ID: 1002260729

View in Genome Browser
Species Human (GRCh38)
Location 5:177992496-177992518
Sequence GGTGAGCTACTGGAAGAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002260729 Original CRISPR GGTGAGCTACTGGAAGAGAC AGG (reversed) Exonic
900330018 1:2129456-2129478 CGTGGGCTCCTGGAAGAGGCAGG + Intronic
900913343 1:5617575-5617597 GATCAGCTAATGGAAGAGAGGGG + Intergenic
901713516 1:11134619-11134641 GGCGTGATACTGGGAGAGACTGG + Intronic
903316726 1:22513803-22513825 GGAGAGCTTCTGAAAGAGACTGG + Intronic
906591178 1:47025227-47025249 GGTGAGAGACAGGAAGAGAGAGG - Intronic
907640234 1:56181693-56181715 AGTGAACTCCTGGAAAAGACTGG + Intergenic
910543138 1:88383864-88383886 TGTGAGCCACTGTAAGAAACAGG + Intergenic
911032055 1:93499333-93499355 GGGGAGCTAGTAGAAGAGCCTGG + Intronic
911105019 1:94122875-94122897 GATGAGTTACTGGAAGAGGGTGG + Intergenic
912770250 1:112457053-112457075 GGAGAGCTGTTGGGAGAGACTGG - Exonic
913489582 1:119366433-119366455 AGTCAGTTACTGGAAGAGATGGG - Intergenic
914274603 1:146112197-146112219 AGGGAGCTGCTGGAAGAGAAAGG - Exonic
914275136 1:146116915-146116937 AGGGAGCTGCTGGAAGAGAAAGG - Exonic
916367313 1:164046004-164046026 GGTGGGATACAGGAAGAGATTGG - Intergenic
918572966 1:186020729-186020751 GGTGAATTAATGGAAGAGAACGG + Intronic
918885900 1:190193952-190193974 GGTGAGTTAGTGGAAAATACCGG - Intronic
920374303 1:205499166-205499188 GGGGAGCTACTGGAAGCAACTGG + Intergenic
920788486 1:209065367-209065389 CCTGAGCAACTGGAAGAGACAGG + Intergenic
923369939 1:233299752-233299774 GTTTAGCCAATGGAAGAGACAGG - Intergenic
1063240933 10:4168567-4168589 GGGGAACTACAGGAAGAAACTGG - Intergenic
1063430996 10:5988129-5988151 GGTGAGGTGAGGGAAGAGACTGG - Intergenic
1064425527 10:15226014-15226036 GGTAAGCCCCTGGAAGAGGCTGG - Intronic
1065373843 10:25016789-25016811 GGTGAGTTATTGGAGGAGAAAGG + Exonic
1065504501 10:26415751-26415773 GGTGAGCTCCCTGAAGACACCGG - Intergenic
1066128687 10:32368311-32368333 GGTTAGACACTGGGAGAGACAGG - Intronic
1066170281 10:32836131-32836153 GGTGAGATACTGAAAGAGGCAGG + Intronic
1069376004 10:67793746-67793768 GGCGAATTACTGGAAGAGAGCGG - Intergenic
1070651044 10:78236593-78236615 GGTGAGGTACTGGATGTGGCTGG + Intergenic
1071946810 10:90655176-90655198 AGTGTGTTTCTGGAAGAGACTGG - Intergenic
1073852333 10:107635273-107635295 TGTGAGCTCCTTGAGGAGACAGG + Intergenic
1075337552 10:121619139-121619161 GTTGAGCTTCTGGATGAGAGTGG - Intergenic
1077498732 11:2899275-2899297 GCTGAGCCACTGGAAGGGGCTGG - Intronic
1078455349 11:11470619-11470641 GCTGAGATATTGGCAGAGACAGG + Intronic
1078528013 11:12115240-12115262 GGTGACCTAATGAAGGAGACCGG + Intronic
1080651337 11:34225151-34225173 GCTGAGCAATTGGAGGAGACGGG - Intronic
1083252732 11:61478674-61478696 GGTTATCTAGTGGCAGAGACAGG + Intronic
1083763511 11:64831483-64831505 GGTGAGCTGGTGGAGGGGACTGG - Exonic
1083910268 11:65704058-65704080 TGTGGGCTAGTGTAAGAGACAGG - Intergenic
1085251562 11:75147432-75147454 GGTGGGGCACTGGAAGAGCCAGG + Intronic
1088543454 11:110936977-110936999 GGAGAGTGGCTGGAAGAGACTGG + Intergenic
1088689381 11:112312060-112312082 TGTGAGCCACTGGAAGACTCTGG + Intergenic
1088794962 11:113260129-113260151 GGAGAGCTTCTGGGAGAAACCGG - Exonic
1090566454 11:127997330-127997352 GGTGAGAAAATGGAAGAGTCAGG - Intergenic
1096258799 12:50078404-50078426 GATGAGCTGCTGGGAGAGCCGGG - Exonic
1101805065 12:108056441-108056463 GGTGAGATATTGAAGGAGACAGG - Intergenic
1101818970 12:108168402-108168424 GGTGACCTAATGGAGGAGATGGG - Intronic
1104258766 12:127163613-127163635 AGTCACCTACAGGAAGAGACAGG + Intergenic
1105239763 13:18598809-18598831 GCTGAGCTCGTGGCAGAGACTGG + Intergenic
1106138263 13:26990621-26990643 GGTCAGCTGCTGGCAGAGGCAGG - Intergenic
1110123940 13:71917640-71917662 AGCGAGCTATTGGAAGAGGCAGG - Intergenic
1110452760 13:75655764-75655786 TTTGAGCTCCTGGAAGACACAGG - Intronic
1113426754 13:110214478-110214500 GGTGTGTTTCTGGAAGAGATGGG + Intronic
1114260491 14:21033034-21033056 GAGGAGCTTCTGGAAGAGAAGGG + Exonic
1117066991 14:52021075-52021097 GATAAGCTACTTTAAGAGACAGG + Intronic
1117075035 14:52093704-52093726 GGGGTGTTTCTGGAAGAGACTGG - Intergenic
1117190603 14:53287058-53287080 GGAGAACTACTGGGAGAAACTGG - Intergenic
1119566315 14:75632045-75632067 GGTGAACTGCTGGGAGAGGCTGG + Intronic
1120555653 14:85927574-85927596 CGTGGGCTACTAGAAGAGAAAGG - Intergenic
1122079522 14:99257291-99257313 GGTGACCTTCAGGAGGAGACAGG - Intronic
1202903096 14_GL000194v1_random:54365-54387 GGTGAGCTCCTGGAGGCCACGGG - Intergenic
1124143426 15:27097712-27097734 GGTGTGCTACTGGCAGTGAGCGG + Intronic
1128458278 15:67845537-67845559 GGTCAGCAACTGGAAGAGACTGG - Intergenic
1137722267 16:50634130-50634152 GGTGCTCTCCTGGAAGAGGCTGG - Exonic
1138228307 16:55318282-55318304 TGTGTGCTACTTGAAGAGAAGGG + Intergenic
1139431456 16:66913109-66913131 GGTGAGCTACAGGATGGGAGAGG - Exonic
1139446640 16:67002388-67002410 GGAGAGCTACTGGGAGGGGCAGG + Intronic
1140810024 16:78567909-78567931 GGTGAGCCACTGGAAAACAAGGG - Intronic
1143739024 17:8939061-8939083 TGTCAGCTGCTGGAAGAGGCAGG + Intronic
1146997627 17:37334760-37334782 GGGGAGCTACTGGCATGGACGGG - Intronic
1148785986 17:50146452-50146474 GGTCTGCTCCTGGAGGAGACGGG - Intronic
1151412004 17:73937209-73937231 GGTGAGCCACAGCAAGAGAGGGG + Intergenic
1153950624 18:10054831-10054853 GGTGGGCTAGTGGAAGGGAGGGG - Intergenic
1156816670 18:41319801-41319823 TGTGAGTTACTGGAAAAGACTGG - Intergenic
1157234993 18:45956293-45956315 ACTGAGAAACTGGAAGAGACTGG + Intronic
1157281429 18:46348599-46348621 GGAGACCTCCTGGAAGACACAGG + Intronic
1158272226 18:55728952-55728974 GCTGGCCTCCTGGAAGAGACAGG + Intergenic
1158294638 18:55981900-55981922 GGTGGGTTCCTGGAAGAGAAGGG + Intergenic
1159720521 18:71884510-71884532 GATGAGCAACTGGCAGAAACAGG - Intergenic
1160336215 18:78042725-78042747 GGGCAGCTGCTGGCAGAGACAGG + Intergenic
1160825830 19:1080238-1080260 GGGGACCTAGTGGAAGAAACCGG - Exonic
1163128803 19:15259166-15259188 CATGAGCTTCTGGAAGAGCCAGG + Intronic
1164983773 19:32633180-32633202 AATGAGCTATTGGAAGAGAGGGG + Intronic
1167677797 19:50898824-50898846 AGAGATCTACTGAAAGAGACAGG - Intergenic
1167953522 19:53046365-53046387 GGTGACCCTCTGGAAGAGCCAGG - Intronic
925039612 2:721145-721167 GTGGAGCTCCTGAAAGAGACCGG - Intergenic
925337638 2:3109452-3109474 GGTGAGTGCCTGGAAGAGCCTGG - Intergenic
925577218 2:5372771-5372793 GGTGTACTACTGTCAGAGACAGG - Intergenic
926134714 2:10328438-10328460 AGGGAGTTTCTGGAAGAGACTGG + Intronic
926296721 2:11574340-11574362 CCTGAGCTACAGGAAGAGTCTGG + Intronic
926759888 2:16268993-16269015 GGTGAGGTACGGGAAGGAACTGG - Intergenic
930984280 2:57566145-57566167 GGTGAGTTACTGGAGAAAACTGG + Intergenic
932108626 2:68972425-68972447 GGGGAGCTACTGGATGAAGCTGG - Intergenic
932401413 2:71483224-71483246 GGTCAACAGCTGGAAGAGACGGG - Intronic
933396136 2:81733685-81733707 GGTGAGCAACTGGGGGATACAGG + Intergenic
934083456 2:88489183-88489205 GGTGAGCTATTACAAGAGAGAGG - Intergenic
937122548 2:119451090-119451112 AGGCAGCTACTGGAAGAGAAGGG + Intronic
939259221 2:139785158-139785180 GGTGAGAAAGTGGAAGAGAAAGG - Intergenic
939966316 2:148613779-148613801 CCTGAGCTACAGAAAGAGACTGG + Intergenic
942333483 2:174853929-174853951 TGTGAGCTACTAGAAGGGAGAGG + Intronic
946521261 2:220467543-220467565 GGTGACTTACTGGGTGAGACAGG - Intergenic
947779429 2:232744211-232744233 GGTGATCCATTGGAAGGGACAGG + Intronic
947787231 2:232834192-232834214 TGTGAGCTACTTGAAGATAGGGG - Intronic
1171203045 20:23257116-23257138 GGTGAGCTATTGGAAAGAACAGG - Intergenic
1172315954 20:33954621-33954643 CGTGAGGTGCTGGAAGAGACAGG - Intergenic
1172649376 20:36492133-36492155 GGTGAGGTATTGGAAGAGGTGGG + Intronic
1173014351 20:39211355-39211377 GGTGACCCACTGGAAGACACAGG + Intergenic
1174733217 20:52938446-52938468 GAAGAGAGACTGGAAGAGACAGG + Intergenic
1175615970 20:60398553-60398575 GGTGAGCTTCAGGAACAGCCAGG - Intergenic
1175622984 20:60466459-60466481 GGTGAGCTCCTGGAGGGGACTGG - Intergenic
1176622460 21:9069132-9069154 GGTGAGCTCCTGGAGGCCACGGG - Intergenic
1179892382 21:44342852-44342874 GGTCAGCTCCTGAAAGGGACCGG + Intergenic
1180216644 21:46327824-46327846 GGTGTGTTGCTGGAGGAGACTGG + Intronic
1182543218 22:31056875-31056897 TGTGAGCTGCTGGCAGAGAAAGG - Intergenic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184310015 22:43635200-43635222 CGTCAGGTACTGGAAGACACTGG - Exonic
1184582858 22:45429082-45429104 GGAGAGAGAGTGGAAGAGACAGG + Intronic
1184819525 22:46899029-46899051 GATGAGCTTCTGGGAGAGCCAGG + Intronic
950121373 3:10484367-10484389 GGTGAGATTCTAGAAGGGACAGG + Intronic
950566777 3:13773995-13774017 GGGCAGCTACTGGAAGAGGTGGG + Intergenic
951252976 3:20415902-20415924 GGTGAGCAGCTGGGAAAGACAGG + Intergenic
952963591 3:38607823-38607845 GGGGAGCTTCTGGAAGGGAATGG + Intronic
952973950 3:38678300-38678322 AGTAAGCTACTGAAAGACACAGG + Intergenic
954438557 3:50509054-50509076 AGTGAGCTCCTGGCAGAGGCAGG + Intergenic
956060768 3:65345907-65345929 GGTTAGCTCTGGGAAGAGACTGG + Intergenic
956064585 3:65383773-65383795 GGTGAAATAATGGAAGACACGGG + Intronic
957904677 3:86540768-86540790 GGTAAGCTACTGGAACTGATGGG + Intergenic
959670105 3:108967393-108967415 GGAGAGCTACAGGAAGATCCAGG + Intronic
961754197 3:129117919-129117941 GGTAAGCTCCTTGAAGACACAGG - Intronic
963750250 3:149170573-149170595 GGTGAGTTGGTGGAAGAGTCTGG + Intronic
963899529 3:150720569-150720591 GGTGAGGAACAGGAAGAGACTGG + Intergenic
965667105 3:171106876-171106898 GGTTTGCTATTGGAAGATACTGG + Intronic
969908004 4:10415565-10415587 GGTGAGATATTAGGAGAGACAGG + Intergenic
974075820 4:57167305-57167327 GATGAGCTAGTGAGAGAGACAGG + Intergenic
974671316 4:65033900-65033922 GGTCAGAGACTAGAAGAGACTGG - Intergenic
976874642 4:89837600-89837622 GGGGAGCTGCTGGAGGAGACAGG + Intronic
977092710 4:92699222-92699244 GGTGAGTTGCTGGATCAGACTGG + Intronic
978167992 4:105631966-105631988 GGTGTGCTACAGGATCAGACGGG - Intronic
983241529 4:165238607-165238629 GGTGAGCTTTTGGAAGAGGAAGG + Intronic
983554214 4:169045599-169045621 TGTGAGCCACTGCATGAGACTGG - Intergenic
983619095 4:169741288-169741310 GGTGAGAGGCTGGAGGAGACTGG + Intronic
983809428 4:172040732-172040754 GGTGACAAACTGGAAGAGCCAGG + Intronic
985302901 4:188508391-188508413 CGTAAGGTACTGGAAGAGAGAGG + Intergenic
986029086 5:3878799-3878821 GGTGAGTTACTGGAAAAGAAAGG - Intergenic
986349728 5:6866469-6866491 GGGGTGCTTCTGGAAGAGGCTGG + Intergenic
990076634 5:51853471-51853493 GTTAAGCTAATGGAAAAGACTGG - Intergenic
992010338 5:72519323-72519345 GAAGAGCTTCTGGAGGAGACAGG - Intergenic
993327519 5:86560414-86560436 TCTGAGTTACTGGAAGAGAGAGG - Intergenic
994382571 5:99088719-99088741 GGGTAGCTTCTGGGAGAGACAGG - Intergenic
996502317 5:124230597-124230619 GGTGAGCCAGTGCAGGAGACGGG - Intergenic
998456729 5:142279693-142279715 TGTGAGCTCCTGGAAGACAGAGG - Intergenic
999146732 5:149400993-149401015 GGTGTGTTTCTGGAAGAGATTGG - Intronic
999301111 5:150491011-150491033 GGTGAGCAAGGGGAAGTGACTGG - Intronic
1000302322 5:159967401-159967423 GCTGAGTTCCTGGAAGAGAATGG + Intronic
1001760836 5:174206764-174206786 AGTGAGCTACTGTAAGAAAGAGG - Intronic
1002081158 5:176738273-176738295 GGTGCATTACTCGAAGAGACTGG - Intergenic
1002260729 5:177992496-177992518 GGTGAGCTACTGGAAGAGACAGG - Exonic
1004166483 6:13261219-13261241 GGTGAGCTGGAGGAAGAGGCTGG + Intronic
1006395201 6:33782703-33782725 TGGGGTCTACTGGAAGAGACAGG - Intronic
1008230580 6:48981684-48981706 TGTAAGCTACTGGAAGACAAGGG - Intergenic
1008590483 6:52988972-52988994 TGTAAGCCACTGGATGAGACAGG + Intronic
1011431660 6:87293850-87293872 TGTGAGATACTGCAAGATACTGG - Intronic
1013350541 6:109301936-109301958 GGTGAGCTCCAGGAAGGGTCAGG - Intergenic
1015499961 6:133921473-133921495 GGAGAGATGCTGGTAGAGACTGG + Intergenic
1018206430 6:161441334-161441356 TGTGAGCTACAGAAAGAGTCTGG + Intronic
1018431947 6:163729724-163729746 GGGGAGCCACTGGAAGGGAGGGG - Intergenic
1018863813 6:167732325-167732347 AGTGAGGTACGGGAAGAGGCGGG - Intergenic
1019149844 6:169997957-169997979 GCTGAGGAAGTGGAAGAGACAGG - Intergenic
1019212775 6:170419909-170419931 GAGGAGCTTCTGGAAGAGACAGG - Intergenic
1019386815 7:761739-761761 GTAGAGGTCCTGGAAGAGACCGG - Exonic
1019510975 7:1417149-1417171 GGTGGGCTGCTGGCAGAGCCAGG - Intergenic
1023612408 7:41984137-41984159 GGAGAGCTACAGGAAGAAATGGG + Intronic
1026065505 7:67068543-67068565 GGTGGGGTACTAGAAGAGACTGG - Intronic
1026083407 7:67242101-67242123 GGTGGGCTCCTGGATGAGGCTGG - Intergenic
1026248056 7:68640772-68640794 GGTGAATTACTGGAAGATAGTGG - Intergenic
1026711369 7:72743318-72743340 GGTGGGATACTAGAAGAGACTGG + Intronic
1028730950 7:94147844-94147866 GGTAATCTATTTGAAGAGACAGG - Intergenic
1029361170 7:100089436-100089458 GGTGAGCAAGGAGAAGAGACTGG - Intronic
1029451589 7:100644382-100644404 GGTGAGCTACAGGAAGCTAGTGG - Intronic
1032563369 7:132915205-132915227 GGTCATCCACTGGAAGAGAGCGG + Intronic
1033148782 7:138894807-138894829 GGTGAGCTAGTAGAATAAACTGG - Intronic
1034609685 7:152354725-152354747 GGTGGGCTCCTGGAAAAGCCAGG + Intronic
1038779547 8:30558263-30558285 AGAAAGCTAATGGAAGAGACAGG + Intronic
1041541433 8:58989399-58989421 GTTGATCTCCTGGAAGATACAGG - Intronic
1043928945 8:86069076-86069098 GGTGAGCCAGTGGAAAAGAATGG + Intronic
1043984912 8:86682635-86682657 GGAGAGCTCCTGGAAGGGAGGGG + Intronic
1048203801 8:132399716-132399738 GGTGAGATACTTGAAGAGAAGGG + Intronic
1048592507 8:135833806-135833828 TGTAAGCTCCTGGAAGACACAGG + Intergenic
1048835646 8:138516382-138516404 GGTGATTTACTGCAAGGGACTGG - Intergenic
1049687890 8:143946263-143946285 GGTGGACAACGGGAAGAGACAGG + Intronic
1051236756 9:15008504-15008526 AGTGAGAGGCTGGAAGAGACTGG - Intergenic
1051378740 9:16433057-16433079 GCTGAGCTGCAGGAAGAGGCAGG + Intronic
1053023996 9:34715588-34715610 GGTGAGCTCCTGAGAGAAACTGG + Intergenic
1053605328 9:39652538-39652560 TGTGAACTACTGGAAGGGGCAGG - Intergenic
1053863243 9:42409165-42409187 TGTGAACTACTGGAAGGGGCAGG - Intergenic
1054248215 9:62689878-62689900 TGTGAACTACTGGAAGGGGCAGG + Intergenic
1054562330 9:66724403-66724425 TGTGAACTACTGGAAGGGGCAGG + Intergenic
1056203972 9:84302721-84302743 GGTGAGCTACTATCAGAGAAAGG + Intronic
1060024795 9:120161958-120161980 GGTGAGCTTCTGCCAGGGACAGG + Intergenic
1060544975 9:124454168-124454190 GGTGAGCTGCTGGCAAAGTCTGG + Intronic
1061247159 9:129406388-129406410 GGTGATCTACTGGTAGTGCCGGG - Intergenic
1061565529 9:131436832-131436854 GGTGTGCCTCTGGAATAGACAGG - Intronic
1203745655 Un_GL000218v1:39561-39583 GGTGAGCTCCTGGAGGCCACGGG - Intergenic
1203564452 Un_KI270744v1:79922-79944 GGTGAGCTCCTGGAGGCCACGGG + Intergenic
1186386267 X:9113220-9113242 GGTGACCTACTGAAACAGTCTGG - Intronic
1186931782 X:14399758-14399780 GGTGAGCTATTTGAAGTGAAGGG - Intergenic
1188797138 X:34481188-34481210 GGTGAGGTGCTGGTAGACACAGG + Intergenic
1189108713 X:38264453-38264475 GGTGTTCTGTTGGAAGAGACAGG + Intronic
1190167454 X:48084922-48084944 GGTGAGCTCGTGTAAGAGCCAGG + Intergenic
1195894558 X:109732860-109732882 GGTGAGCGGCAGGAAGAGGCAGG + Intronic
1197583424 X:128313245-128313267 GGTGGCCTACTGGAGGAGAGAGG - Intergenic
1199241359 X:145551438-145551460 TGTGAGATAGAGGAAGAGACTGG + Intergenic
1199743900 X:150759948-150759970 GGTGAGTCACTGCCAGAGACGGG - Intronic
1201158984 Y:11154573-11154595 GGTGAGCTCCTGGAGGCCACGGG - Intergenic