ID: 1002258632

View in Genome Browser
Species Human (GRCh38)
Location 5:177978587-177978609
Sequence CTGTGGGACTGGAGAGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002258625_1002258632 1 Left 1002258625 5:177978563-177978585 CCGTAGGGTGACTGACAGCAGCC No data
Right 1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG No data
1002258624_1002258632 15 Left 1002258624 5:177978549-177978571 CCTAGGCAGAGAGGCCGTAGGGT No data
Right 1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002258632 Original CRISPR CTGTGGGACTGGAGAGCAGA CGG Intergenic
No off target data available for this crispr