ID: 1002277681

View in Genome Browser
Species Human (GRCh38)
Location 5:178114155-178114177
Sequence GCTCCCGGCAGGCCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 317}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002277671_1002277681 -9 Left 1002277671 5:178114141-178114163 CCCCCGGCCCAGCCGCTCCCGGC 0: 1
1: 0
2: 8
3: 81
4: 574
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277666_1002277681 4 Left 1002277666 5:178114128-178114150 CCTCGGCCTCCGCCCCCCGGCCC 0: 2
1: 3
2: 38
3: 300
4: 1932
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277664_1002277681 15 Left 1002277664 5:178114117-178114139 CCGGCGTCTGACCTCGGCCTCCG 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277672_1002277681 -10 Left 1002277672 5:178114142-178114164 CCCCGGCCCAGCCGCTCCCGGCA 0: 1
1: 0
2: 0
3: 30
4: 360
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277662_1002277681 23 Left 1002277662 5:178114109-178114131 CCTTGGCGCCGGCGTCTGACCTC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277669_1002277681 -8 Left 1002277669 5:178114140-178114162 CCCCCCGGCCCAGCCGCTCCCGG 0: 1
1: 1
2: 5
3: 88
4: 769
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277668_1002277681 -5 Left 1002277668 5:178114137-178114159 CCGCCCCCCGGCCCAGCCGCTCC 0: 1
1: 0
2: 11
3: 180
4: 5551
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
1002277667_1002277681 -2 Left 1002277667 5:178114134-178114156 CCTCCGCCCCCCGGCCCAGCCGC 0: 1
1: 0
2: 17
3: 249
4: 1817
Right 1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002277681 Original CRISPR GCTCCCGGCAGGCCTCAGGG AGG Intronic
900314763 1:2051166-2051188 GCCCCCGGCAGGGCTCGGGGCGG + Intronic
900599274 1:3496184-3496206 GCCCCCAGCAGGCCTGCGGGTGG - Intronic
900759620 1:4462098-4462120 GCTTCCTGCAGGCCGCAGCGAGG + Intergenic
900812412 1:4816920-4816942 GCTCCCTGAATGCTTCAGGGAGG + Intergenic
900866158 1:5270029-5270051 GCTCCCATCAGGACACAGGGCGG + Intergenic
901511001 1:9717980-9718002 GCTCCCTGGAGGCACCAGGGCGG + Intronic
901634689 1:10665078-10665100 GCACCAGGCAGGCTTCAGGTGGG - Exonic
901655282 1:10765799-10765821 GCTGCCGGCAGGGGACAGGGAGG + Intronic
902374584 1:16024299-16024321 CTTCCAGGGAGGCCTCAGGGTGG - Intronic
902379527 1:16046071-16046093 CTTCCAGGGAGGCCTCAGGGTGG - Intronic
902466851 1:16623921-16623943 GCTCCCGGCGGGCCTCAAGCTGG + Intergenic
902507751 1:16948853-16948875 GCTCCCGGCGGGCCTCAAGCTGG - Exonic
903263647 1:22143731-22143753 GCTCCCGGAAGGCTGTAGGGAGG - Intronic
903448757 1:23438660-23438682 GCTCCCGGGGGGCTTCAGTGAGG - Intronic
903770269 1:25759394-25759416 TCCCCAGGCAGCCCTCAGGGAGG - Intronic
905399663 1:37692236-37692258 ACTCCCGGCAGGCCTTGTGGCGG - Intronic
905465711 1:38151591-38151613 GCTGCAGGCAGTCCCCAGGGAGG - Intergenic
912498765 1:110107978-110108000 GCTCAAGGCAGGCCCCAGGCCGG + Intergenic
913090748 1:115475101-115475123 GCTCCTGGTAGACCACAGGGAGG + Intergenic
918358083 1:183724719-183724741 GCTCCCCCCAGGCCCCAGGCAGG - Intronic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
920269444 1:204752204-204752226 CCTCCCGGAAGGGCACAGGGAGG - Intergenic
920377898 1:205519111-205519133 GCCCCGGGCTGGCCTCAGGCTGG + Intronic
920656032 1:207875813-207875835 GCTGCAGGCAGGGCTCTGGGAGG - Intergenic
922234383 1:223712409-223712431 GCGCTCGGCAGGCCGCAGGATGG + Exonic
922609320 1:226912800-226912822 GCCCCCGCAAGGGCTCAGGGCGG - Intronic
922766458 1:228158886-228158908 GCCCCCGGGAGGCCGCAGGGAGG - Exonic
922769875 1:228175975-228175997 GCTTCCAGCATGTCTCAGGGTGG + Exonic
1062905817 10:1178813-1178835 GCTTCCCGCGGCCCTCAGGGAGG - Exonic
1062925379 10:1312352-1312374 GCCCCCGGCAGGCCCCAGGCTGG + Intronic
1065431378 10:25660865-25660887 GTTCCCCCCAGGCCTCAGGCAGG + Intergenic
1069861459 10:71474209-71474231 CCTCCAGGGAGCCCTCAGGGTGG + Intronic
1070359126 10:75670578-75670600 GCTCCAAGGAGGCCTCTGGGAGG + Intronic
1070400265 10:76047051-76047073 GCTCCTGTGAGACCTCAGGGTGG - Intronic
1070540248 10:77410420-77410442 GCTCTAGGCAGGCAGCAGGGAGG - Intronic
1071603370 10:86969703-86969725 CCTCCGGGCAGGCCACAGGAGGG + Intronic
1073045880 10:100637944-100637966 GCCCCGGGCAGGACACAGGGGGG - Intergenic
1073066028 10:100759661-100759683 GCTCCTGGCAGGGCTGAGGCAGG + Intronic
1073118751 10:101108451-101108473 GCCCCCGGCAGGCTTCACTGCGG - Intronic
1073463014 10:103677356-103677378 GGTCCCGGAAGGTCTGAGGGAGG + Intronic
1075247521 10:120836456-120836478 GCTCCCTGCAGGCCAGAGAGTGG + Intergenic
1075375353 10:121974531-121974553 GCGCCCGGCAGTCCTCGGCGTGG - Intronic
1076120904 10:127935713-127935735 GGACACGGCAGCCCTCAGGGAGG - Intronic
1076145121 10:128112752-128112774 GCCCCCGGCAGTCCACATGGAGG + Intronic
1076328164 10:129644556-129644578 GCTCTCACCAGGCCTCAGGGGGG - Intronic
1076642813 10:131930327-131930349 GCGGCCAGCAGGCCTCAGAGTGG - Intronic
1076818026 10:132924188-132924210 GCAGGCGGCAGGCATCAGGGTGG - Intronic
1076818035 10:132924221-132924243 GCAGGCGGCAGGCATCAGGGTGG - Intronic
1076987685 11:251087-251109 GGTCAGGGAAGGCCTCAGGGTGG - Intronic
1077043629 11:535194-535216 GATTCCCGCAGGCCCCAGGGAGG + Intronic
1077358674 11:2130184-2130206 GCTCCTGGCTGGCCTGAGGCTGG - Intronic
1078084712 11:8226912-8226934 CATCCCAGCAGGCCTCAGGCTGG + Intronic
1083298969 11:61730361-61730383 GCTCCCTGCAGCCCTGGGGGCGG - Intronic
1083489999 11:63009137-63009159 GCCCCCGGCAGGGCTGAGGGTGG + Intronic
1084106879 11:66986142-66986164 CCTCCTGGGAGGCCCCAGGGTGG - Intergenic
1084731921 11:71079301-71079323 GCTCCAGGCAGGTCCCAGGCTGG + Intronic
1086174410 11:83872803-83872825 TCTCTTGGCAGGGCTCAGGGTGG - Intronic
1086491777 11:87363116-87363138 GCTCCTGGATGGCCTCAGGATGG - Intergenic
1089764453 11:120752655-120752677 CCTCCCTGCAGCTCTCAGGGAGG + Intronic
1090517890 11:127448183-127448205 GCTCCAGGCAGGCCGGACGGAGG - Intergenic
1092980646 12:13791038-13791060 GCTTGGGGCAGCCCTCAGGGTGG + Intronic
1096255063 12:50057768-50057790 GCTCCCTGCAGGGCTCTGCGCGG + Exonic
1096627662 12:52905180-52905202 CCTCCGGGCAGGACTCAGGTGGG + Intronic
1096771441 12:53938497-53938519 GCCCCCGGCAGGCCCCAGGGAGG - Intergenic
1097014282 12:55974276-55974298 GGCCCCGGCAGGCCTAATGGGGG + Intronic
1100610309 12:96186332-96186354 GGTCCCTGCAGGCATGAGGGGGG - Intergenic
1101334600 12:103785085-103785107 GCTCCTAGCAGGCTTCAGTGTGG + Intronic
1101412506 12:104481202-104481224 GGACCAGGCAGGCCTCAGTGAGG - Intronic
1103928703 12:124437735-124437757 GCTTCCAGAAGGCCCCAGGGTGG - Intronic
1104031662 12:125069298-125069320 CCGCCCTGCAGGCTTCAGGGAGG + Intronic
1104930233 12:132335102-132335124 GGGCACAGCAGGCCTCAGGGAGG + Intergenic
1105845525 13:24290690-24290712 GCTCCAGGCAGGCGCCCGGGTGG - Exonic
1106114938 13:26809268-26809290 GCTCCTGGATGGCCTCAGGATGG - Intergenic
1106717200 13:32403400-32403422 GCTCCTTGCTAGCCTCAGGGTGG - Intronic
1111438063 13:88238523-88238545 GCAACCAGCAGCCCTCAGGGAGG + Intergenic
1111946292 13:94669059-94669081 TCTCCCTGCAGCCCTCAGAGGGG + Intergenic
1113457412 13:110458379-110458401 GCTCCAGGGAGCCGTCAGGGAGG - Intronic
1113485047 13:110647046-110647068 GCACCCAGCAGGCCACAGGAGGG + Intronic
1113606392 13:111610641-111610663 GCTCCTGGAAGAGCTCAGGGTGG + Intronic
1114055327 14:18963315-18963337 GCCCTGTGCAGGCCTCAGGGAGG + Intergenic
1114107218 14:19438461-19438483 GCCCTGTGCAGGCCTCAGGGAGG - Intergenic
1114634793 14:24181482-24181504 GCTGCTGGCAGCCCTCAGAGGGG - Intronic
1116916775 14:50532699-50532721 GTTCTCAGCAGGCCTCAGGGCGG - Intronic
1117221623 14:53612016-53612038 GGTCCCCTCAGACCTCAGGGTGG - Intergenic
1117723154 14:58646547-58646569 GTTCCCGGCAGGCCCGCGGGCGG + Exonic
1119644958 14:76341411-76341433 GCTTCCAGGAGGCCACAGGGAGG - Intronic
1121380543 14:93462192-93462214 GCTACTGGCAGGGCTCAGGCAGG + Intronic
1122016617 14:98802144-98802166 TCTCCCTGCAGGGCTCTGGGAGG - Intergenic
1122956963 14:105075465-105075487 CCACCCCCCAGGCCTCAGGGCGG + Intergenic
1123458167 15:20444481-20444503 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1123458181 15:20444535-20444557 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1123458195 15:20444589-20444611 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1123458223 15:20444697-20444719 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1123659844 15:22555712-22555734 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1123659872 15:22555820-22555842 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1123659886 15:22555874-22555896 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1123659900 15:22555928-22555950 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1124264470 15:28220706-28220728 GCTCCCAGCAGACCTCAGTTAGG + Intronic
1124264484 15:28220760-28220782 GCTCCCAGCAGACCTCAGTTAGG + Intronic
1124313705 15:28650207-28650229 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1124313733 15:28650315-28650337 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1124313747 15:28650369-28650391 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1124313761 15:28650423-28650445 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1124651344 15:31476519-31476541 GCTCCTGCCAGCACTCAGGGAGG - Exonic
1125476994 15:40054392-40054414 GCACCGGGCCGGCCTCAGTGGGG - Intergenic
1125509682 15:40286276-40286298 CCTCCCAGCAGGCCCCAGGCTGG + Intronic
1125689606 15:41585486-41585508 GCGCCCTGCAGGCCGCGGGGAGG + Intergenic
1125730342 15:41889527-41889549 GCTCTCGGGAGGGCTCAGGTGGG - Intronic
1126110787 15:45173585-45173607 CCTCCAGGCTGGGCTCAGGGAGG + Exonic
1129697696 15:77749931-77749953 CCTCCCAGCAGCTCTCAGGGTGG + Intronic
1130362901 15:83207500-83207522 GCTCCCCGCGGGCCTCAAGCCGG + Exonic
1131268945 15:90935090-90935112 GCTCCCTGCAGGTCTCTGCGGGG + Intronic
1131870973 15:96764596-96764618 GCCCCCCTCCGGCCTCAGGGTGG + Intergenic
1132232314 15:100193247-100193269 GCTCCCGGGAGACCTCAAGGAGG - Intronic
1132552901 16:560644-560666 GCTCCCGGCCGGGCGCAGGTAGG + Exonic
1132640203 16:974703-974725 GCTGCGGGCCGGCTTCAGGGAGG + Intronic
1132685593 16:1160765-1160787 GCTCCCGGCAAGCGACCGGGCGG - Intronic
1132701644 16:1224696-1224718 GCCCCTGCCAGGCCTCAGGGCGG + Intronic
1132712833 16:1276934-1276956 GCCGCCCGCAGGCATCAGGGAGG + Intergenic
1135194525 16:20383482-20383504 GCTCCCAGCAGGCTTGTGGGAGG - Intronic
1136368753 16:29822591-29822613 GCTCCAGGCAGTCCTGAGGTTGG - Intronic
1136493524 16:30626598-30626620 CCTCCTGGCTGGCCTCAGAGGGG - Intergenic
1136544657 16:30948499-30948521 CCTCCGCGCAGGCCTCCGGGGGG + Exonic
1136631092 16:31489678-31489700 GCTCCAGGCAGGGCTGATGGTGG + Exonic
1136702655 16:32157885-32157907 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1136702670 16:32157939-32157961 GCTCCCAGCAGACCTCAGTTGGG + Intergenic
1136764999 16:32769549-32769571 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1136765013 16:32769603-32769625 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1136803086 16:33100781-33100803 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1136803100 16:33100835-33100857 GCTCCCAGCAGACCTCAGTTAGG + Intergenic
1138428318 16:56951262-56951284 CTTCCCTGCAGGCCTCAGTGGGG - Intergenic
1139357779 16:66377500-66377522 GCGCCAGGCTGACCTCAGGGAGG - Intronic
1139849636 16:69942985-69943007 CCTCCTGGAAGGCATCAGGGTGG - Intergenic
1140426901 16:74868838-74868860 GCTCCCGGACAGCCTCAGGATGG + Intergenic
1141709964 16:85692642-85692664 CCTCCCACCTGGCCTCAGGGTGG + Intronic
1141764741 16:86051113-86051135 GCTCTCAGCAGGCCCCAGGTTGG - Intergenic
1142160088 16:88552854-88552876 CCTCCCTGCAGGGCTCAGGGAGG - Intergenic
1142181674 16:88674246-88674268 GCACACGGCAGGCCTCAGACAGG - Intergenic
1142366718 16:89654044-89654066 GCTCCCCGAAGGCCCCAGGCAGG - Intronic
1203067386 16_KI270728v1_random:1031782-1031804 GCTCCCAGCAGACCTCAGTTGGG - Intergenic
1203067401 16_KI270728v1_random:1031836-1031858 GCTCCCAGCAGACCTCAGTTAGG - Intergenic
1142508720 17:381277-381299 GCTTCCGGGAGGCATGAGGGGGG - Intronic
1142909054 17:3071649-3071671 ACTCCCTGCAGACCCCAGGGTGG - Intergenic
1142925508 17:3232593-3232615 ACTCCCTGCAGACCCCAGGGTGG + Intergenic
1143649528 17:8254971-8254993 ACCCCCGGCAGGCCTCAGCTGGG - Intronic
1145038683 17:19560187-19560209 GGTCCCTGCAGGCTTCAGTGTGG + Exonic
1145268037 17:21389845-21389867 GCTCCCTGCATGTCACAGGGAGG - Intronic
1145318770 17:21750552-21750574 GCTTTCTGCAGCCCTCAGGGTGG + Intergenic
1147383627 17:40069829-40069851 GCTCCAGCCAGGCATCAAGGTGG - Intronic
1148199361 17:45739849-45739871 GATTCCTGCAGGCCCCAGGGAGG + Intergenic
1148861772 17:50608237-50608259 GGTCCTGGGAGGCCCCAGGGTGG - Intronic
1149806064 17:59619457-59619479 GCACCCGTCATGCCTCAAGGTGG + Intergenic
1151964417 17:77423921-77423943 GCCCCAGGCAGGGCTCAGGGCGG - Intronic
1151975263 17:77480728-77480750 CCTCCCGCCAGTCCTCCGGGAGG - Intronic
1152267752 17:79306212-79306234 GCTCTTAGCAGGGCTCAGGGAGG - Intronic
1152268056 17:79307640-79307662 GCTTCTCCCAGGCCTCAGGGTGG - Intronic
1152327632 17:79650833-79650855 GCGCCCTGCAGGCTCCAGGGTGG + Intergenic
1152684716 17:81688367-81688389 GGACCCGGCAGGCCTGACGGTGG - Intronic
1152709137 17:81861437-81861459 GCTCCCTGAAGGCCTTAGCGGGG - Intergenic
1155100373 18:22605013-22605035 GTGCCCGGCAGAACTCAGGGAGG + Intergenic
1155880151 18:31136776-31136798 GCTGCCTGCAGGCCACAGGTTGG + Intronic
1158783462 18:60679782-60679804 GCAACCAGCAGCCCTCAGGGAGG - Intergenic
1158957762 18:62556932-62556954 GCTCCCGGAAGGTCACAGTGAGG - Intronic
1160192243 18:76723805-76723827 GCTCTCCGCAGGCATCAGGGTGG - Intergenic
1160452991 18:78978603-78978625 GCTCCCGGCAGGGCTGGTGGCGG - Intergenic
1160743604 19:699486-699508 GCTCCTGGCAGCCCTGAGGAGGG + Intergenic
1160920963 19:1520382-1520404 CCTTCCGGCAGGCGCCAGGGTGG - Intergenic
1161030270 19:2054860-2054882 GCTCCCTGCAGTGCCCAGGGCGG - Intergenic
1161115842 19:2495933-2495955 CCTCCCGGCAGACCCAAGGGCGG + Intergenic
1161170886 19:2812009-2812031 GCTTCCTGCAGGGCCCAGGGAGG - Intronic
1161349241 19:3783283-3783305 GTTCCCGGGTGGCCTCTGGGTGG + Intronic
1162127155 19:8505902-8505924 GCTCCCGGCAGGGTTCCGCGCGG + Intergenic
1162621486 19:11847810-11847832 GCTCCAGACTGGCCTCAGCGTGG - Intergenic
1162647371 19:12059672-12059694 GCTCCAGGCTGGCCTCAGCGTGG - Intergenic
1162701081 19:12515112-12515134 GCTCCAGACTGGCCTCAGGTTGG + Intronic
1163236890 19:16035181-16035203 GGGCCCAGCAGGCCTCTGGGTGG - Intergenic
1163595883 19:18220828-18220850 GCTCCCAGCTGTCCTCAGCGGGG + Intronic
1163688421 19:18725331-18725353 GCTCCCTGGAGGCCACAGGGAGG - Intronic
1164463791 19:28470623-28470645 GCTCCTGGGTGGCCTCAGGATGG + Intergenic
1164639318 19:29812521-29812543 CCGCCCCGCAGGCCTCAGGCCGG + Exonic
1165773333 19:38390485-38390507 CCTCCCCGCATGCCCCAGGGTGG - Intronic
1166941842 19:46371801-46371823 GCTGCCTGCATGCCTCAGGCAGG + Intronic
1167243998 19:48363230-48363252 GCTCCCAGCAGGCTTCGCGGCGG - Intronic
1167469163 19:49665874-49665896 GCTCCCAGCATGCCTCTGGCCGG - Exonic
1167748241 19:51365425-51365447 GCACCCTGGAGGCCTCAGGGTGG - Intronic
1168249885 19:55135873-55135895 GCTCCTGGAAGCCCTCTGGGGGG - Intronic
1168295090 19:55374351-55374373 GGTCCCGTCTGGCCTCTGGGGGG + Intergenic
1168504470 19:56921695-56921717 GCTCCCGGACAGCCTCAGGTTGG + Intergenic
925523766 2:4777146-4777168 GCTCCCGGCTGTCCTCAATGGGG - Intergenic
926914020 2:17876647-17876669 GCTCCCTGCAGGGCTCAGCAGGG + Intergenic
927329921 2:21850527-21850549 GCCCCCGACAGGCCCCAGCGTGG + Intergenic
927653558 2:24927174-24927196 ATTCCCCGCAGGCCGCAGGGAGG - Intergenic
928998750 2:37324870-37324892 GCTCCCGGCAGGCCCCGCGCTGG - Intergenic
932278966 2:70473098-70473120 ACTCCAGCCTGGCCTCAGGGTGG - Intronic
932355836 2:71068015-71068037 GGTCCCGGCAGCCCTGAGGAGGG - Intronic
933258637 2:80107819-80107841 GCTCCATGCAGGCCCCATGGTGG - Intronic
933707943 2:85305379-85305401 GCTCACTGCAGGGCTCAGGCTGG - Exonic
933713609 2:85344825-85344847 GGGCCCGGCATGCCTCAGGCAGG - Intronic
934517272 2:94996610-94996632 GCTCCTGGAGGGCCTCAGGATGG + Intergenic
934562527 2:95320611-95320633 GCTCCATGAAGGCCTCTGGGTGG + Intronic
935632021 2:105219860-105219882 GCAACCAGCAGGCCCCAGGGTGG - Intergenic
935760115 2:106312567-106312589 GCCCCCGACAGGCCCCAGTGTGG - Intergenic
938079617 2:128362817-128362839 GCTGCCTGCAGGCCTCAGTGGGG - Intergenic
938473345 2:131586094-131586116 GCCCTATGCAGGCCTCAGGGAGG + Intergenic
938708538 2:133955323-133955345 GCTCCTGGGTAGCCTCAGGGTGG + Intergenic
942965971 2:181892284-181892306 GCTCCCGGCCGGGCTCCGGGGGG + Intronic
944925400 2:204458971-204458993 GCTCCTTTTAGGCCTCAGGGTGG - Intergenic
945939330 2:215932557-215932579 GCCCCCGGGAGGGCTCAGGAGGG - Intergenic
946016466 2:216608007-216608029 GCTCCAAGGGGGCCTCAGGGTGG - Intergenic
946509061 2:220334858-220334880 GCTCCCTGTTGGCCCCAGGGAGG + Intergenic
946811596 2:223531100-223531122 GCTCCATGCAGGCCCCATGGTGG - Intergenic
947501541 2:230674776-230674798 GCTCCGGGCAGACCTCAGAGGGG + Intergenic
947665749 2:231904417-231904439 GCTCCTAGAAGGCCTCAAGGTGG - Intergenic
948425650 2:237885372-237885394 GCTCACGACAGGCCTCAGGGAGG - Intronic
948489541 2:238303675-238303697 GCTCCCTGCAGACCTGTGGGCGG + Intergenic
948765192 2:240215845-240215867 GCCCCGGGGAGGCCTCAGGCTGG + Intergenic
948921464 2:241067882-241067904 GGTCCCTGAGGGCCTCAGGGTGG - Exonic
1171533187 20:25865605-25865627 CATCCCGGCAGGCCTGAGGCTGG + Intronic
1171837192 20:30168124-30168146 GGTCCGGGCAGGCCTGAGGCTGG + Intergenic
1171846752 20:30281972-30281994 GGTCCGGGCAGGCCTGAGGCTGG - Intergenic
1172320954 20:33994509-33994531 GCTCCGGGGAGGCCGCAGGCGGG + Intronic
1173081999 20:39877399-39877421 GCTCCCTGCAGGCCTCCAGGGGG - Intergenic
1175621831 20:60454019-60454041 GCTCCGGGCTGGATTCAGGGTGG + Intergenic
1175924385 20:62464877-62464899 CCCCCAGGCTGGCCTCAGGGGGG - Exonic
1176170891 20:63695971-63695993 GCCCGCTGCAGGCCTCAGGCAGG + Exonic
1176247079 20:64102433-64102455 CCTCCCGGCTGGCCGCGGGGCGG + Intergenic
1176377604 21:6094206-6094228 GCTCCCGGCACGGCTCCGGGGGG + Intergenic
1179585129 21:42369991-42370013 GCTCTCGCCAGACCGCAGGGAGG - Intergenic
1179595936 21:42443329-42443351 GCTCTCGGCCGGCATGAGGGCGG - Exonic
1179745871 21:43444038-43444060 GCTCCCGGCACGGCTCCGGGGGG - Intergenic
1180473807 22:15685867-15685889 GCCCTGTGCAGGCCTCAGGGAGG + Intergenic
1180869344 22:19137613-19137635 GCTCCCAGCAGGCCCGAGGCAGG + Intronic
1180972747 22:19823982-19824004 ACTCCCGCCAGGCCCCAGGCAGG - Intronic
1181756534 22:25028553-25028575 GGTCCCCGCAGGCTTCTGGGTGG - Exonic
1182299357 22:29329191-29329213 GGGCCGGGCAGCCCTCAGGGTGG - Intronic
1182426270 22:30274576-30274598 GCTCCCGGAAGGACTGAGGAAGG - Intergenic
1183038367 22:35157585-35157607 TCTGCTGGGAGGCCTCAGGGAGG - Intergenic
1183055564 22:35303248-35303270 GCTTGGGGCAAGCCTCAGGGAGG - Intronic
1183209396 22:36441570-36441592 GCTCAGGGCTGGCATCAGGGAGG + Intergenic
1183361152 22:37384195-37384217 TCTCCTGTCAGGCCACAGGGTGG - Intronic
1183452646 22:37905542-37905564 GGACCCGGCAGGCCGCAGTGGGG + Intergenic
1183585498 22:38750839-38750861 GCTGCTGGGAGGCCTCAGGAAGG - Intronic
1183734450 22:39636125-39636147 GCTCCCAGCCTGCCTCTGGGTGG - Intronic
1184251725 22:43264445-43264467 GGTCCAGCCAGGCCCCAGGGAGG - Intronic
1184511320 22:44934919-44934941 GCTCCTGGAAGGTCTCAGCGAGG - Intronic
1184689552 22:46111225-46111247 ACTCCAGGCAGGCCCCAGGCTGG - Intronic
1185259573 22:49854008-49854030 GCTCGCGGCAGGCGGCGGGGCGG - Intronic
1185287802 22:50010356-50010378 GATCCGAGCAGGCCTCAGGTGGG + Intronic
950282290 3:11719153-11719175 GGTCCCCGCCGGCCTCAGGGAGG - Intronic
951513159 3:23527541-23527563 TCTCCTGGAAGGCCTCAGGATGG + Intronic
953907512 3:46875750-46875772 GCTCCCAGCAGGTCTGGGGGCGG + Intronic
953953100 3:47207915-47207937 GCTACCAGCAGGGCTCAGGCAGG - Intergenic
954930911 3:54280565-54280587 AGTCAGGGCAGGCCTCAGGGAGG + Intronic
961446117 3:126982634-126982656 GCCCCCTGCAGGCCCCAGGCTGG - Intergenic
961562497 3:127740473-127740495 GGTCCCGGCAGTCCTCAGAGGGG - Intronic
961824309 3:129590872-129590894 GCTCAGAGCAGGACTCAGGGAGG + Intronic
962388612 3:134953314-134953336 GTTCTCAGCAGGCCTCAGGAAGG - Intronic
962811160 3:138960587-138960609 GCTTCCGGCGGGCCTCTGCGGGG - Intergenic
964835112 3:160929722-160929744 GCTCCAGGCAGTCCTCTGGCAGG + Intronic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
968647299 4:1747222-1747244 GCTCCCGGCTTGGCTCAGAGAGG - Intergenic
968878842 4:3288360-3288382 GCGTCCGGCAGGCCTCTGCGCGG - Intergenic
968905405 4:3448451-3448473 CCTTCCGGCAGGGCTCTGGGTGG - Intronic
969022286 4:4146658-4146680 GCTCCTGGCAGGGCAGAGGGTGG - Intergenic
969313550 4:6368256-6368278 GCTGGCTGCAGGCCTCAGGTCGG - Intronic
969731587 4:8960735-8960757 GCTCCTGGCAGGGCAGAGGGTGG + Intergenic
970320793 4:14873575-14873597 GCTCCAAGAAGGCTTCAGGGAGG + Intergenic
971938981 4:33189441-33189463 CATCCTGGCAGCCCTCAGGGTGG + Intergenic
981660287 4:147158390-147158412 GCTCCCGGCCGTCCTGAGGCAGG + Intergenic
983513302 4:168631672-168631694 GCTCCCGGGAAGCCTCCTGGCGG - Intronic
985572715 5:658328-658350 GAGGCCGGGAGGCCTCAGGGAGG - Intronic
985635506 5:1033857-1033879 TTTCCCGGGAGGGCTCAGGGAGG + Intronic
988493717 5:31726932-31726954 GCTTCTGGGGGGCCTCAGGGAGG + Intronic
990324388 5:54660622-54660644 GCTTGCAGCAGGCCTCAGGTTGG - Intergenic
990380817 5:55220829-55220851 GGGTCCGGCAGGCCCCAGGGCGG - Intronic
997282278 5:132656547-132656569 GCTCCCGGCAGGGCTTTTGGTGG + Intronic
997349546 5:133220855-133220877 GCTCCTCCCAGGCCTCAGCGTGG - Exonic
997823498 5:137086412-137086434 GCACTCAGCAGCCCTCAGGGAGG + Intronic
998113248 5:139518042-139518064 GTTCCCGGCATGCCTCCGGCCGG + Intergenic
998556885 5:143134154-143134176 GCTACCTGCACGGCTCAGGGTGG + Intronic
999266734 5:150271431-150271453 CCTCCCGGCAGGCCTCATGTTGG - Intronic
999734981 5:154506281-154506303 GCTCCAAGCAGGACTCTGGGAGG - Intergenic
999849421 5:155522801-155522823 GTTCCCCCCAGGCCTCAGGCTGG + Intergenic
1001995633 5:176155242-176155264 TCTCCTGGCAGGACACAGGGAGG + Intergenic
1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG + Intronic
1006605005 6:35249764-35249786 GCTCCAGGCTGGCTTCAGAGTGG - Exonic
1013666480 6:112354626-112354648 GCCCCAGGCAGGCATTAGGGTGG - Intergenic
1014535781 6:122611124-122611146 GACCCCGGCAGGCCGCAGGGAGG + Intronic
1018979570 6:168592301-168592323 ACGCCCGTGAGGCCTCAGGGAGG - Intronic
1019028220 6:168990446-168990468 GATGGCGGCAGGCCTCAGAGGGG - Intergenic
1019280136 7:195543-195565 GCTCCCTGCAGGCCGCATGCGGG + Exonic
1019459983 7:1152753-1152775 GCTCCCCGCAGCCCTCAGAAGGG + Intronic
1019515868 7:1439959-1439981 GGTCCTGTCAGGCCTCACGGGGG + Exonic
1019640237 7:2099565-2099587 GCTCCCGCCTGGCCTCTGGGTGG - Intronic
1020104071 7:5413066-5413088 GCTCCCAGCAGGCCCTGGGGAGG + Intronic
1023567822 7:41540993-41541015 GCTCCAGGCAGTCCTCAGAGAGG + Intergenic
1024556044 7:50604447-50604469 GCTCATGGCAGGCCACTGGGTGG + Intronic
1024596307 7:50940575-50940597 GCTCCCCGCAGGCTTCAGCAGGG + Intergenic
1024932579 7:54679330-54679352 GCAATCGGCAGTCCTCAGGGAGG + Intergenic
1026562497 7:71462121-71462143 GCTCCAGGGAGGACTCTGGGTGG - Intronic
1027029044 7:74875021-74875043 GCTCCCGGCAGGCCCGGGTGGGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028583720 7:92432821-92432843 GCCCTCAGAAGGCCTCAGGGTGG + Intergenic
1028622566 7:92841217-92841239 GCTCTGGGGAGGACTCAGGGTGG - Intergenic
1029495163 7:100892605-100892627 GGACCCGGCACGCCTGAGGGAGG - Exonic
1032383981 7:131508893-131508915 GCTCACAGCAGGGCTGAGGGAGG - Intronic
1032791566 7:135246597-135246619 GCTCTCGGCAGGCCTCCGCCAGG - Exonic
1034406176 7:150903745-150903767 GCTCCAGCCAGGGCCCAGGGTGG + Intergenic
1034462593 7:151206052-151206074 ACTCTTGGCAGGCCCCAGGGAGG - Intergenic
1035228084 7:157444511-157444533 GCTACCGGGTGGCCGCAGGGTGG + Intergenic
1035381372 7:158443523-158443545 GCTACCAGGATGCCTCAGGGAGG + Intronic
1035633846 8:1128488-1128510 GCTGCCTGCAGGACTCAGCGCGG + Intergenic
1035742595 8:1939467-1939489 ACTCCCTCCAGGCCTCAGGCTGG + Intronic
1036707341 8:11055512-11055534 GCTCCCTGCAGGGCTGAGGGAGG - Intronic
1036760816 8:11507480-11507502 GCTCCCAAAAGCCCTCAGGGTGG - Intronic
1037367605 8:18139680-18139702 GCAACCAGCAGCCCTCAGGGCGG - Intergenic
1037695237 8:21217674-21217696 GCTCCTGGATAGCCTCAGGGTGG - Intergenic
1038491428 8:27974796-27974818 ACTCCAGGCAGGACTCAGGTGGG - Intronic
1040385794 8:46914232-46914254 GCTTGAGGCTGGCCTCAGGGAGG + Intergenic
1045357057 8:101398665-101398687 TCTCCAGGCAGGCCTCAGGGAGG + Intergenic
1049187429 8:141264695-141264717 TCTCCCCGAAGGCGTCAGGGTGG - Intronic
1049209473 8:141378881-141378903 GGTCCTGGCAGGCTTCAGGGTGG - Intergenic
1049213546 8:141397529-141397551 GCTCCCCGCTGGCCTCAGTTGGG + Intronic
1049259166 8:141629577-141629599 GCTCCCAGCCAGCCTCTGGGTGG + Intergenic
1049419674 8:142511128-142511150 GCTGCCGGCGGGCCTGCGGGTGG + Intronic
1049501016 8:142966016-142966038 GCAGCCAGCAGCCCTCAGGGTGG + Intergenic
1049760381 8:144329469-144329491 GCTCATCCCAGGCCTCAGGGAGG + Intergenic
1053166474 9:35847253-35847275 GGTCCCCTCAGCCCTCAGGGTGG - Intronic
1054159771 9:61665623-61665645 CGTCCAGGCAGGCCTGAGGGAGG - Intergenic
1054835705 9:69672726-69672748 GCTCCCGGCCGGACGCAAGGAGG + Intergenic
1055293186 9:74805696-74805718 GCCCCAGGCAGGCATTAGGGTGG + Intronic
1057215393 9:93225062-93225084 GCTCTGGGCAGGGCTCAGAGGGG + Intronic
1057385774 9:94604900-94604922 GTTCCCAGCAGGCTGCAGGGTGG - Intronic
1057702899 9:97376441-97376463 GCTCCCGAGAGGCCACAGTGTGG + Intronic
1057726583 9:97572504-97572526 GCTGAAGGCAGGTCTCAGGGAGG + Intronic
1058402401 9:104634105-104634127 GCCCCCGGCAGAGCTCAGGGCGG - Intergenic
1058915356 9:109559502-109559524 GCTCCCAGCACCCCTCAGTGAGG - Intergenic
1060742852 9:126111013-126111035 GCTCCAGGCAGGCCTCAGCATGG - Intergenic
1060927027 9:127462176-127462198 GCTCCCAGCGGGCATCAGGCAGG + Intronic
1061027003 9:128056276-128056298 GAGCCTGGCAGGCCTCAGTGGGG + Intergenic
1061182432 9:129032690-129032712 GCTCCATGCAGGCCCCATGGCGG - Intergenic
1061245690 9:129400409-129400431 GCTCAGGGCAGGCCTCTCGGGGG + Intergenic
1061762554 9:132860511-132860533 GCTCCAGGCATGCCTGAAGGAGG + Intronic
1061867381 9:133499824-133499846 GCTCCAGCAAGGACTCAGGGAGG - Intergenic
1062041625 9:134407041-134407063 GGTCCCTGCAGGACTCAGGTGGG - Intronic
1062165524 9:135105556-135105578 GCTCCAGGCTGGCCCCCGGGAGG - Intronic
1062578927 9:137221296-137221318 GGTCCCGCCAGGCCTGGGGGGGG + Exonic
1190266688 X:48831246-48831268 GATCCGGGCAGTGCTCAGGGTGG + Exonic
1191911825 X:66160005-66160027 GCTCCAGGCAGGCAACAGAGAGG + Intergenic
1192205327 X:69092054-69092076 GATCACGGAAGGCCTCAGTGAGG + Intergenic
1200128674 X:153829919-153829941 TCTCCCCGCAGGACCCAGGGCGG - Intronic
1202185335 Y:22181948-22181970 GCTGGCGGCAGGCCTCCGAGGGG - Intronic
1202206025 Y:22404447-22404469 GCTGGCGGCAGGCCTCCGAGGGG + Intronic