ID: 1002243612

View in Genome Browser
Species Human (GRCh38)
Location 5:177863984-177864006
Sequence GCCGCACTCAGCCCTCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002243600_1002243612 22 Left 1002243600 5:177863939-177863961 CCCCTTTGCTGGACTCACGGCAG No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243607_1002243612 -6 Left 1002243607 5:177863967-177863989 CCCCATCTACTTGGCCTGCCGCA No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243609_1002243612 -8 Left 1002243609 5:177863969-177863991 CCATCTACTTGGCCTGCCGCACT No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243608_1002243612 -7 Left 1002243608 5:177863968-177863990 CCCATCTACTTGGCCTGCCGCAC No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243598_1002243612 25 Left 1002243598 5:177863936-177863958 CCGCCCCTTTGCTGGACTCACGG No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243601_1002243612 21 Left 1002243601 5:177863940-177863962 CCCTTTGCTGGACTCACGGCAGG No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1002243603_1002243612 20 Left 1002243603 5:177863941-177863963 CCTTTGCTGGACTCACGGCAGGG No data
Right 1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG 0: 2
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002243612 Original CRISPR GCCGCACTCAGCCCTCTTGT GGG Intergenic
900636212 1:3667028-3667050 CCCTCTCTCACCCCTCTTGTGGG - Intronic
901471379 1:9458939-9458961 ACCACACTCAGCCCACTTTTTGG + Intergenic
901651884 1:10747687-10747709 CCCCCACTCTGCTCTCTTGTGGG + Intronic
902703646 1:18190030-18190052 GCCACCCTCAGCCCTCTTCCTGG + Intronic
904774476 1:32898304-32898326 CCCACACTCAGGCCTCCTGTGGG + Exonic
915447039 1:155979721-155979743 GCCCAACTCAGCACTCTTGTAGG + Intronic
915873486 1:159587445-159587467 GCTGAGCTCAGCCCTCTTGTGGG - Intergenic
1062825869 10:568152-568174 GCCGCACTCCTCCCTTTTGGGGG - Intronic
1064416445 10:15154200-15154222 GCCCCACTCATCCCTCCTGCTGG - Intronic
1070551710 10:77495454-77495476 GCCACAGTCAGCCCTCTGGGTGG - Intronic
1074538590 10:114346255-114346277 GCGGCACTCAGCTCTCTTGCTGG + Intronic
1076645214 10:131949036-131949058 CCCGCACACAGCCCTCGTGGAGG - Intronic
1077164140 11:1127535-1127557 CCCCCACCCTGCCCTCTTGTTGG + Intergenic
1077270360 11:1675028-1675050 TCCGCACGGAGCCCTCTTCTTGG + Intergenic
1085338111 11:75712853-75712875 GCCGCACACTGTCCTGTTGTTGG + Intergenic
1093595041 12:20949568-20949590 CCAGCCCTCAGCCTTCTTGTAGG - Intergenic
1095790153 12:46158142-46158164 GCCCCACTCAGACCTTTGGTAGG + Intergenic
1100207220 12:92363791-92363813 GCTGCACAGACCCCTCTTGTTGG - Intergenic
1102986179 12:117280503-117280525 ACCTCACTCAGCCCTCCTGATGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1108692012 13:52867706-52867728 GCCTCACTCATCACTCTTGCAGG - Intergenic
1112756900 13:102645847-102645869 GCCACACTCAGCCCTCCTCCTGG - Intronic
1122143417 14:99675448-99675470 GCCGAACTCGGCTCTCTTGACGG - Exonic
1125394533 15:39232627-39232649 GCAGGACTCAGGCCTCTTCTTGG + Intergenic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1129386048 15:75196599-75196621 GCCTGACTCAGCCCTGTGGTGGG + Intronic
1132629604 16:910811-910833 GCCGCCCTCTGTCCTCCTGTCGG - Intronic
1133597811 16:7310051-7310073 GCCTCACCCAGCCCTATTGAGGG + Intronic
1136459058 16:30398599-30398621 GCCACACTCAGGGCACTTGTGGG - Exonic
1136477902 16:30524835-30524857 GCCGCACTCAGGGCACTTGAAGG + Exonic
1136518676 16:30782852-30782874 GCCGCACTCGGGGCACTTGTAGG + Exonic
1136518715 16:30783104-30783126 GCCGCACTCTGGGCACTTGTAGG + Exonic
1136924175 16:34356160-34356182 GATGCACCCAGTCCTCTTGTTGG - Intergenic
1136980398 16:35055646-35055668 GATGCACCCAGTCCTCTTGTTGG + Intergenic
1138538245 16:57671622-57671644 ACCGCACTCAGCCTTCCTGGCGG + Intronic
1142338678 16:89507068-89507090 TCCGCCCTCAGCCCTCCAGTGGG - Intronic
1153049654 18:889785-889807 TCCACACTGAGCCCTCTTTTTGG + Intergenic
1162088099 19:8260658-8260680 GCCGCACCCAGCCTTCCTGCTGG - Intronic
1168315360 19:55482551-55482573 GCCGCACTCGGCACATTTGTAGG - Exonic
1168474128 19:56663927-56663949 GCCGCACTCGCCGCACTTGTAGG + Exonic
1168681651 19:58320191-58320213 GCCACACTCATTCCACTTGTAGG - Intergenic
1168689522 19:58368418-58368440 GCCGCACTCGGCGCACTCGTAGG + Exonic
926335444 2:11859264-11859286 GCTGCACTCTCCCCCCTTGTTGG - Intergenic
927575707 2:24200477-24200499 CCCACACTCAGCCCTCCTGCTGG - Intronic
928242108 2:29595607-29595629 GCCGCGCCCAGCCGTCTTATTGG + Intronic
936925939 2:117736928-117736950 GCAGAACTCAGCCCTTTTCTTGG - Intergenic
937258145 2:120569055-120569077 TCCCCACTCAGCCCTCCTGCTGG + Intergenic
940637783 2:156319790-156319812 GCCGCTCGCTGCCCTCTTCTCGG - Intergenic
943070740 2:183137631-183137653 GCCACACTCAGCCCTGTTTTTGG - Intronic
944414197 2:199467192-199467214 GACGCCCAGAGCCCTCTTGTTGG + Intronic
945317988 2:208391497-208391519 GCAGCTCTCAGCCTTCCTGTAGG - Intronic
946195425 2:218030036-218030058 GCCCCACTCAGCCCTCTCCCTGG + Intergenic
946199854 2:218065199-218065221 GCCCCACTCAGCCCTCTCCCTGG + Intronic
946516676 2:220419465-220419487 GCCGCACTCCAGGCTCTTGTGGG + Intergenic
1173429811 20:42977038-42977060 GCCTGACTTAGCCCTCTTATGGG + Intronic
950104256 3:10378349-10378371 GCCGCCCTCGGCACTCTTGAGGG + Exonic
950489898 3:13297860-13297882 GCTGCACACTGCCCTCTTGGAGG + Intergenic
952080422 3:29751792-29751814 GCAGCACTCAAACCCCTTGTGGG + Intronic
953890767 3:46750353-46750375 GCCGCCCTCAGGCCTCTCATAGG - Intronic
956722465 3:72130484-72130506 ACCCCACTCAGGCCTCTTGCTGG + Intergenic
958053299 3:88376874-88376896 GCAGCACTCAATACTCTTGTTGG + Intergenic
983382411 4:167014169-167014191 GCCTTTCTCAGCCCTCTAGTAGG + Intronic
984691294 4:182729013-182729035 GCCAGAATCAGCCCTATTGTCGG + Exonic
984803225 4:183733362-183733384 GCCTCTCTCTGCCCTCCTGTGGG + Intergenic
988686139 5:33527269-33527291 GCAGCACTCAGCCCTCACGGTGG + Exonic
990425330 5:55682541-55682563 GCCTCAATCAGTCCTCATGTTGG - Intronic
992262531 5:74985754-74985776 GCCCCTCTGAGCCCTCTTCTTGG + Intergenic
992838959 5:80668451-80668473 GCTGCCCTCAGCCCTCTCCTTGG + Intronic
1001973820 5:175979795-175979817 GCCGCACTCAGCCCTCTTGTGGG - Intronic
1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG + Intergenic
1009778362 6:68235680-68235702 GCCTCTCTCTGCCCTCTTGCAGG - Intergenic
1010621739 6:78085354-78085376 GCTGCACTCAAACCTCTTGAAGG + Intergenic
1013983792 6:116165719-116165741 GCCGCACTTCCCCCTCTTCTAGG + Intronic
1023907105 7:44530902-44530924 ACCCCACTCAGCCCTGTTGTGGG + Intronic
1029894017 7:103962442-103962464 GCCTCACTCATTCCTCTTGGTGG - Intronic
1032328744 7:130957321-130957343 GCCACCCTGAGCCCTCTTGCTGG - Intergenic
1037596861 8:20361568-20361590 GTCCAACTGAGCCCTCTTGTTGG + Intergenic
1049554790 8:143276470-143276492 GCCGCACTCGCCGCACTTGTAGG - Exonic
1049799207 8:144510004-144510026 GCCTCACTCACCCAGCTTGTAGG - Exonic
1056581585 9:87890669-87890691 GCAGCCCTCTGCCCTCTTCTAGG + Intergenic
1059433501 9:114263564-114263586 GCCGCTCTCATCCCCCATGTGGG - Intronic
1188526512 X:31093742-31093764 GCTGCACTCAAACCGCTTGTGGG + Intergenic
1189303011 X:39966461-39966483 GCTGCAGTGAGCCCTCGTGTTGG + Intergenic
1201867893 Y:18673933-18673955 GCAGCAATGAGCCCTCATGTTGG + Intergenic