ID: 1002263052

View in Genome Browser
Species Human (GRCh38)
Location 5:178007583-178007605
Sequence GCCTCGGAGGGCACCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002263035_1002263052 11 Left 1002263035 5:178007549-178007571 CCAGGCCCGGCTTCCCCGCAGCC 0: 6
1: 8
2: 10
3: 83
4: 555
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263043_1002263052 -2 Left 1002263043 5:178007562-178007584 CCCCGCAGCCCCTGGGATGGGGC 0: 4
1: 1
2: 13
3: 46
4: 367
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263030_1002263052 30 Left 1002263030 5:178007530-178007552 CCAGGGTGGGAGGGGGTCCCCAG 0: 11
1: 6
2: 13
3: 63
4: 454
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263047_1002263052 -10 Left 1002263047 5:178007570-178007592 CCCCTGGGATGGGGCCTCGGAGG 0: 2
1: 1
2: 6
3: 22
4: 234
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263033_1002263052 13 Left 1002263033 5:178007547-178007569 CCCCAGGCCCGGCTTCCCCGCAG 0: 12
1: 3
2: 5
3: 52
4: 302
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263045_1002263052 -4 Left 1002263045 5:178007564-178007586 CCGCAGCCCCTGGGATGGGGCCT 0: 4
1: 2
2: 13
3: 103
4: 647
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263036_1002263052 6 Left 1002263036 5:178007554-178007576 CCCGGCTTCCCCGCAGCCCCTGG 0: 5
1: 7
2: 9
3: 73
4: 644
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263038_1002263052 5 Left 1002263038 5:178007555-178007577 CCGGCTTCCCCGCAGCCCCTGGG 0: 5
1: 7
2: 10
3: 96
4: 690
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263034_1002263052 12 Left 1002263034 5:178007548-178007570 CCCAGGCCCGGCTTCCCCGCAGC 0: 6
1: 8
2: 13
3: 85
4: 355
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data
1002263044_1002263052 -3 Left 1002263044 5:178007563-178007585 CCCGCAGCCCCTGGGATGGGGCC 0: 4
1: 0
2: 18
3: 82
4: 629
Right 1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002263052 Original CRISPR GCCTCGGAGGGCACCCTCAG AGG Intronic
No off target data available for this crispr