ID: 1002252175

View in Genome Browser
Species Human (GRCh38)
Location 5:177936673-177936695
Sequence TCTCATCTGCACCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002252175_1002252181 9 Left 1002252175 5:177936673-177936695 CCGTCCTCCTGGTGCAGATGAGA No data
Right 1002252181 5:177936705-177936727 AACGCCAACAGAAGGGCCTCTGG No data
1002252175_1002252180 2 Left 1002252175 5:177936673-177936695 CCGTCCTCCTGGTGCAGATGAGA No data
Right 1002252180 5:177936698-177936720 CTCTTTAAACGCCAACAGAAGGG No data
1002252175_1002252179 1 Left 1002252175 5:177936673-177936695 CCGTCCTCCTGGTGCAGATGAGA No data
Right 1002252179 5:177936697-177936719 CCTCTTTAAACGCCAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002252175 Original CRISPR TCTCATCTGCACCAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr