ID: 1002240578

View in Genome Browser
Species Human (GRCh38)
Location 5:177836602-177836624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002240572_1002240578 -4 Left 1002240572 5:177836583-177836605 CCAGGACAGTTCCATAGAACAGG No data
Right 1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG 0: 2
1: 0
2: 2
3: 26
4: 334
1002240570_1002240578 -2 Left 1002240570 5:177836581-177836603 CCCCAGGACAGTTCCATAGAACA No data
Right 1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG 0: 2
1: 0
2: 2
3: 26
4: 334
1002240571_1002240578 -3 Left 1002240571 5:177836582-177836604 CCCAGGACAGTTCCATAGAACAG No data
Right 1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG 0: 2
1: 0
2: 2
3: 26
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002240578 Original CRISPR CAGGGTGACCAGAGACAGGT GGG Intergenic
900457786 1:2785826-2785848 AAAGATGGCCAGAGACAGGTAGG + Exonic
900616148 1:3566557-3566579 GACGCTGCCCAGAGACAGGTGGG - Intronic
900913674 1:5619713-5619735 CAGGGTGACCAGATATTGCTGGG + Intergenic
901749765 1:11398697-11398719 CAGGGAGACCAGAGATACTTTGG - Intergenic
901908620 1:12436335-12436357 CATGTGGACAAGAGACAGGTGGG + Intronic
903013505 1:20346996-20347018 CAGGCTGGTCATAGACAGGTGGG - Intronic
903243863 1:22001726-22001748 CAGGGAGCACACAGACAGGTTGG - Intronic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904750786 1:32740670-32740692 CCGTGTGACCAGAGTCAGATTGG + Intergenic
905302920 1:36997809-36997831 AAGGGTGACCAGATACAGCCTGG + Intronic
905328273 1:37173976-37173998 GAGGGAGGCCAGAGACAGGCTGG + Intergenic
905730518 1:40296150-40296172 CAGTTTGACCAGAAACAGCTAGG + Intergenic
906129255 1:43446295-43446317 CAGGAAGGCGAGAGACAGGTGGG - Intronic
907200134 1:52719313-52719335 CTGGATGGCCAGAGACAGGTAGG - Intergenic
907278928 1:53332343-53332365 CAGGGGGACAAGAGCCAGGGAGG + Intergenic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
907459384 1:54596274-54596296 CAGAGAGACCACAGACAGGGTGG - Intronic
907572622 1:55497975-55497997 CAGGGTGACCAGTGAAGGGCTGG - Intergenic
911381286 1:97118255-97118277 CAGGGTGCCCAGAGTCTGGGTGG - Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913346833 1:117818050-117818072 CAGAGTGACCAAAGACATATGGG + Intergenic
913966775 1:143383306-143383328 AAGGGTGACACGAGACAGGAAGG + Intergenic
914061152 1:144208913-144208935 AAGGGTGACACGAGACAGGAAGG + Intergenic
914117998 1:144757456-144757478 AAGGGTGACACGAGACAGGAAGG - Intergenic
914247653 1:145897766-145897788 CAGGGTGACCTGAGACAGACTGG - Intronic
914676102 1:149908594-149908616 CAGGGTGATGAGAGAAGGGTGGG - Intronic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
921703925 1:218298299-218298321 AAGGGTGACCAGAGATATCTGGG - Intronic
922504805 1:226120363-226120385 CAGGGTGAGCTGAGGCTGGTGGG + Intergenic
923467835 1:234265066-234265088 CAGGGAGACATGAGACAGGAGGG - Intronic
923507686 1:234620409-234620431 CAGGGTGGCAGGAGACAGCTGGG + Intergenic
923511541 1:234657850-234657872 CAGGGTGATCTGAGACATGGTGG + Intergenic
924897936 1:248362404-248362426 GAGGATGACCACAGTCAGGTGGG - Exonic
924909063 1:248489328-248489350 GAGGATGACCACAGTCAGGTGGG - Exonic
924915042 1:248558730-248558752 GAGGATGACCACAGTCAGGTGGG + Exonic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1065681518 10:28238630-28238652 CAGGGTGTCCGGAGAGCGGTGGG - Exonic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1068631156 10:59298938-59298960 TAGGGTTACCAGAGGCTGGTGGG + Intronic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1070333252 10:75432591-75432613 CAGGGTGTGCAGGGAAAGGTGGG - Intronic
1075347792 10:121697019-121697041 GAGGAAGACCAGAGACAGATGGG - Intergenic
1075852400 10:125599957-125599979 CATGCTGTCCTGAGACAGGTGGG + Intronic
1076110316 10:127855089-127855111 CAGGGTGGGCAGACACAGGTTGG - Intergenic
1076870296 10:133189598-133189620 CACGGAGTCCAGACACAGGTAGG - Exonic
1077018780 11:408265-408287 CTGGGTGAACCCAGACAGGTGGG - Intronic
1077218298 11:1404274-1404296 CACGGGGCCCAGAGACAGGAGGG - Intronic
1077287246 11:1773077-1773099 GAGGGTGTCCAGGCACAGGTGGG + Intergenic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1077737804 11:4809693-4809715 CAGGGAGACCTGAGAAAGGTAGG - Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1078884888 11:15490199-15490221 CAAGGTGAAGAGGGACAGGTGGG + Intergenic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082614147 11:55338069-55338091 CAGGGAGAACAGAAACAAGTTGG - Intergenic
1082655841 11:55856316-55856338 CATAGTGACCACAGTCAGGTGGG - Intergenic
1083299704 11:61733993-61734015 CAGAGAGACCAGAGCCAGGTGGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083712613 11:64558536-64558558 GAGGGTGACTAGAGAGAGCTTGG - Intronic
1083771324 11:64869325-64869347 GAGGGAGACCACAGCCAGGTGGG + Intronic
1084317564 11:68354281-68354303 GTCGGTGACCAGAGACTGGTTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084570003 11:69953616-69953638 CTGGGTGCCCTGTGACAGGTGGG - Intergenic
1085389725 11:76176259-76176281 CAGGCTGCCCAGGGACAGGCAGG + Intergenic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1091439166 12:499185-499207 AAGAGTGACCACAGCCAGGTAGG - Intronic
1091501115 12:1018970-1018992 CATGGAAACCAGAGACAGCTTGG + Intronic
1091899244 12:4131445-4131467 GAGGGTCACTTGAGACAGGTAGG - Intergenic
1092534478 12:9375603-9375625 CAGGCTGACCTCAGACACGTGGG - Intergenic
1092900146 12:13051606-13051628 CAGTCTGACCAGAGAAAGGGAGG - Intronic
1096055165 12:48644564-48644586 CCAGGTGACAAGAAACAGGTAGG - Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102107268 12:110336141-110336163 CATGGTGATGACAGACAGGTAGG - Intronic
1103724037 12:122989157-122989179 GAGGGTCACCAGAGTCAGGAAGG - Intronic
1104729611 12:131097723-131097745 CGGAGAGACCAGAGACAGGCAGG + Intronic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107012228 13:35680552-35680574 CAGGGTGGCCAAAGTCAGGGTGG + Intergenic
1110518188 13:76441543-76441565 CAAGCTGACCAGAAACATGTTGG - Intergenic
1113919865 13:113901096-113901118 CAGGCTCACCTGAGACAGGAAGG + Intergenic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1115959194 14:38815925-38815947 CAAGGTGAACAGAGTCATGTAGG + Intergenic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119898733 14:78242637-78242659 CAGGGAGGCCAGGGACAGGGAGG - Intronic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1122191465 14:100047354-100047376 CAGGGAGTCCAGAGATAGATAGG - Intronic
1122298000 14:100716284-100716306 GAAGCTGCCCAGAGACAGGTGGG - Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1123449343 15:20350281-20350303 CAGGGTGACCAGATGCTGGCCGG - Intergenic
1124718783 15:32093645-32093667 CCAGGTGAACAGAGGCAGGTGGG - Intronic
1124892322 15:33744714-33744736 CAGGGAGGCAAGAGACAGTTTGG + Intronic
1124906440 15:33872918-33872940 CAGGGTGAAGGGACACAGGTCGG - Intronic
1125407150 15:39364591-39364613 TAGGGTGACCATATATAGGTTGG + Intergenic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1125932181 15:43608188-43608210 CAGGGTGCCCAGAGCCCTGTGGG + Exonic
1125945279 15:43707662-43707684 CAGGGTGCCCAGAGCCCTGTGGG + Intergenic
1127450352 15:59110468-59110490 AAGGCTGACCAGAGACAGGCAGG - Intronic
1128064463 15:64755758-64755780 CAGGCTGACCAGCCACATGTAGG + Intronic
1128215137 15:65929689-65929711 CAGGGTGGGGAGGGACAGGTTGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1130992931 15:88887309-88887331 CAGGGTGACCCGGGCCAGGCTGG + Exonic
1132467960 16:86313-86335 CAGGGTGGCCACAGACTGGGGGG + Exonic
1132830728 16:1926766-1926788 GAGGGTGGCCAGAACCAGGTGGG - Intergenic
1133277294 16:4646702-4646724 CAGTCTGCCCAGAGACATGTCGG + Intronic
1133384915 16:5361765-5361787 CAGGCTCACCTGAGACAGCTGGG - Intergenic
1134073183 16:11273175-11273197 GAGGGGAACCAGAGACAGGGAGG + Intronic
1134235148 16:12459443-12459465 TAGGGAGCCCAGAGACAGGCTGG + Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1134666037 16:16019479-16019501 CAGGGTAAACAGAGTCTGGTTGG + Intronic
1135105495 16:19645765-19645787 CTGGGTGACCTGAGTCAGGAGGG + Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136287542 16:29253319-29253341 CAGGGTGTCCCGAGACAGCCAGG - Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1138560551 16:57798374-57798396 CTGGGTAACCAGCGACCGGTGGG - Intronic
1139891117 16:70253741-70253763 CAGGATGACAAGAGGCTGGTTGG + Exonic
1139927817 16:70501058-70501080 CAGGGTGACCTCAGTCAGGATGG + Exonic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1140899386 16:79353945-79353967 CATGGAGACCAGAGATAAGTGGG + Intergenic
1141398216 16:83723602-83723624 GGGAGTGACCAGTGACAGGTGGG - Intronic
1141764341 16:86048623-86048645 CACGGTGCCAAAAGACAGGTTGG - Intergenic
1141932292 16:87214065-87214087 GAGGGAGAGCAGAGACAAGTTGG + Intronic
1142078304 16:88133039-88133061 GAGGGTCACCACACACAGGTTGG + Intergenic
1142093163 16:88225948-88225970 CAGGGTGTCCTGAGACAGCCAGG - Intergenic
1142942877 17:3397661-3397683 CAGTGACACCACAGACAGGTGGG + Exonic
1143461644 17:7108161-7108183 AGGGGTGGCCAGAGAGAGGTGGG - Intronic
1144807616 17:17978188-17978210 AGGGGTGACCAAAGACAGGCTGG + Intronic
1144949133 17:18984700-18984722 CAGGCCAACCAGAGACAGGCTGG - Intronic
1145233255 17:21190459-21190481 CAGGATGGCCAGACAGAGGTGGG - Intronic
1146056627 17:29584651-29584673 CAGGGTTTCCTGAGACAGGGTGG - Intronic
1146299428 17:31676655-31676677 AAAGGTGAGTAGAGACAGGTGGG + Intergenic
1147255344 17:39177882-39177904 CAGGGTGACCAGGAACACCTGGG - Intronic
1147452051 17:40511869-40511891 CACCCTGACCAGAGACAGCTGGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149500213 17:57146759-57146781 CAGGATGGGCAGAGACAGGGAGG - Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1151561274 17:74871128-74871150 CAGCGTGAGCCGAGGCAGGTGGG - Intronic
1151943356 17:77306209-77306231 CATGGTGATCAGATACAGGGAGG + Intronic
1152330495 17:79669912-79669934 CAGGGTGACCAGAGAAACTTGGG + Intergenic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1154355981 18:13623592-13623614 CACGATGACCAGAGGCAGCTCGG + Intronic
1155390348 18:25329203-25329225 CAAGGTGACCAGGCACAGCTTGG + Intronic
1156928967 18:42617916-42617938 CAAGGAGACAGGAGACAGGTTGG - Intergenic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1159291988 18:66434935-66434957 CAGGGTTCCCACACACAGGTAGG - Intergenic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1160086040 18:75778310-75778332 CTGGGTGTCCAGTGCCAGGTGGG + Intergenic
1160696146 19:485551-485573 AAGGGTGATCAGAGAATGGTGGG + Intergenic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161533722 19:4805768-4805790 CAGGCAGACCATAGACATGTGGG + Intergenic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1163066393 19:14799387-14799409 CAAGGTGACCACTGAGAGGTGGG + Exonic
1163233471 19:16018601-16018623 CAGTGTGAGCAGGTACAGGTCGG + Intergenic
1164611132 19:29632442-29632464 GAGGGTGACCACAGAAAGGCAGG - Intergenic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1167368553 19:49067059-49067081 CACAGTGACAAGAGACAGGTTGG - Intergenic
1167485777 19:49762142-49762164 CAGGTTGAGCAGTGACACGTTGG + Exonic
1167508025 19:49881364-49881386 CTGGGTCACCAGAACCAGGTAGG - Exonic
1167576975 19:50322499-50322521 CATGGAGACCAGAGAGAGATGGG - Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1202700559 1_KI270712v1_random:160801-160823 AAGGGTGACACGAGACAGGAAGG + Intergenic
925174642 2:1773851-1773873 TAGGGTGACAAGTGACAGGAAGG - Intergenic
925421485 2:3716315-3716337 CTGGGTGATGAGAGACAGGGTGG + Intronic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926225823 2:10966281-10966303 CAGGCTGAGCAGAGACACATGGG - Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
926598677 2:14818097-14818119 CAGATGGAGCAGAGACAGGTGGG - Intergenic
926606709 2:14905494-14905516 CAGGGGCACCAGAGAGAGTTGGG - Intergenic
927508378 2:23629053-23629075 CGCGGTGACCAGAAACAGGCAGG + Intronic
928488203 2:31754194-31754216 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
931146714 2:59527253-59527275 CAGAGTGAGCAGGGACAGGGTGG - Intergenic
931324828 2:61209551-61209573 CAGCGTCATCAGAGACATGTGGG - Intronic
934171486 2:89544274-89544296 AAGGGTGACATGAGACAGGAAGG + Intergenic
934188877 2:89767339-89767361 CAGGGAACCCATAGACAGGTAGG + Intergenic
934281795 2:91618592-91618614 AAGGGTGACATGAGACAGGAAGG + Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
938771751 2:134506806-134506828 TTGGGGGACCAGAGACGGGTGGG + Intronic
938943314 2:136188304-136188326 CTGGGTGACCGTGGACAGGTAGG + Intergenic
940594788 2:155776658-155776680 CTGGGAGAACAGAGACAAGTAGG - Intergenic
941003903 2:160227794-160227816 CAGGGTGACCAGATCCAACTTGG + Intronic
941070800 2:160952264-160952286 CATGGAGACTAGAGAAAGGTTGG - Intergenic
943531209 2:189083275-189083297 TTGAGTGACAAGAGACAGGTGGG + Intronic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
948090790 2:235293131-235293153 GAGGGTTGCCAGAGACAGGGAGG - Intergenic
948154657 2:235771449-235771471 CAGGGTGACCTAAGGCATGTGGG + Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1172103074 20:32497329-32497351 CAGGCTGACAAGAGTCAGGGTGG + Intronic
1172111526 20:32548158-32548180 CAAGTTGCCCAAAGACAGGTGGG + Intronic
1172884482 20:38222166-38222188 AAGGGTGACCAGAAATGGGTAGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173374037 20:42467054-42467076 CAGGGAGACCAAAAACAGGGAGG + Intronic
1173988897 20:47284557-47284579 CAAGGTGAGCCGAGACAGGTGGG - Intronic
1174127499 20:48317714-48317736 CAGGGTGCTCAGAGACTCGTTGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175883456 20:62274031-62274053 GAGGGCCACCAGAGACAGGAGGG - Intronic
1176069186 20:63217195-63217217 CAGGGTGAACAGTGACAGCAGGG + Intergenic
1178601564 21:33999194-33999216 CAGGGTGACAAGGGACAGTGGGG - Intergenic
1179293671 21:40042076-40042098 CAGGGAGAACACAGCCAGGTCGG + Intronic
1179348389 21:40583498-40583520 GAGGGTGGGAAGAGACAGGTGGG - Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182131532 22:27856535-27856557 CAAGGGGTCCAGAGATAGGTAGG + Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1183058722 22:35322472-35322494 CAGGGCGGCCAGACACACGTGGG + Intronic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183255581 22:36759474-36759496 CAGGGTGCACAGGGACAGGCTGG + Intronic
1183678149 22:39311207-39311229 CAGGGTGGACAGACACACGTGGG + Intergenic
1183801564 22:40169580-40169602 GAGGGTGGCTAGAGACAGCTGGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184669324 22:46004511-46004533 CAGGGTGGCCAGAGACCCTTTGG - Intergenic
950629795 3:14274873-14274895 AAGGTTGACCAAGGACAGGTTGG + Intergenic
950711418 3:14815677-14815699 CACGGTGACCAGAAACAGCTGGG - Intergenic
951537903 3:23756336-23756358 CAGGGAGACTGGAGGCAGGTGGG - Intergenic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
951912889 3:27769754-27769776 GATGGTGATCAGAGACAGGAAGG - Intergenic
952956775 3:38562520-38562542 CAGGCTGACCAGAGAGACCTGGG + Exonic
954087787 3:48259595-48259617 CAGGGTAATCAGAGGCAGCTGGG + Intronic
956304078 3:67805078-67805100 CAGAGTGAGCAGAGACTGCTTGG + Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
958985067 3:100770804-100770826 CACGGTGACCACAGTGAGGTTGG + Exonic
960228240 3:115192638-115192660 CAGGAAGAAGAGAGACAGGTAGG - Intergenic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
965520896 3:169667426-169667448 CTGGGTGACCAGAGCTAGGCAGG + Intergenic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
967894088 3:194383041-194383063 CAGGGAGACCAGAGCCATCTGGG - Intergenic
967972858 3:195012150-195012172 CAGGGTGGCCAAGGACAGGAGGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968605195 4:1532108-1532130 GAGGGTGACCGGAGAAAGGGAGG + Intergenic
969528208 4:7714907-7714929 AAGGATGGACAGAGACAGGTAGG - Intronic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970439930 4:16071891-16071913 CAGGGTGATCAGAGGAAGTTAGG - Intronic
972109818 4:35543403-35543425 CAGGAAGACCACAGACAGTTGGG - Intergenic
972337421 4:38119847-38119869 CAGGCTGACCACAGACTGGAGGG + Intronic
976768061 4:88619105-88619127 CAGGATGACCAGCCACAGGAAGG - Intronic
978459972 4:108940627-108940649 CAGGGTGACCAAGGACAGGCAGG - Exonic
981574464 4:146190295-146190317 CAGGGGGACCACTGACAGGAGGG - Intronic
982542762 4:156695096-156695118 AAAGGTGAACAGAGACAGGCAGG + Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
986269226 5:6216897-6216919 CAGGGTGGCCAGAAGCATGTAGG + Intergenic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
989201743 5:38770626-38770648 CAGGGAGAGCAGAGAAGGGTGGG + Intergenic
989268320 5:39503307-39503329 CAGGGAGCCCACAGACAGATTGG - Intergenic
989404174 5:41042087-41042109 CTGGGGGATCAAAGACAGGTGGG - Exonic
990098779 5:52156486-52156508 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
990566484 5:57034754-57034776 CAGGTAGAGCAGAGACTGGTGGG - Intergenic
993994855 5:94710680-94710702 CATGATGAAAAGAGACAGGTTGG - Intronic
994240507 5:97414637-97414659 CAGGGTCTCCAGAGTCATGTGGG - Intergenic
994753754 5:103769659-103769681 CCAGGTGACCAAGGACAGGTGGG + Intergenic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
996952581 5:129145656-129145678 GATGGTTACCAGAGACTGGTAGG - Intergenic
997030045 5:130117046-130117068 CTGGGTGACAAGAGATTGGTAGG - Intronic
998183618 5:139962350-139962372 AAGGGTGATCAGAGCCAGCTTGG + Intronic
998294346 5:140952632-140952654 CTGGGTAACCAGGCACAGGTTGG - Intronic
998967894 5:147560488-147560510 TAGGGTGGGCAGAGACAGCTAGG - Intergenic
999233820 5:150078669-150078691 CAGGGCGGTCAGAAACAGGTTGG - Intronic
999695131 5:154182058-154182080 GAGGCTGACCAGGTACAGGTGGG + Intronic
999774958 5:154804710-154804732 CAGGGTCAGCAGATACAGGTTGG - Intronic
1000112070 5:158117747-158117769 GAGGGTGACAGGAGACAGGTTGG + Intergenic
1000364227 5:160476307-160476329 CTGGGTGACCAGGGACAGGTGGG + Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003030562 6:2597086-2597108 CTCAGTGACCAGAGGCAGGTTGG - Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1005532620 6:26722738-26722760 CAGGGTGACTAAAGAGAGGGTGG - Intergenic
1005535784 6:26754865-26754887 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005538175 6:26778927-26778949 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007919404 6:45592826-45592848 CTTGGGGACCAGAGACAGATAGG - Intronic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1010010312 6:71041046-71041068 AAGGGTCCCCAGAGACAGGACGG - Intergenic
1010936110 6:81863874-81863896 CAGGGAGACCAGAGACACTTTGG - Intergenic
1011299009 6:85854198-85854220 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1012978638 6:105806894-105806916 CAGGGTGACAGGAGGCAGTTTGG - Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1016321600 6:142852628-142852650 CAGGGTGTCCTGAGACATCTGGG - Intronic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1019148147 6:169987551-169987573 CGGGGTGTCCAGCGACAGGGTGG + Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019466769 7:1193965-1193987 CAGGGTGTCCTGAGAGAGGTAGG - Intergenic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1020445461 7:8262402-8262424 CAGGGTGACCGGGGGAAGGTGGG + Intronic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022797842 7:33746402-33746424 CAAGGAGACAAGAGAGAGGTCGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024813077 7:53236052-53236074 CAGGGTGATCAGACACAATTTGG - Intergenic
1026455482 7:70568742-70568764 CAGGGAGACCAGAGCCAACTGGG + Intronic
1029850924 7:103461150-103461172 AAGGGCAACCAGAGAGAGGTCGG - Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034165264 7:149020602-149020624 CAGGGTGGCCTGAGACAGGTCGG + Intronic
1034748341 7:153544292-153544314 AAGGGTCACTAGAGACAGATTGG - Intergenic
1035030691 7:155856701-155856723 CAGGGAGACCATGGAAAGGTAGG - Intergenic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035079557 7:156204651-156204673 CAGGGTCATCATATACAGGTTGG - Intergenic
1035122494 7:156579890-156579912 GCAGGTGACCAGAGGCAGGTGGG + Intergenic
1035969212 8:4228488-4228510 CTGGAAGACCAGAGACAGTTGGG - Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1040489766 8:47909086-47909108 CAGGGTGACCAGACACTGCCTGG - Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043487718 8:80714797-80714819 GAGGGTGGCAAGAGGCAGGTAGG + Intronic
1044288639 8:90441007-90441029 CATGGTGATCAGAGTCAGCTAGG - Intergenic
1044572522 8:93735265-93735287 CAGGGTCACTAGAGAGAGATAGG - Exonic
1044855390 8:96470021-96470043 CAGGGTAACCAGGGACAGCCTGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1048215084 8:132486769-132486791 CAGGGAGACCACAGTCAGGATGG - Intergenic
1048856860 8:138693680-138693702 CAGGGTGCCAAGGGACAGGAAGG - Exonic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1053728996 9:41033488-41033510 GAGGGTGAGAAGAGACAAGTTGG + Intergenic
1054699516 9:68398595-68398617 GAGGGTGAGAAGAGACAAGTTGG - Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055583569 9:77732851-77732873 CAGGGAGAGCAGGGACAGGGTGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057088526 9:92234635-92234657 CAGGGTAACCTGAGACAGCCAGG + Intronic
1058395847 9:104553112-104553134 GAGGGTGACAGGAGACTGGTAGG + Intergenic
1059431045 9:114250498-114250520 CTGGGTGACCAGGCACGGGTGGG + Intronic
1060999135 9:127892884-127892906 CAGGGGGACTAGAGAATGGTTGG - Intronic
1060999492 9:127895041-127895063 GAGGATGTCTAGAGACAGGTGGG + Intronic
1062055861 9:134469513-134469535 CAGGGAGAGAAGAGACAGGGAGG - Intergenic
1062187132 9:135224104-135224126 CAGGGTGCCCATAGGCGGGTGGG - Intergenic
1186181400 X:6976496-6976518 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1188676731 X:32950740-32950762 CAGAAGGACCGGAGACAGGTAGG + Intronic
1189901512 X:45711715-45711737 CAGGGAGATAAGAGTCAGGTTGG + Intergenic
1191153175 X:57242604-57242626 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1196514308 X:116551231-116551253 CAGGCTGACTGGAGACACGTGGG - Intergenic
1197393329 X:125895533-125895555 CAGGGTGGGTAGAGAAAGGTAGG + Intergenic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1199911876 X:152295669-152295691 GAGGGTGACCCGAAACAGGGCGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200110929 X:153740576-153740598 CAGGGAGCCCACAGACATGTAGG - Exonic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200829436 Y:7676913-7676935 CAGTGTGACAGGGGACAGGTGGG - Intergenic
1200951842 Y:8905240-8905262 CAGTGTGACAGGGGACAGGTGGG + Intergenic