ID: 1002277704

View in Genome Browser
Species Human (GRCh38)
Location 5:178114220-178114242
Sequence TCCGGGACCTCCCGCAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002277699_1002277704 -10 Left 1002277699 5:178114207-178114229 CCCCCCAGGTAGCTCCGGGACCT 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277696_1002277704 -6 Left 1002277696 5:178114203-178114225 CCCGCCCCCCAGGTAGCTCCGGG 0: 1
1: 0
2: 4
3: 21
4: 250
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277692_1002277704 -1 Left 1002277692 5:178114198-178114220 CCCACCCCGCCCCCCAGGTAGCT 0: 1
1: 0
2: 7
3: 171
4: 2864
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277698_1002277704 -7 Left 1002277698 5:178114204-178114226 CCGCCCCCCAGGTAGCTCCGGGA 0: 1
1: 0
2: 1
3: 12
4: 186
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277688_1002277704 30 Left 1002277688 5:178114167-178114189 CCTCAGGGAGGGGCCAGGAGGAG 0: 1
1: 0
2: 9
3: 90
4: 704
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277691_1002277704 2 Left 1002277691 5:178114195-178114217 CCTCCCACCCCGCCCCCCAGGTA 0: 1
1: 0
2: 14
3: 166
4: 1298
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277689_1002277704 17 Left 1002277689 5:178114180-178114202 CCAGGAGGAGACGCGCCTCCCAC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277693_1002277704 -2 Left 1002277693 5:178114199-178114221 CCACCCCGCCCCCCAGGTAGCTC 0: 1
1: 1
2: 7
3: 55
4: 597
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1002277694_1002277704 -5 Left 1002277694 5:178114202-178114224 CCCCGCCCCCCAGGTAGCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002277704 Original CRISPR TCCGGGACCTCCCGCAGCTT TGG Intronic
900471433 1:2856890-2856912 TCCGGCAGCTCCTGCAGCATCGG - Intergenic
904826426 1:33276501-33276523 CCCGGCACCTGCTGCAGCTTGGG - Exonic
912518137 1:110228528-110228550 TCCGGGACTTTCCACAGCCTTGG - Intronic
921956788 1:220993331-220993353 TCCTTGACCTCCCACAGCCTCGG + Intergenic
922561531 1:226573028-226573050 TCCTGGGCCTGCCGCAGGTTTGG + Intronic
922677825 1:227563608-227563630 ACCAGGGCCTCCCGCAGCTGGGG - Exonic
924041621 1:239989459-239989481 TCAGGGCCCTCCCGCAGCAGCGG - Intergenic
1066064012 10:31749564-31749586 GCCAGGACCTTCCCCAGCTTCGG - Intergenic
1074311161 10:112324494-112324516 TCCGGGAACTGCAGCAGCTCTGG + Intergenic
1076216895 10:128702015-128702037 CCAGGGACCTCCGGCAGCTCAGG + Intergenic
1077008910 11:371397-371419 TCCTGGACCTCCCTAAGCTGAGG + Intronic
1077074705 11:695080-695102 TCCGGGACCGCCCGAAGCGCCGG + Exonic
1083856158 11:65394079-65394101 ACCTGGAGCTCCCGCCGCTTTGG - Exonic
1085353521 11:75815697-75815719 TCCGGGATCTCCCGGAGGTTCGG - Intronic
1090043693 11:123312848-123312870 TCCAGGACCTCCCTCAGGATAGG - Intergenic
1096385977 12:51195828-51195850 TCTGGGACCTCCCCCACTTTAGG + Intronic
1102346407 12:112163802-112163824 TCCGGGACCTCCAGCTGAGTGGG - Intronic
1111392222 13:87611270-87611292 TCAGGTCCCTCCCGCAGCATTGG - Intergenic
1112437858 13:99404486-99404508 TGCGGGGCCCCACGCAGCTTTGG + Intergenic
1113900099 13:113792002-113792024 TCTGGGGCCTCCCGCAGTTCCGG - Intronic
1114640437 14:24216014-24216036 TGCGGAACCTCCGGCAGCTAAGG + Exonic
1119756392 14:77122961-77122983 TCAGGGAGCTCCTGCAGCTCTGG - Intronic
1122808922 14:104278122-104278144 TCCAGGCCCTCCCGCAGCCGAGG - Intergenic
1123067464 14:105625837-105625859 ACCGTGCCCTCCAGCAGCTTGGG - Intergenic
1123076439 14:105669616-105669638 ACCGTGCCCTCCAGCAGCTTGGG - Intergenic
1123091141 14:105742842-105742864 ACCGTGCCCTCCAGCAGCTTGGG - Intergenic
1123096912 14:105771177-105771199 ACCGTGCCCTCCAGCAGCTTGGG - Intergenic
1127807548 15:62534963-62534985 TCCGGGAAGTCCTGCAGCTCTGG + Intronic
1132055255 15:98647508-98647530 TCCGCGGCCTCGCGCAGCTCAGG - Intergenic
1132747453 16:1442958-1442980 TCCCGGACCTCCACCAGCCTGGG + Exonic
1133282962 16:4677466-4677488 TCCGGGCCCTCCTGCAGATCCGG + Exonic
1139740821 16:69033667-69033689 TCCAGGACCTCCCGCCACATTGG - Intronic
1140478451 16:75250480-75250502 CCCGGGGCCCGCCGCAGCTTTGG - Intronic
1141722761 16:85765976-85765998 TCAGGGACCTCGCTCAGGTTGGG + Intergenic
1144221520 17:13104294-13104316 GTCTGGACCTCCAGCAGCTTTGG + Intergenic
1145124231 17:20286923-20286945 TCCAGGAGCTCCTGCAGCCTGGG - Intronic
1148105939 17:45118889-45118911 TCCAGGAACTCCAGCAGCTCAGG + Exonic
1154207640 18:12351337-12351359 TCCTGGACCCCGCGCTGCTTAGG - Exonic
1161371590 19:3914982-3915004 TCAGGGACCCCCCGGAGCTTGGG + Intronic
1168713381 19:58513999-58514021 TCCGGGGCCTCCCGCACAGTCGG - Exonic
932562758 2:72887469-72887491 ACCGGGGCCTCCCGCGGCTTCGG + Exonic
932578699 2:72978789-72978811 TCTGGGCCCTACCTCAGCTTTGG - Intronic
938248743 2:129797852-129797874 TCCGGGGCCTCCAGCAGCTCGGG + Intergenic
945359465 2:208879604-208879626 TTCTGGACCTCCCTCAGCTCTGG + Intergenic
948310244 2:236980241-236980263 TCCAGGACCTCTTGCAGCTCAGG - Intergenic
1174134747 20:48372002-48372024 TACCGGACCTCCCCCATCTTGGG - Intergenic
1174168980 20:48604636-48604658 TCCTGGACCTCCTGCTGCTGAGG + Intergenic
1174342373 20:49906011-49906033 TGCAGGACAGCCCGCAGCTTTGG + Exonic
1175994223 20:62805132-62805154 TCCTGGAGCTCCCGCAGCCCCGG + Intronic
1179999877 21:44990786-44990808 TCCTGGCCCTCCTGCAGCTCGGG + Intergenic
1180014791 21:45074894-45074916 CCCGGGACGGCCCGCAGCTCCGG - Intronic
1183548062 22:38465877-38465899 TTCGGAACCTGCCGCAGCTCAGG + Intergenic
1183927717 22:41217777-41217799 TCCTGGATTTCCCGGAGCTTAGG - Intronic
1185317984 22:50186947-50186969 TGCGGGGACTCCCGCAGCCTCGG + Intronic
952905853 3:38138699-38138721 GCCGGGACCTCCTGCAGCCATGG - Exonic
961043910 3:123695901-123695923 TCCGGGACCTGCCTCTGCTGAGG - Intronic
961664201 3:128486193-128486215 TCCAGGGCCTCCAGCAGCTGAGG + Exonic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
968054291 3:195679388-195679410 TCCGGCACCTCACGGAGCCTGGG - Intergenic
968101596 3:195969758-195969780 TCCGGCACCTCACGGAGCCTGGG + Intergenic
968509587 4:989547-989569 TGTGGGACCTCCCGCGGCTGTGG - Exonic
971289733 4:25326187-25326209 TCTGGGACCACCTGCATCTTTGG + Intronic
973785994 4:54333084-54333106 TCTGGGAGCTCACACAGCTTTGG + Intergenic
981317041 4:143350082-143350104 TCCGGGCCCTCCCGCTGCACCGG + Intronic
984638917 4:182142938-182142960 TCTGGAACCTCCAGCAGTTTCGG + Intergenic
992399937 5:76403109-76403131 GCCGGGACCCCCTGCAGCTGGGG - Intergenic
1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG + Intronic
1002527121 5:179821040-179821062 TCCCGGACCCGCCGCAGCCTCGG - Exonic
1010382047 6:75236596-75236618 TCTGGGACCTCCCACAGATACGG - Intergenic
1013072349 6:106740700-106740722 TCCTGGACCTCCCAAAGCATTGG + Intergenic
1015822430 6:137278997-137279019 TCCTGGGCATCCCGCAGCCTGGG + Intergenic
1019565986 7:1679361-1679383 TCTGGGACCTCCCCAAGCCTGGG + Intergenic
1024963970 7:55005370-55005392 CCCAGGTCCTCCCGCAGCCTCGG + Intergenic
1034425266 7:151010636-151010658 TCCAGCACCTCCAGCAGCGTGGG - Exonic
1050013756 9:1211444-1211466 TCTGGGACCTCCCAGAGTTTTGG + Intergenic
1052264187 9:26552620-26552642 TCCGGGACCACACACACCTTGGG + Intergenic
1056588299 9:87943945-87943967 TCTGGGCCCTCCCGAAGCTGAGG - Intergenic
1199199975 X:145075766-145075788 TCCCAGACCTCCTGCAGCTGAGG + Intergenic