ID: 1002276069

View in Genome Browser
Species Human (GRCh38)
Location 5:178105045-178105067
Sequence GGTGTGAGCAGACCGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002276060_1002276069 19 Left 1002276060 5:178105003-178105025 CCCTGGCTTGCCTGATTGGCTGA 0: 8
1: 0
2: 0
3: 11
4: 166
Right 1002276069 5:178105045-178105067 GGTGTGAGCAGACCGCTAGGTGG No data
1002276061_1002276069 18 Left 1002276061 5:178105004-178105026 CCTGGCTTGCCTGATTGGCTGAA 0: 3
1: 5
2: 1
3: 6
4: 127
Right 1002276069 5:178105045-178105067 GGTGTGAGCAGACCGCTAGGTGG No data
1002276062_1002276069 9 Left 1002276062 5:178105013-178105035 CCTGATTGGCTGAACACAGATAG No data
Right 1002276069 5:178105045-178105067 GGTGTGAGCAGACCGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002276069 Original CRISPR GGTGTGAGCAGACCGCTAGG TGG Intergenic
No off target data available for this crispr