ID: 1002240706

View in Genome Browser
Species Human (GRCh38)
Location 5:177837399-177837421
Sequence CTCCTGGTCAACCATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002240706_1002240713 -6 Left 1002240706 5:177837399-177837421 CCTGCCACATGGTTGACCAGGAG No data
Right 1002240713 5:177837416-177837438 CAGGAGCTTGGGGATCAGGTTGG 0: 2
1: 0
2: 0
3: 30
4: 346
1002240706_1002240715 26 Left 1002240706 5:177837399-177837421 CCTGCCACATGGTTGACCAGGAG No data
Right 1002240715 5:177837448-177837470 AGATGTTGACAAAGGAGAGATGG 0: 2
1: 0
2: 5
3: 47
4: 495
1002240706_1002240716 27 Left 1002240706 5:177837399-177837421 CCTGCCACATGGTTGACCAGGAG No data
Right 1002240716 5:177837449-177837471 GATGTTGACAAAGGAGAGATGGG 0: 2
1: 0
2: 2
3: 25
4: 305
1002240706_1002240714 18 Left 1002240706 5:177837399-177837421 CCTGCCACATGGTTGACCAGGAG No data
Right 1002240714 5:177837440-177837462 GATGAAGCAGATGTTGACAAAGG 0: 2
1: 0
2: 2
3: 31
4: 302
1002240706_1002240711 -10 Left 1002240706 5:177837399-177837421 CCTGCCACATGGTTGACCAGGAG No data
Right 1002240711 5:177837412-177837434 TGACCAGGAGCTTGGGGATCAGG 0: 2
1: 0
2: 0
3: 21
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002240706 Original CRISPR CTCCTGGTCAACCATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr