ID: 1002254602

View in Genome Browser
Species Human (GRCh38)
Location 5:177949872-177949894
Sequence GGCCCCCGTGGACCAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002254596_1002254602 1 Left 1002254596 5:177949848-177949870 CCAGGAGACCTGGCCAGCTGCAG No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254589_1002254602 14 Left 1002254589 5:177949835-177949857 CCCCCTCCGACTCCCAGGAGACC No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254594_1002254602 8 Left 1002254594 5:177949841-177949863 CCGACTCCCAGGAGACCTGGCCA No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254587_1002254602 20 Left 1002254587 5:177949829-177949851 CCATGGCCCCCTCCGACTCCCAG No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254595_1002254602 2 Left 1002254595 5:177949847-177949869 CCCAGGAGACCTGGCCAGCTGCA No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254586_1002254602 21 Left 1002254586 5:177949828-177949850 CCCATGGCCCCCTCCGACTCCCA No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254598_1002254602 -7 Left 1002254598 5:177949856-177949878 CCTGGCCAGCTGCAGCGGCCCCC No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254590_1002254602 13 Left 1002254590 5:177949836-177949858 CCCCTCCGACTCCCAGGAGACCT No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254592_1002254602 11 Left 1002254592 5:177949838-177949860 CCTCCGACTCCCAGGAGACCTGG No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data
1002254591_1002254602 12 Left 1002254591 5:177949837-177949859 CCCTCCGACTCCCAGGAGACCTG No data
Right 1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002254602 Original CRISPR GGCCCCCGTGGACCAGCAGA GGG Intergenic
No off target data available for this crispr