ID: 1002271101

View in Genome Browser
Species Human (GRCh38)
Location 5:178072949-178072971
Sequence TGGTGGTGCTGAGTCTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002271101_1002271109 19 Left 1002271101 5:178072949-178072971 CCACGCAAGACTCAGCACCACCA No data
Right 1002271109 5:178072991-178073013 CTCTGAGGCTTGTCCTGCTAAGG No data
1002271101_1002271106 4 Left 1002271101 5:178072949-178072971 CCACGCAAGACTCAGCACCACCA No data
Right 1002271106 5:178072976-178072998 CTGCTGCTCCCGATGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002271101 Original CRISPR TGGTGGTGCTGAGTCTTGCG TGG (reversed) Intergenic
No off target data available for this crispr