ID: 1002252608

View in Genome Browser
Species Human (GRCh38)
Location 5:177939059-177939081
Sequence GCTGCTGGGGAGCCTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002252599_1002252608 14 Left 1002252599 5:177939022-177939044 CCTCTGAGAAATGGCTGGGGGTG No data
Right 1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG No data
1002252594_1002252608 20 Left 1002252594 5:177939016-177939038 CCTCTGCCTCTGAGAAATGGCTG No data
Right 1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002252608 Original CRISPR GCTGCTGGGGAGCCTGGAGC TGG Intergenic
No off target data available for this crispr