ID: 1002282102

View in Genome Browser
Species Human (GRCh38)
Location 5:178137125-178137147
Sequence GATGGAGAGCAGGCCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 911}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002282094_1002282102 9 Left 1002282094 5:178137093-178137115 CCAGCCTCTCAAGTAGTCGAGGA 0: 1
1: 0
2: 0
3: 14
4: 86
Right 1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 7
3: 112
4: 911
1002282096_1002282102 5 Left 1002282096 5:178137097-178137119 CCTCTCAAGTAGTCGAGGAGGTA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 7
3: 112
4: 911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002282102 Original CRISPR GATGGAGAGCAGGCCAGGTG AGG Intronic
900090727 1:919303-919325 GCTGGAGCCCAGGCCAGCTGGGG - Intergenic
900345987 1:2210472-2210494 TTTGGGGAGGAGGCCAGGTGGGG + Intronic
900395196 1:2450601-2450623 GTTGGAGGGCAGGCCGAGTGGGG - Intronic
900711861 1:4119526-4119548 GATGGAGAGCTGCCCAGGACAGG - Intergenic
900782390 1:4626601-4626623 AAGGAAGGGCAGGCCAGGTGTGG + Intergenic
900972622 1:5999958-5999980 GATGGGGTGCAGGCAGGGTGCGG - Intronic
901258036 1:7848805-7848827 GATGTACAGAAGGCCGGGTGCGG - Intronic
901422816 1:9162405-9162427 CGTGGAGGTCAGGCCAGGTGGGG + Intergenic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901827636 1:11872767-11872789 GATGCAGAGAAGGTCATGTGAGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902555869 1:17246247-17246269 GATGGAGATCAGATCAGGGGAGG + Intergenic
902647650 1:17812781-17812803 AATAGAGAGATGGCCAGGTGTGG - Intronic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
902921733 1:19670070-19670092 GAAGGAGAGGAGGCCAGATAGGG - Intronic
903443588 1:23406463-23406485 CAAGGAGAGCAGGCCAGGCCAGG - Intronic
903492109 1:23737115-23737137 TATGGAGTGCTGGCCAGGCGTGG + Intergenic
904024440 1:27493425-27493447 GATGAACCCCAGGCCAGGTGTGG - Intergenic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
904378765 1:30097385-30097407 GATGGATTGCAGGGCAGGTGGGG + Intergenic
904381961 1:30117488-30117510 GATGGAGACCGGGTCAGCTGAGG + Intergenic
904449193 1:30600230-30600252 AATGGAGAGCAAGACAGGTGTGG - Intergenic
904454350 1:30638412-30638434 AATGGTGAGCGGTCCAGGTGTGG + Intergenic
904468979 1:30724051-30724073 GCTGGAGAGCAGGGCGTGTGCGG - Intergenic
904489676 1:30850608-30850630 GATGGCGTGGAGGCCAGATGGGG - Intergenic
905054632 1:35082619-35082641 GTTGGAAAGCAGGCCAGGCGTGG - Intronic
905526236 1:38642054-38642076 GATGGGGTGCATGGCAGGTGAGG + Intergenic
905539248 1:38746976-38746998 GAAGGAGAGCAGGGAGGGTGGGG + Intergenic
905646367 1:39627197-39627219 GATGAAGGTCATGCCAGGTGTGG + Intronic
905652328 1:39664777-39664799 CAAGAAAAGCAGGCCAGGTGCGG - Intronic
906072365 1:43026365-43026387 AAGGGAGAACAGGCCGGGTGCGG + Intergenic
906090418 1:43174525-43174547 AATGGACATCTGGCCAGGTGTGG + Intronic
906208731 1:44000654-44000676 TATGGAGCTCCGGCCAGGTGCGG + Intronic
906384538 1:45356341-45356363 GAGTGAGTTCAGGCCAGGTGTGG + Intronic
907118391 1:51989533-51989555 CCTGGGGAGGAGGCCAGGTGTGG - Intronic
907406338 1:54255780-54255802 GCTGGAGAGCTGGCCAGGCACGG + Intronic
907589315 1:55651002-55651024 CTTGGAGTGAAGGCCAGGTGTGG - Intergenic
907751290 1:57265766-57265788 GACGGAGAGCAGGCTTGGAGTGG + Intronic
908352863 1:63303164-63303186 GATGGAAAGGCGGCCAGGTGAGG - Intergenic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
909224847 1:73006174-73006196 GAAAAAGAGCAGGCCAGGCGTGG - Intergenic
909972409 1:82006622-82006644 GATGGAGGCTCGGCCAGGTGGGG + Intergenic
910290512 1:85596066-85596088 GATGGAGAACAGGCTGGGCGTGG + Intergenic
912499940 1:110115019-110115041 GGCTGAGAGCAGGCCAGGGGAGG + Intergenic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912713329 1:111964926-111964948 GATGAAGAGCTTGCCAGGTGTGG - Intronic
912729458 1:112089339-112089361 GATGAATAAGAGGCCAGGTGTGG - Intergenic
913244482 1:116859752-116859774 GAAGTAAAGGAGGCCAGGTGCGG - Intergenic
913972395 1:143424506-143424528 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
914066777 1:144250119-144250141 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
914112376 1:144716235-144716257 GATCCAGGGGAGGCCAGGTGGGG + Intergenic
914823414 1:151122966-151122988 CATGGAGAGAATGGCAGGTGAGG + Exonic
915086808 1:153394690-153394712 GAGGGACAGCAGGCCAGGCCCGG + Intergenic
915270589 1:154750656-154750678 GATGGAGAGCTGGTTAGGTAGGG + Intronic
915299934 1:154946101-154946123 GAAGGAGGGCAGGCCAAGGGTGG - Exonic
915302615 1:154959972-154959994 TATGGACCACAGGCCAGGTGCGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
915563896 1:156703447-156703469 GCGGCAGATCAGGCCAGGTGAGG - Intronic
915959719 1:160255422-160255444 GAGGGAGAAGAGGCCAGGTGTGG - Intronic
915978463 1:160405780-160405802 GAAGGAGAGGAGGAAAGGTGGGG + Intronic
916038731 1:160944140-160944162 AAAGGAGAGATGGCCAGGTGTGG - Intergenic
916617136 1:166453584-166453606 GATGGAGAGGCGGCCTGGTGTGG - Intergenic
916753890 1:167749867-167749889 CATGCAGATCAGGCCAGCTGTGG - Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
916860134 1:168794911-168794933 GAAAGATAACAGGCCAGGTGTGG + Intergenic
916943533 1:169700943-169700965 AATTAAGAGCAGGCCAGGCGTGG + Intronic
918077847 1:181183872-181183894 GATGTATAGGAGGCCGGGTGTGG - Intergenic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
918455800 1:184712214-184712236 TATGTTGAGTAGGCCAGGTGCGG - Intronic
918723617 1:187889166-187889188 GGTGGAAAACAGGTCAGGTGCGG + Intergenic
918728434 1:187955915-187955937 GAGGGATAGCTGGCCGGGTGCGG - Intergenic
918761973 1:188421139-188421161 GCTAGAAAGCAGGCCAGGAGTGG - Intergenic
919100429 1:193090092-193090114 GATGAAAAGTTGGCCAGGTGCGG - Intronic
919902704 1:202056005-202056027 CATGGAAATCAGGCCAAGTGAGG - Intergenic
920029617 1:203028691-203028713 GTTGGAGAGGAGGAGAGGTGAGG + Intronic
920132995 1:203747053-203747075 GATGGAGGGCAGGCTGGGCGTGG - Intergenic
920693324 1:208163392-208163414 GGTGGAAAGGAGGGCAGGTGAGG + Intronic
920969625 1:210732065-210732087 GAGGGAGCCCAGGCCAGCTGTGG + Intronic
921012404 1:211155529-211155551 GAAGGGGTCCAGGCCAGGTGCGG + Intergenic
921156502 1:212443029-212443051 AATGGAAGGAAGGCCAGGTGTGG - Intronic
921243306 1:213209403-213209425 AATGTAAAGGAGGCCAGGTGTGG + Intronic
921426096 1:215002703-215002725 GAAGGAGAGCAGCCCAGGAAAGG + Intergenic
921484224 1:215697247-215697269 AATAGGGGGCAGGCCAGGTGAGG - Intronic
921834342 1:219762407-219762429 GGTGGCCAGCAGGCCAGGTATGG - Intronic
921928032 1:220729243-220729265 GATGCTGATGAGGCCAGGTGGGG + Intergenic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
922178407 1:223215065-223215087 GATGGAGAGGAGGCTGGGTAGGG - Intergenic
922713668 1:227853330-227853352 TAGACAGAGCAGGCCAGGTGTGG - Intergenic
922801854 1:228368121-228368143 GCTGGTCAGCTGGCCAGGTGAGG - Intronic
922974096 1:229769295-229769317 GAAGGAGTCCAGGCCGGGTGTGG + Intergenic
922988135 1:229882634-229882656 GGTGGAGAGCATGCCAGAGGAGG - Intergenic
923338869 1:232991402-232991424 GAGAGAGAGCAGACCAGATGGGG + Intronic
923521306 1:234737113-234737135 AATGTATATCAGGCCAGGTGTGG - Intergenic
923794118 1:237136723-237136745 GATGCTGAGCAGGCTGGGTGTGG + Intronic
924156484 1:241181980-241182002 GATAGAGAGCAGGCCAGGAATGG - Intronic
924415046 1:243849985-243850007 GAGGGAGTGGAGGCCAGGCGGGG + Intronic
1062835613 10:633615-633637 CATGGAGAGCAGTCCATCTGTGG - Intronic
1062948300 10:1477035-1477057 GTTGGATCGTAGGCCAGGTGGGG - Intronic
1063159580 10:3409382-3409404 GATGGAGAGAAGGCCCAGTGAGG + Intergenic
1063326048 10:5103176-5103198 GATGAAGAGGAGGCCAGGAGCGG - Intronic
1063473522 10:6308220-6308242 AATGCAGGGAAGGCCAGGTGCGG + Intergenic
1063741721 10:8829590-8829612 GAAAAAGAACAGGCCAGGTGTGG - Intergenic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1065114157 10:22468149-22468171 GCTGCAGGGCTGGCCAGGTGTGG - Intergenic
1065322792 10:24524597-24524619 GCTGGGGAGCTGGCCACGTGAGG - Exonic
1066025986 10:31361554-31361576 GATGGTGAGGGGGCCGGGTGGGG + Intronic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1066600963 10:37106756-37106778 GCCGGATAGCAGGCCAGGCGCGG + Intergenic
1067032076 10:42884819-42884841 GAGGAGGGGCAGGCCAGGTGTGG - Intergenic
1067081713 10:43216157-43216179 GGTGGGGACCAGGCCAGGTTGGG - Intronic
1068455249 10:57247001-57247023 GATGTCGGGCAGGCCAGGAGTGG - Intergenic
1068933797 10:62617011-62617033 GATAGAGAGCAGCTCAGCTGGGG - Intronic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069415469 10:68196773-68196795 AAGGGAGAGGGGGCCAGGTGTGG - Intronic
1069575069 10:69521217-69521239 AAGGCAGAGGAGGCCAGGTGTGG + Intergenic
1069799056 10:71070989-71071011 GAGATAGAGCAGGCCACGTGGGG + Intergenic
1070060034 10:72973052-72973074 AAAGGAGAGCAGGCTGGGTGTGG - Intergenic
1070485969 10:76931819-76931841 GAAGGTGAGCAGACCAGGTAAGG - Intronic
1070494323 10:77007967-77007989 GATGGAGAGCAGGCTCCCTGGGG + Intronic
1070622491 10:78024071-78024093 ACTGGAGAGCTGGCCGGGTGTGG + Intronic
1070706930 10:78646568-78646590 AATGGAGAGAAGGTCATGTGAGG - Intergenic
1070982071 10:80657151-80657173 CGTGGAGAGCAGGCCTTGTGAGG - Intergenic
1071431396 10:85609687-85609709 GATGGAAACCGGGCCAGGGGAGG + Intronic
1071528320 10:86371302-86371324 CATGGTGGGCAGCCCAGGTGAGG + Intergenic
1071568768 10:86685124-86685146 GAGGGAGAGGAGGTCAGGTTTGG + Intronic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072518600 10:96210659-96210681 GACAGAGGGCAGGCCAGGAGGGG + Intronic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1073037849 10:100576599-100576621 GATGAAGGGCAGGGCAGGGGAGG - Intergenic
1074590741 10:114810530-114810552 AAGGGAGTTCAGGCCAGGTGCGG - Intergenic
1074694933 10:116041938-116041960 GTTGGAGAGGAGGCCATGTTTGG - Intergenic
1074814935 10:117136396-117136418 GGTGAAGAGCAGGCTAGGTAGGG + Intronic
1075467346 10:122661746-122661768 ATTGGTGATCAGGCCAGGTGCGG - Intergenic
1075559121 10:123455818-123455840 GATGCAGAGCAGGCCCGGGCGGG + Intergenic
1075670908 10:124263644-124263666 GAGGGAGAGGAGGCGAGGGGAGG - Intergenic
1075902450 10:126053995-126054017 GACTGAGACCAGGCCAGGTACGG - Intronic
1076738341 10:132468536-132468558 GATGGAAAGCAGGGGAGGGGAGG + Intergenic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077132619 11:980860-980882 GGTGGAGGCCAGGCCAGGAGAGG + Intronic
1077253537 11:1571180-1571202 GATGCGGAGCAGACCAGGTGGGG - Intronic
1077466053 11:2734272-2734294 GCTGCAGAGCAGGGCAGGGGTGG + Intronic
1077625925 11:3771151-3771173 GATGGAAAAGAGGCCAAGTGTGG - Intronic
1077964157 11:7109623-7109645 AGTGGAAAGTAGGCCAGGTGTGG - Intergenic
1078219455 11:9339481-9339503 AATAAACAGCAGGCCAGGTGCGG + Intergenic
1079054928 11:17197308-17197330 AATGGAGTGGGGGCCAGGTGCGG - Intronic
1081547994 11:44085446-44085468 AAAATAGAGCAGGCCAGGTGAGG - Intergenic
1081625956 11:44655162-44655184 GATGGAGGTCAGGTCAGGAGGGG + Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1082233640 11:49798185-49798207 GATGGGCGGCCGGCCAGGTGTGG + Intergenic
1082848265 11:57743450-57743472 GTTGCAGGTCAGGCCAGGTGCGG - Intronic
1083106106 11:60360316-60360338 GCTGGAGTGCAAGACAGGTGTGG - Intronic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1084114700 11:67035288-67035310 GTTAAAAAGCAGGCCAGGTGTGG - Intronic
1084138270 11:67204089-67204111 AATGTAGGGGAGGCCAGGTGTGG - Intronic
1084237652 11:67798395-67798417 GATGGAGCACAGGTCAGTTGTGG + Intergenic
1084261580 11:67982300-67982322 GGTGGCGATCAGCCCAGGTGGGG + Intergenic
1084522625 11:69673841-69673863 AGTGGATTGCAGGCCAGGTGCGG - Intronic
1084601326 11:70147523-70147545 GATGCAGAGCTGAGCAGGTGAGG - Intronic
1084811062 11:71611811-71611833 GGTGGCGATCAGCCCAGGTGGGG - Intergenic
1084834751 11:71794433-71794455 GATGGAGCACAGGTCAGTTGTGG - Intronic
1084962780 11:72726070-72726092 GAGGGAGGGCATGCCAGATGAGG + Intronic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1087059816 11:93966653-93966675 GAAGTAGCACAGGCCAGGTGTGG + Intergenic
1087296164 11:96376716-96376738 GAAGAAAAGCAGGCCAGGCGCGG - Intronic
1087672249 11:101121874-101121896 GAATGAGGACAGGCCAGGTGTGG + Intronic
1087752290 11:102020100-102020122 GAAGAAGAAGAGGCCAGGTGTGG + Intergenic
1088670136 11:112132584-112132606 GCTAGCTAGCAGGCCAGGTGCGG - Intronic
1089270657 11:117299600-117299622 AATGGAAACCAGGCCAGGAGTGG - Intronic
1089466084 11:118687661-118687683 GAAGGAGAGCAGGGGAGGTGGGG - Intergenic
1089502359 11:118940134-118940156 GATGGGAAGCAGGCCATGTGAGG - Intronic
1089563108 11:119355777-119355799 GCTGGGGAGCAGACCAGGGGTGG + Exonic
1090015806 11:123085537-123085559 AATGGAAGGCAGGCCAGGCGTGG - Intronic
1090248995 11:125237996-125238018 GAAGGAGAGCAGGGGACGTGAGG - Intronic
1090293462 11:125566610-125566632 GAAGGATGGCGGGCCAGGTGCGG + Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090391023 11:126387385-126387407 AAAGGTAAGCAGGCCAGGTGTGG + Intronic
1090393369 11:126403832-126403854 GATGGGGTGCAGGGCAGGCGGGG - Intronic
1090405389 11:126473205-126473227 GATGGGGAGGAGGCTAGGTAAGG - Intronic
1090663340 11:128897386-128897408 GATGGTCAACAGGCCAGGCGTGG - Intronic
1090709640 11:129373638-129373660 GATGGAGAGGAGGGGAGGGGAGG + Intergenic
1090865538 11:130697656-130697678 GAGGGAGCCCAGGCCAGCTGTGG - Intronic
1091419665 12:325721-325743 GAAGGAAACGAGGCCAGGTGTGG + Intronic
1091479203 12:809052-809074 GAGAGATAGGAGGCCAGGTGCGG - Intronic
1091663351 12:2400735-2400757 AGTGGTGAGCAGGCCAGATGGGG - Intronic
1091942978 12:4507140-4507162 GATTGAGATCATGACAGGTGTGG - Intronic
1092157889 12:6296196-6296218 GATGGAGAACAGGACAGGATAGG + Intergenic
1092346831 12:7722288-7722310 CATATAGATCAGGCCAGGTGAGG - Intergenic
1094204610 12:27827066-27827088 GAATGATATCAGGCCAGGTGTGG - Intergenic
1094454612 12:30618792-30618814 GATGGGAAGCAGGCCGGGTGCGG + Intergenic
1094612518 12:32007887-32007909 GTTACAGAGCAGGCCAGGCGCGG - Intergenic
1096412936 12:51390487-51390509 GATGAAAACCAGGTCAGGTGAGG - Intronic
1096429994 12:51534931-51534953 GGTGGAGATGAGGCCACGTGGGG + Intergenic
1096606603 12:52770993-52771015 GAGGGAGAGGAGTGCAGGTGAGG - Exonic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096641548 12:52998597-52998619 TCTGGTTAGCAGGCCAGGTGCGG - Intergenic
1096741763 12:53698648-53698670 GACAGAGATGAGGCCAGGTGCGG - Intergenic
1096768135 12:53911165-53911187 AATAATGAGCAGGCCAGGTGCGG - Intergenic
1097186548 12:57199397-57199419 GACGGTGAGCAGGCAAGGGGTGG + Exonic
1097797960 12:63883991-63884013 GTAGGAGAGCAGGCCAGGCGCGG + Intronic
1097863148 12:64537936-64537958 GACGAAGAGGAGGCCATGTGAGG - Intergenic
1098199544 12:68040170-68040192 CATGGAGAGCAGAACTGGTGGGG + Intergenic
1099223963 12:79946545-79946567 AATGGAAAGCTGGCCAGGAGCGG - Intergenic
1099533985 12:83823480-83823502 GCTGGAGTGTAAGCCAGGTGCGG - Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1100494495 12:95111941-95111963 GAATGTGATCAGGCCAGGTGTGG + Intronic
1101359896 12:104016344-104016366 GATGATGTGCAGGCCGGGTGTGG + Intronic
1102469286 12:113150488-113150510 GCAGGAGAGCAGGTCAGGTGGGG - Intronic
1102704673 12:114870667-114870689 GAAGGAGGGCTGGCCAAGTGGGG + Intergenic
1102933873 12:116881341-116881363 GAGGGAGAGGAGGCGAGGGGCGG - Exonic
1103000441 12:117381779-117381801 GATGGAGAATTGGACAGGTGGGG - Intronic
1103010514 12:117455092-117455114 GATGCAGAGCAGGCCTGAGGTGG + Exonic
1103019474 12:117522395-117522417 AATGGAGAGAAGGCCAGGGGTGG + Intronic
1103249727 12:119489191-119489213 GTTGGAGAGCAGTCAAGCTGTGG - Intronic
1103330241 12:120149229-120149251 GAGGGAGAGCTGGCCAGGCGTGG + Intronic
1103536175 12:121635098-121635120 GGTGGCCATCAGGCCAGGTGTGG + Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1103636218 12:122308098-122308120 GATGGAGAGGAGCCCAAGTCAGG + Intronic
1103804610 12:123562708-123562730 GAGGGGGAGCAGGCCGGGCGCGG + Intergenic
1104111615 12:125710079-125710101 GATGGAGAGTCGGCCAGGGCAGG - Intergenic
1106808047 13:33331654-33331676 AATGAAGAACAGACCAGGTGTGG - Intronic
1107864291 13:44688284-44688306 GACGGAGAGCATTCCAAGTGAGG - Intergenic
1108091650 13:46855653-46855675 GATGGCCAGCAGGGCAGGTGAGG + Intronic
1108502789 13:51083819-51083841 AATGAGGACCAGGCCAGGTGAGG + Intergenic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109713953 13:66196048-66196070 TATGAACATCAGGCCAGGTGTGG - Intergenic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1112516285 13:100055850-100055872 AAGGGAGATCAGGCCAGGCGTGG + Intergenic
1113405040 13:110031216-110031238 CATGGAGAAAAGGCCATGTGAGG - Intergenic
1113581056 13:111429434-111429456 AATGGAGAGCAGCACGGGTGTGG - Intergenic
1114781713 14:25545572-25545594 GATGAAGAGATGGCCAGGTACGG - Intergenic
1115229512 14:31144670-31144692 AATGGGGAGCAGGCCAGATTTGG + Intronic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115755021 14:36520759-36520781 GCTGGAGCGCTGGCCAGGAGGGG + Intronic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1117341671 14:54797449-54797471 GATGCACATCTGGCCAGGTGTGG - Intergenic
1117485046 14:56187805-56187827 GATGGAGGGCAGCCTAGGTTTGG + Intronic
1118026684 14:61775542-61775564 TATAGAGGGTAGGCCAGGTGTGG - Intronic
1118542105 14:66839986-66840008 TATTGAAAGCAGGCCAGTTGTGG + Intronic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1118938970 14:70315148-70315170 GCTGGAGAGCATCTCAGGTGCGG - Intergenic
1119030626 14:71189402-71189424 AAGAGAGAGGAGGCCAGGTGTGG - Intergenic
1119327444 14:73769198-73769220 GGTGGTGAGCTGGGCAGGTGTGG + Intronic
1119776629 14:77253206-77253228 GGTGGTGAGAAGCCCAGGTGTGG + Intronic
1119881740 14:78105133-78105155 GATGCAGAGCAGGTCAGACGTGG - Intergenic
1120209294 14:81619154-81619176 GATGGTGACAAGCCCAGGTGGGG - Intergenic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1122238499 14:100346242-100346264 GAAGGAGAGCAGGGCAGGGGTGG + Intronic
1122332135 14:100927797-100927819 AATTGAAAGAAGGCCAGGTGTGG + Intergenic
1122359577 14:101151477-101151499 GATGGAGGGGAGGCCAGATTGGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1122896091 14:104757822-104757844 GATGGTGTGCAGGGCAGGAGTGG - Intronic
1123112531 14:105880035-105880057 CAGGGAGAGCAGGGCAGCTGGGG + Intergenic
1123114191 14:105886533-105886555 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114210 14:105886597-105886619 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114234 14:105886677-105886699 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114254 14:105886742-105886764 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123116408 14:105896141-105896163 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123118413 14:105905198-105905220 GGTGAAGTCCAGGCCAGGTGAGG + Intergenic
1123120643 14:105914842-105914864 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123167899 14:106344056-106344078 AATGCACAGGAGGCCAGGTGGGG - Intergenic
1202829040 14_GL000009v2_random:5958-5980 GAGGGGGAGGAGGCAAGGTGAGG - Intergenic
1202833564 14_GL000009v2_random:60659-60681 CATGGAGAGCAGGCAACATGTGG + Intergenic
1123435654 15:20252196-20252218 GAAAGATAGGAGGCCAGGTGCGG + Intergenic
1123457756 15:20441368-20441390 GAGGGAGAGCAGGTCCTGTGGGG - Intergenic
1123660314 15:22559049-22559071 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1123662115 15:22573439-22573461 GACGGACAGCGGCCCAGGTGCGG - Intergenic
1124262097 15:28202067-28202089 GACGGACAGCGGCCCAGGTGCGG + Intronic
1124263902 15:28216522-28216544 GAGGGAGAGCAGGTCCTGTGGGG - Intronic
1124314172 15:28653538-28653560 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1124315919 15:28667721-28667743 GACGGACAGCGGCCCAGGTGCGG - Intergenic
1125479484 15:40070318-40070340 GGTGGAGAGCAGGGGAGGTCAGG + Intergenic
1125531409 15:40415920-40415942 GATGGAGATGGGGGCAGGTGTGG - Intronic
1125823862 15:42658820-42658842 AAAGAAAAGCAGGCCAGGTGTGG + Intronic
1125833950 15:42734907-42734929 AATTGAGATCGGGCCAGGTGTGG - Intronic
1126039468 15:44576356-44576378 GAAGGGGGTCAGGCCAGGTGTGG + Intronic
1126116010 15:45208216-45208238 AAGAAAGAGCAGGCCAGGTGAGG - Intergenic
1126162741 15:45629336-45629358 AATGGAGATAAGGCCAAGTGTGG - Intronic
1126181179 15:45786607-45786629 GATGGAGAGGAATCCAGGAGAGG + Intergenic
1126188516 15:45854419-45854441 GTTGGAGAGTGGGCCAGGTGTGG - Intergenic
1126564563 15:50081524-50081546 GATGGAGAAGAGGCCAGATTAGG - Intronic
1128102045 15:65010084-65010106 GATGGAGAGTAGCTAAGGTGAGG - Intronic
1128146565 15:65335237-65335259 GAGGAGGAGGAGGCCAGGTGGGG + Intronic
1128253768 15:66182211-66182233 GATGGGGAGCAGGCCCGTGGAGG - Intronic
1128705318 15:69833963-69833985 GAGGGACGGCAGGGCAGGTGAGG - Intergenic
1128930613 15:71702024-71702046 GATGGAGAGGAGGCCTGGCAGGG - Intronic
1129039518 15:72674097-72674119 AATAGAAATCAGGCCAGGTGCGG + Intergenic
1129368742 15:75074099-75074121 GAAGTAAAGGAGGCCAGGTGTGG + Intronic
1129615808 15:77098148-77098170 GCTAGAGAGAAGGCCAGCTGTGG + Intergenic
1129756069 15:78099982-78100004 GATAGAGAGAACGGCAGGTGGGG - Intronic
1129819835 15:78592031-78592053 GAGGCAGAGGTGGCCAGGTGCGG + Intronic
1130834588 15:87637009-87637031 GATACAGAGCAGGCCAAGTGTGG + Intergenic
1131043306 15:89293394-89293416 AAGGGAGGGGAGGCCAGGTGCGG + Intronic
1131271013 15:90947714-90947736 GAGGGAGTCCAAGCCAGGTGTGG + Intronic
1131282904 15:91035002-91035024 CATGGAGAGCATGCCGCGTGTGG - Intergenic
1131370342 15:91875779-91875801 AGTAGAGAGCAGGCCAGGTTTGG - Intronic
1131372453 15:91894224-91894246 GTTGGAGAGGAGGGCAGGGGTGG + Intronic
1131651513 15:94404587-94404609 GATGAAACGGAGGCCAGGTGCGG - Intronic
1131810444 15:96167955-96167977 AATTTAGAGGAGGCCAGGTGTGG + Intergenic
1132230253 15:100176796-100176818 GATGGAGAGCAGACTAGTGGTGG - Intronic
1132415534 15:101616094-101616116 GAGGAAGAGCAGCCCACGTGCGG + Intergenic
1132486461 16:194654-194676 GGAGGACAGCAGGCCAGGGGAGG + Intronic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132686772 16:1165543-1165565 GATGCACCGGAGGCCAGGTGGGG - Intronic
1132898798 16:2242281-2242303 TATGGACAGTGGGCCAGGTGCGG - Intronic
1132929145 16:2449801-2449823 GGAGGAAAGCAGGCCAGGGGTGG - Intronic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1133326652 16:4946003-4946025 GATGGAGGACAGCCCAGGTCAGG + Intronic
1133961271 16:10495616-10495638 GAGGTAGACTAGGCCAGGTGTGG + Intergenic
1134133588 16:11665985-11666007 AATGGAGATGAGGCCGGGTGCGG - Intergenic
1135112322 16:19699805-19699827 AAAGCAGAGCTGGCCAGGTGTGG + Intronic
1135278870 16:21136842-21136864 GAGGAATAACAGGCCAGGTGTGG + Intronic
1135408072 16:22212608-22212630 GAGACAGAGAAGGCCAGGTGCGG - Intronic
1135875725 16:26198349-26198371 GCAGCAGAGCCGGCCAGGTGAGG - Intergenic
1136145605 16:28314687-28314709 GAGGGAGAAGGGGCCAGGTGCGG + Intronic
1136246331 16:28978300-28978322 GAGAGAGGGCAGGCCAGGTAGGG - Intronic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136407793 16:30058770-30058792 GAAGCAGAGCAGGCCAGGCGTGG - Intronic
1136656464 16:31712207-31712229 GCTGGATTGAAGGCCAGGTGGGG + Intergenic
1136714008 16:32262501-32262523 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136753897 16:32666918-32666940 GATGGAGGGCAGGTGAGATGGGG + Intergenic
1136814216 16:33203447-33203469 GATGGAGGGCAGGTGAGATGGGG - Intronic
1136820692 16:33313527-33313549 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136827255 16:33370066-33370088 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136832321 16:33468837-33468859 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136848950 16:33598799-33598821 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1136926297 16:34377766-34377788 CAAGCAGATCAGGCCAGGTGTGG - Intergenic
1136978277 16:35034041-35034063 CAAGCAGATCAGGCCAGGTGTGG + Intergenic
1137262076 16:46839352-46839374 CATGGAGAATCGGCCAGGTGTGG + Intergenic
1138434332 16:56988885-56988907 GAGGGAGAGCAGGGAAGGAGAGG - Intergenic
1138438453 16:57020236-57020258 GATGGAGAACAGGTGAGTTGTGG - Intronic
1138595665 16:58027752-58027774 GAGGGAGGGCAGAGCAGGTGGGG - Intronic
1138615237 16:58160132-58160154 GGTGGAGACCAGGGCAGGGGAGG - Intronic
1139462712 16:67135434-67135456 AGGGGAGAGCTGGCCAGGTGCGG - Intronic
1139492887 16:67296126-67296148 GATGGGGAGCAGGGCAGCCGAGG + Intronic
1139494843 16:67308840-67308862 AATGGAGGGCTAGCCAGGTGCGG + Intronic
1139607214 16:68027888-68027910 GAGAGAGAGCAGGCCAGGCTGGG + Intronic
1139934741 16:70561309-70561331 AATGGAATGAAGGCCAGGTGCGG - Intronic
1140077421 16:71714506-71714528 CATGGAGACCTGGTCAGGTGAGG - Exonic
1140225814 16:73075918-73075940 GATGAAAAGCTGGCCGGGTGCGG - Intergenic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1141440477 16:84026546-84026568 GAAGCAGAGCAGGCCTGCTGAGG + Intronic
1141643266 16:85354009-85354031 GAGGGACAGCATTCCAGGTGTGG - Intergenic
1141731720 16:85827454-85827476 GATGTAAAGCAGGCTGGGTGTGG + Intergenic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1141981914 16:87556060-87556082 GATGGGGTGGAGGCCACGTGGGG + Intergenic
1142120021 16:88382653-88382675 GCTGGAGCGCAGGCCAGGGATGG + Intergenic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1202992792 16_KI270728v1_random:26421-26443 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1203056046 16_KI270728v1_random:927251-927273 GATGGAGGGCAGGTGAGATGGGG + Intergenic
1203110657 16_KI270728v1_random:1447449-1447471 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142654553 17:1382732-1382754 AATGAAAAACAGGCCAGGTGCGG + Intronic
1142759482 17:2034659-2034681 GATGGGGAGCAGGGGAGGGGAGG - Intronic
1142913484 17:3114519-3114541 GATGATGGGAAGGCCAGGTGCGG - Intergenic
1143248451 17:5504739-5504761 GATGGTGAGCAAGCCTGGGGTGG - Intronic
1143406183 17:6678435-6678457 GCTGGGGAGCTGGCCAGGTAAGG + Intergenic
1143443149 17:6991331-6991353 GATGGGTTTCAGGCCAGGTGCGG - Intronic
1143475786 17:7203333-7203355 GATGGAGGGGAGGCCAGAGGTGG + Intronic
1143807432 17:9440959-9440981 GATGGAGAGGAGGCCAGCCATGG - Intronic
1143813005 17:9487706-9487728 GATGGAGATGAGGACAGGGGAGG + Intronic
1143872043 17:9964172-9964194 GATGCAGAGATGCCCAGGTGGGG - Intronic
1145081654 17:19899243-19899265 GAGGTAAAGGAGGCCAGGTGTGG - Intergenic
1145115883 17:20210674-20210696 GAGGGAGTGGAGGCCTGGTGGGG - Intronic
1145312411 17:21707867-21707889 GAGGGAGAGCAGGGAAGGTTGGG - Intergenic
1146230332 17:31102450-31102472 AAGGGAGAGTAGGCCAGGTGCGG + Intronic
1146708238 17:35017936-35017958 GATAGAGAGCAGTCCAGCAGTGG - Intronic
1147234688 17:39048663-39048685 GAGGCAGACTAGGCCAGGTGAGG + Intergenic
1147254028 17:39171250-39171272 GAAAGAGAGGTGGCCAGGTGTGG - Intergenic
1147745093 17:42690028-42690050 GTTAGAGGGCTGGCCAGGTGCGG - Intronic
1147779291 17:42928636-42928658 GAAGGAGACCAGGTGAGGTGCGG - Intergenic
1147918642 17:43902993-43903015 AATTAAGAACAGGCCAGGTGTGG + Intronic
1148093200 17:45034939-45034961 ACTGGAGAGCAGGGCAAGTGTGG + Exonic
1148140284 17:45323277-45323299 AATGCAGAGCAGAGCAGGTGAGG + Intergenic
1148170545 17:45515912-45515934 GGTGGAGCGCATGCCAGATGAGG - Intergenic
1148171022 17:45519905-45519927 GGTGGAGCGCATGCCAGATGAGG - Intergenic
1148278660 17:46329900-46329922 GGTGGAGCGCATGCCAGATGAGG + Intronic
1148300870 17:46547762-46547784 GGTGGAGCGCATGCCAGATGAGG + Intronic
1148364998 17:47048647-47048669 GGTGGAGCGCATGCCAGATGAGG + Intergenic
1148734220 17:49855683-49855705 GAAGGAGAGCAGGCTCGGGGTGG + Intergenic
1149425234 17:56548462-56548484 GATGAAGTTGAGGCCAGGTGTGG + Intergenic
1149809384 17:59653481-59653503 GAGGGAGAGGAGGCCGGGCGTGG - Intronic
1150255172 17:63738859-63738881 AATGGGGAACAGGCCGGGTGCGG + Intronic
1150401634 17:64861501-64861523 GGTGGAGCGCATGCCAGATGAGG - Intronic
1150781744 17:68128804-68128826 GGTGGAGTGCATGCCAGATGAGG - Intergenic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151426318 17:74033090-74033112 GAAGGAGAGTAAGCCAGATGGGG + Intergenic
1151467071 17:74292700-74292722 GACTGAAATCAGGCCAGGTGTGG - Intronic
1151516525 17:74599634-74599656 GATGGAGCCCAGGCCAGGCCTGG + Intergenic
1151768591 17:76145189-76145211 GATGGAATGCAGGGCAGGAGGGG + Exonic
1151769527 17:76151016-76151038 GATGGAAGCCAGGCCAGGAGCGG + Intronic
1152014773 17:77743351-77743373 ACTTGAGAGCAGGCCAGGTGTGG + Intergenic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152377529 17:79926545-79926567 GATGGGGAGGGGGCGAGGTGGGG - Intergenic
1152664210 17:81558014-81558036 GGTGCAGAGCAGCCCAGATGTGG + Exonic
1152763362 17:82121496-82121518 GATGGACAGCAGGTCTGCTGAGG + Intronic
1152804491 17:82348598-82348620 GAAGGAGAGGCTGCCAGGTGGGG + Intergenic
1152811721 17:82385649-82385671 GTTGGAGAGCAGCCCAGTGGTGG - Intergenic
1153721402 18:7907055-7907077 GATGAAGAGCAGGCCATTTCTGG - Intronic
1153837012 18:8972371-8972393 CATGGAGAGGAGGTCAGCTGTGG - Intergenic
1154156929 18:11951136-11951158 GCTGGGGAGCAGGCCAGGTCAGG + Intergenic
1154177561 18:12094762-12094784 GATGGAGTGCAGGACTGGTGTGG + Intronic
1155477198 18:26246821-26246843 GAATGAGATTAGGCCAGGTGCGG - Intronic
1155515248 18:26617881-26617903 GAAGGAGGGCAGGCAAGGTAAGG + Intronic
1156252703 18:35366189-35366211 GAGGGAAAGCAGGCCAGATGGGG - Intergenic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1157147369 18:45177547-45177569 GAGGGAGAGCATTCCAGATGCGG - Intergenic
1157513269 18:48293964-48293986 GCTGGAGATCAGGCCCGCTGTGG + Intronic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1158208576 18:55021712-55021734 GAGGTAGAGCCGGCCAGGTGCGG + Intergenic
1158498843 18:57982246-57982268 GAAGGCCAGCAGGGCAGGTGTGG + Intergenic
1158590537 18:58775110-58775132 GAAAGAAGGCAGGCCAGGTGCGG + Intergenic
1158595114 18:58809134-58809156 ACAGGGGAGCAGGCCAGGTGCGG + Intergenic
1158650659 18:59281767-59281789 AATTGAAAGCAGGTCAGGTGCGG - Intronic
1158892017 18:61881200-61881222 GAGAGAGAGAAGGCCGGGTGCGG - Intronic
1158968502 18:62644460-62644482 GATGGGGGGCGGGCCAGGGGTGG - Intergenic
1159038664 18:63302031-63302053 AAAAGAGAGGAGGCCAGGTGTGG + Intronic
1159054907 18:63453761-63453783 GACGGTGAGCAGGGCAGGAGAGG - Intergenic
1159672055 18:71233048-71233070 AATGGATAGAAGGCCAGGTATGG - Intergenic
1159868707 18:73736151-73736173 GCTAGAGAGGAGGCCAAGTGTGG + Intergenic
1159908932 18:74125242-74125264 AATGCAGAGCAGGCAAGCTGCGG + Intronic
1160099143 18:75904300-75904322 GAAGCAGAACAGGCCAGGAGTGG + Intergenic
1160350964 18:78177939-78177961 GATGGGGAGCAGGCTATGGGTGG - Intergenic
1160480126 18:79232307-79232329 GATGGTGTGCAGACAAGGTGTGG - Intronic
1160724706 19:612968-612990 GGTGGAAAGGAGGCCGGGTGCGG - Intronic
1160753825 19:747643-747665 GATGGAGAAGAGGCCGGGGGCGG - Exonic
1160951901 19:1671865-1671887 GAAGAAGAGCAGGCCGGGTACGG - Intergenic
1161001825 19:1914528-1914550 GGTGGATGTCAGGCCAGGTGGGG + Intronic
1161020680 19:2009861-2009883 AAAGGAGGGGAGGCCAGGTGCGG + Intronic
1161656431 19:5518393-5518415 GAGAGAGAGCGAGCCAGGTGTGG + Intergenic
1161663153 19:5559623-5559645 GATTGACAGCCGGCCAGGCGCGG - Intergenic
1161695874 19:5767745-5767767 AAGGGAGGGCAGGCCAGGCGCGG - Intronic
1161931098 19:7340960-7340982 GTGGGAGAAAAGGCCAGGTGTGG + Intergenic
1161986269 19:7656363-7656385 AATGAAGAGCAGTCCAGGCGTGG + Intergenic
1162150919 19:8645068-8645090 AATGGAAAGCTGGACAGGTGCGG - Intergenic
1162177630 19:8843036-8843058 TCTGAAGAGCAGGCAAGGTGGGG - Exonic
1162197678 19:8998318-8998340 GAGAGAGAGCAGGCTGGGTGCGG + Intergenic
1162228493 19:9244911-9244933 AATGGGCAGAAGGCCAGGTGTGG + Intergenic
1162259738 19:9522727-9522749 GATTGAAAAGAGGCCAGGTGTGG + Intergenic
1162598261 19:11646163-11646185 AATGTAGAACAGGCCAGGTGCGG - Intergenic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163492828 19:17626901-17626923 AATGGAGAACAGGCCAGATGCGG + Intronic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1163763509 19:19149787-19149809 GAAAATGAGCAGGCCAGGTGCGG + Intronic
1164207910 19:23073243-23073265 GCTGGAGGGAAGACCAGGTGGGG + Intergenic
1164578594 19:29420601-29420623 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578623 19:29420748-29420770 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578634 19:29420797-29420819 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1165278049 19:34772003-34772025 GTTAGAGAACAGACCAGGTGAGG + Intronic
1165316483 19:35059579-35059601 GCTGGAGCACAGGCCAGGAGGGG + Intronic
1165725039 19:38106782-38106804 GTTAGAGAGCAGCCCAGGTGTGG + Intronic
1165793355 19:38505281-38505303 GATGGAGGGGAGGCAGGGTGAGG - Intronic
1165860800 19:38908248-38908270 AATGGAGTTCTGGCCAGGTGCGG + Intronic
1165912165 19:39236328-39236350 GAGGCAGAAAAGGCCAGGTGTGG + Intergenic
1166042428 19:40212154-40212176 GATGGAGGCCAGGCCAGGGTGGG + Intronic
1166195439 19:41202808-41202830 GAGAGAGAGAAGGCCAGGTACGG + Intronic
1166367689 19:42285642-42285664 GATGGAGAGCAGGGCTAGGGCGG + Intronic
1166392899 19:42419716-42419738 GATGGAGGAAGGGCCAGGTGTGG + Intronic
1166570403 19:43792399-43792421 GATGTATAACAGGCCAGGTATGG - Intergenic
1166596878 19:44058243-44058265 GATGGACTGCAGGACAGTTGGGG - Intronic
1166639678 19:44484868-44484890 GATGTTTAGCAGGCCGGGTGCGG + Intronic
1166874908 19:45891161-45891183 GGTGGAGACAAGGCCAGGCGAGG + Exonic
1166892527 19:46002232-46002254 GGGTCAGAGCAGGCCAGGTGCGG - Intronic
1166921440 19:46231514-46231536 CATCGGGAGCAGCCCAGGTGGGG + Intergenic
1167268402 19:48494396-48494418 GATGGAGGTCAGGCCAGAGGAGG - Intronic
1167284868 19:48593259-48593281 GAGAGAGAGAAGGCCAGGTGTGG + Intronic
1167303603 19:48694544-48694566 TATGCAAAACAGGCCAGGTGTGG - Intergenic
1167305691 19:48707942-48707964 GAGGGGAAGGAGGCCAGGTGTGG + Intergenic
1167876512 19:52418271-52418293 TATGCTGAGCTGGCCAGGTGTGG - Exonic
1168169727 19:54577311-54577333 GAAGGAGAACAGGCTGGGTGGGG + Intronic
1168233728 19:55048980-55049002 CATGGGGAGAAGGCCATGTGTGG + Intronic
1168315801 19:55484303-55484325 GATGGAGGGCAGGCCCTGAGGGG - Exonic
1168343364 19:55638696-55638718 GATTTGGAGGAGGCCAGGTGTGG + Intronic
1168407416 19:56118186-56118208 CAGGGAGAGCAAGGCAGGTGTGG - Intronic
1168660696 19:58163628-58163650 CATGGAAATCAGGCCAGGTGTGG - Intergenic
1202639105 1_KI270706v1_random:67033-67055 CATGGAGAGCAGGCAACATGTGG - Intergenic
1202643658 1_KI270706v1_random:121831-121853 GAGGGGGAGGAGGCAAGGTGAGG + Intergenic
925234625 2:2267057-2267079 GAACCAGAGCAAGCCAGGTGGGG + Intronic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925410464 2:3636973-3636995 GCTGTAGAGCAGGTCAGGTCGGG + Intronic
926041019 2:9673267-9673289 TTTGAAGAGCAGACCAGGTGTGG + Intergenic
926043243 2:9691515-9691537 GATGGTGGCCAAGCCAGGTGAGG - Intergenic
926150869 2:10424997-10425019 GATGGAGGGCAGGGCAGGCGAGG - Intronic
926289157 2:11515084-11515106 GATGGATAGATGGGCAGGTGGGG - Intergenic
926911268 2:17853620-17853642 CCTGGAGAGGAGGACAGGTGTGG - Intergenic
927419783 2:22918445-22918467 GATAGAGATTAGGCCGGGTGTGG + Intergenic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
927751928 2:25677093-25677115 ATTGGACTGCAGGCCAGGTGCGG + Intergenic
927812266 2:26186683-26186705 GATTAAGTTCAGGCCAGGTGCGG + Intronic
928142660 2:28744121-28744143 GAAGAAGATCAAGCCAGGTGTGG + Intergenic
928299408 2:30112190-30112212 GCTGTAGAGCAGGCCAGGTGCGG + Intergenic
928650377 2:33397810-33397832 GATGGAGAAGAGGCCAGGCGTGG - Intronic
929117319 2:38455547-38455569 ATAGGAAAGCAGGCCAGGTGTGG - Intergenic
929222794 2:39482463-39482485 AAATGAGTGCAGGCCAGGTGTGG - Intergenic
929692110 2:44083565-44083587 AATGGTGAGCAAGACAGGTGGGG + Intergenic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
930179402 2:48337594-48337616 GAATGAGATCAGGCCAGGCGTGG - Intronic
930200638 2:48549349-48549371 GATGGAGTCCAGGCCTGGGGTGG + Intronic
930824883 2:55686922-55686944 GATTGAGACCAGGCCAGGCGCGG + Intronic
931387534 2:61810748-61810770 GCTGGGGACCAGGGCAGGTGTGG - Intergenic
931687430 2:64806458-64806480 GCTGGTGAGCAGGGCAGCTGGGG - Intergenic
931704876 2:64939030-64939052 GTGGGTGAACAGGCCAGGTGTGG + Intergenic
933228851 2:79782525-79782547 GAAGGCAAGCAGGCCAGGTGCGG - Intronic
933236818 2:79873606-79873628 AAGGGACAGTAGGCCAGGTGTGG + Intronic
933808541 2:86017711-86017733 GTTAGAATGCAGGCCAGGTGCGG - Intergenic
933871670 2:86572536-86572558 CATGGAGAAGAGGCCATGTGTGG - Intronic
934177088 2:89585444-89585466 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
934287395 2:91659803-91659825 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
934481339 2:94648635-94648657 AATGGAATACAGGCCAGGTGTGG - Intergenic
934530630 2:95085574-95085596 GATAGGGAGCAGGCCATGTTAGG - Intergenic
935227328 2:101064254-101064276 CATGGAGAAAAGGCCATGTGAGG + Intronic
935690644 2:105728296-105728318 AATGGAAAGCAGCCCGGGTGCGG - Intergenic
936853851 2:116933900-116933922 CATGGAGAGAAGACCAAGTGGGG + Intergenic
937174657 2:119917441-119917463 GATGGTATACAGGCCAGGTGCGG + Intronic
937268593 2:120632985-120633007 GCTGCAGAGAAGGCCTGGTGGGG + Intergenic
937587186 2:123567040-123567062 GAAAGAAATCAGGCCAGGTGCGG + Intergenic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
938283701 2:130088863-130088885 GATGAAAATAAGGCCAGGTGTGG - Intronic
938334345 2:130477427-130477449 GATGAAAATAAGGCCAGGTGTGG - Intronic
938355481 2:130643241-130643263 GATGAAAATAAGGCCAGGTGTGG + Intronic
938431906 2:131250030-131250052 GATGAAAATAAGGCCAGGTGTGG + Intronic
938475578 2:131608655-131608677 GATGAAAATAAGGCCAGGTGTGG + Intergenic
938938771 2:136150173-136150195 GATTGAGAGAAGGCGAGCTGCGG - Intergenic
938971190 2:136434433-136434455 GATGGAGATGGGGCCAGCTGGGG - Intergenic
939145557 2:138410503-138410525 GATGGAGAGATGGCCAGGCACGG - Intergenic
940306878 2:152236422-152236444 GCAGGACAGCTGGCCAGGTGTGG - Intergenic
941307379 2:163887771-163887793 GATGGAGGGGAAGCCAGGTTAGG + Intergenic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941869656 2:170370926-170370948 GAAAAAGAACAGGCCAGGTGCGG + Intronic
941928319 2:170917248-170917270 GCTGGAATGCAAGCCAGGTGTGG - Intergenic
942395375 2:175541503-175541525 AATCAAGATCAGGCCAGGTGCGG - Intergenic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
942711985 2:178847237-178847259 AAAGCAAAGCAGGCCAGGTGCGG + Intronic
943266491 2:185738846-185738868 GAAGGAGAGCGGGGCGGGTGAGG + Exonic
943614274 2:190074359-190074381 AATAGAGAAAAGGCCAGGTGCGG + Intronic
943669724 2:190648656-190648678 GCTGGAGAGCAGGCCGGAGGCGG + Intronic
944158532 2:196634742-196634764 AATAAAGACCAGGCCAGGTGCGG + Intergenic
944267632 2:197746609-197746631 GAAGCAGAGAGGGCCAGGTGCGG + Intronic
944488998 2:200238188-200238210 GATGGAGAGTAGGTCTGGAGAGG - Intergenic
944528015 2:200640068-200640090 GAAGGAAGGCATGCCAGGTGTGG + Intronic
944829068 2:203514130-203514152 ATTGGAGAGAGGGCCAGGTGTGG - Intronic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945089193 2:206163054-206163076 ATTGCAGTGCAGGCCAGGTGTGG + Intergenic
945107588 2:206330525-206330547 GAGGCAGAGGCGGCCAGGTGCGG + Intergenic
945275946 2:207987775-207987797 GATGGAGTGGAAGGCAGGTGAGG - Intronic
945859889 2:215108777-215108799 GAGGGGGAAAAGGCCAGGTGCGG + Intronic
948211384 2:236195804-236195826 GAGTGAGAACAGGCCAGGTGCGG - Intronic
948371678 2:237493646-237493668 GATGGACAGGAAGCCAGGTCTGG + Intronic
948582424 2:238997176-238997198 GCTGGAGCGCAGGCCTGGAGCGG - Intergenic
1170691480 20:18619713-18619735 GCAGGAGAGGAGGCCAGGTGCGG - Intronic
1170694678 20:18647659-18647681 GATGGAGAGGCAGCCAGATGTGG + Intronic
1172096035 20:32460973-32460995 GATGGAGATCGGGGCAGGTAGGG - Intronic
1172269530 20:33646332-33646354 GATGGAGAGCAGGAGGGGTCGGG - Exonic
1172272465 20:33662484-33662506 GATGGGGAGCAGGGCTGGGGAGG + Intronic
1172470809 20:35193462-35193484 GAAACAGGGCAGGCCAGGTGCGG - Intergenic
1172559513 20:35874264-35874286 AATTTATAGCAGGCCAGGTGTGG - Intronic
1172759775 20:37313936-37313958 GATGAAGAGGAGCCCATGTGAGG + Intronic
1172783671 20:37451961-37451983 GATGGGGAGCTGGGCAGGTGAGG - Intergenic
1172970272 20:38868091-38868113 GATGGAAAACAGCCCAGGGGAGG - Intronic
1173517016 20:43671758-43671780 AATGGAAATCGGGCCAGGTGTGG - Intronic
1173524016 20:43718421-43718443 GATAGAAACCAGGCCAGGTGTGG + Intergenic
1173564024 20:44026633-44026655 GCTGGAGAGCAGGAAATGTGTGG + Intronic
1173586344 20:44186311-44186333 GATGGAGGTGAGGCCAGCTGGGG - Exonic
1173736540 20:45365635-45365657 CATGGAGAGCCGGCCTGGAGGGG - Exonic
1173866603 20:46316539-46316561 GATGCAAAGAATGCCAGGTGTGG + Intergenic
1174091903 20:48055908-48055930 GATGGAGAACTGGCCAAGTGAGG - Intergenic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1174413157 20:50349163-50349185 GATGGAGATCCGGCCGGGTGTGG - Intergenic
1174489019 20:50879224-50879246 GATGGAAAGTTGGCCGGGTGAGG + Intronic
1174524527 20:51160592-51160614 GGTGGAGAGCAGGTCAAGTTTGG - Intergenic
1174879365 20:54261512-54261534 GATGGAAAACAAGCAAGGTGAGG - Intergenic
1175264614 20:57695198-57695220 AAAGGAATGCAGGCCAGGTGAGG + Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1175893709 20:62326873-62326895 CATGGAGAGCAGGCCGGATGTGG - Exonic
1176020798 20:62961482-62961504 GATCGAGGCCAGGCCAGGGGTGG + Intronic
1176103566 20:63375541-63375563 GATGGGGTGCAGGGCTGGTGGGG - Intronic
1176103753 20:63376101-63376123 GCTGGAGTGCAGGGCTGGTGGGG - Intronic
1176138784 20:63536183-63536205 AGTGGGGAGGAGGCCAGGTGAGG - Intronic
1176308375 21:5136235-5136257 GCTGTGGAGCAGGGCAGGTGCGG + Intronic
1176363349 21:6016920-6016942 GAGGGAGAGTTGGCCGGGTGTGG + Intergenic
1176608224 21:8850797-8850819 GAGGGGGAGGAGGCAAGGTGAGG - Intergenic
1177842136 21:26246425-26246447 AAGGGAAATCAGGCCAGGTGCGG + Intergenic
1178056274 21:28802435-28802457 AATGGCAAACAGGCCAGGTGTGG + Intergenic
1178451804 21:32708544-32708566 GATCGACAGCAGTTCAGGTGAGG + Intronic
1179137392 21:38692292-38692314 CAAAAAGAGCAGGCCAGGTGCGG + Intergenic
1179196873 21:39172204-39172226 AAAGGAGAGCAGGCAGGGTGGGG + Intergenic
1179476064 21:41646048-41646070 AGTATAGAGCAGGCCAGGTGCGG - Intergenic
1179480386 21:41673098-41673120 CATGGAGAGCAGGAGCGGTGGGG + Intergenic
1179530459 21:42015068-42015090 GAGGCAGAGAAGGCCAGGTGTGG - Intergenic
1179760169 21:43521625-43521647 GAGGGAGAGTTGGCCGGGTGTGG - Intergenic
1179848685 21:44125797-44125819 GCTGTGGAGCAGGGCAGGTGCGG - Intronic
1179899402 21:44381202-44381224 GAAGCAGGGGAGGCCAGGTGTGG + Intronic
1180094599 21:45550117-45550139 GATGCACAGCAGCCCAGGAGGGG - Intergenic
1180150294 21:45943832-45943854 GGTGGGGAGCACTCCAGGTGGGG + Intergenic
1180358306 22:11860602-11860624 GAGGGGGAGGAGGCAAGGTGAGG - Intergenic
1180362843 22:11914830-11914852 CATGGAGAGCAGGCAACATGTGG + Intergenic
1180379956 22:12131728-12131750 GAGGGGGAGGAGGCAAGGTGAGG + Intergenic
1180605646 22:17057109-17057131 CAAGGAGAGCATTCCAGGTGGGG - Intergenic
1180658169 22:17442271-17442293 AATGCAGATCAGGCCAGGTGTGG + Intronic
1180928506 22:19572983-19573005 GAAAGAGAAAAGGCCAGGTGCGG - Intergenic
1181042438 22:20198474-20198496 GAGGGAGACCAGGCGGGGTGGGG - Intergenic
1181067080 22:20311820-20311842 GATGGAGAACAGGGGAGGTGAGG + Intergenic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181526252 22:23490186-23490208 GTTGGATAGCTGGCCAGGTGTGG + Intergenic
1181576742 22:23800117-23800139 GTTCGAAACCAGGCCAGGTGCGG - Intronic
1181613684 22:24036967-24036989 CATGGAAACCAGGCCGGGTGCGG + Intronic
1181789586 22:25253958-25253980 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181824407 22:25502782-25502804 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181994414 22:26864130-26864152 GATCCACAGCATGCCAGGTGGGG - Intergenic
1182008673 22:26982326-26982348 AAAGGAGAGCTGGCCGGGTGCGG + Intergenic
1182183630 22:28378049-28378071 AATGCAGAGGGGGCCAGGTGAGG + Intronic
1182231906 22:28844510-28844532 GAAGAAGAACAGGCCATGTGAGG + Intergenic
1182257906 22:29051205-29051227 GATGGGGAGCAGGGCAGAGGGGG - Intronic
1182354003 22:29714013-29714035 GAAGGAGAGCAGGGGAAGTGGGG - Intergenic
1182416705 22:30225929-30225951 GCAGGGGAGAAGGCCAGGTGAGG - Intergenic
1182423663 22:30260608-30260630 AAGGAAGAGCAGGGCAGGTGGGG - Intergenic
1182728742 22:32470498-32470520 AATGTTTAGCAGGCCAGGTGCGG + Intergenic
1182943170 22:34297673-34297695 AAAGGAGAGCAGGCCAGGGGAGG - Intergenic
1183566216 22:38617025-38617047 GCTGGGGAGGAGGGCAGGTGGGG + Intronic
1183973459 22:41496019-41496041 GATGAGTTGCAGGCCAGGTGTGG + Intronic
1183987171 22:41576116-41576138 GAGGGAGGGCTGGCCAGGGGTGG + Exonic
1184206860 22:43010246-43010268 GATTGAAAATAGGCCAGGTGTGG + Intronic
1184227169 22:43135699-43135721 GATGGTGGGCAGGTCAGGTATGG - Intronic
1184315942 22:43689316-43689338 GAGGGAGAGTGGGCCACGTGAGG + Intronic
1184578846 22:45398408-45398430 GCCAGAGTGCAGGCCAGGTGCGG + Intronic
1184686393 22:46098298-46098320 GATGGTGAGGAGGCTGGGTGCGG - Intronic
1184885449 22:47342292-47342314 ACTGGGGAGCAGGGCAGGTGGGG + Intergenic
1185165811 22:49261528-49261550 AAGGGGGAGCAGGGCAGGTGCGG + Intergenic
949731008 3:7112655-7112677 GATGGAGCACAAGCCAAGTGAGG - Intronic
949988859 3:9560630-9560652 TATGGCGTACAGGCCAGGTGTGG + Intergenic
950010514 3:9719701-9719723 TATACAAAGCAGGCCAGGTGTGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950139472 3:10605383-10605405 GATGGTGAACAGGCCAGCTTTGG - Intronic
950167832 3:10815046-10815068 GATGGAGAGTAGGGTTGGTGGGG + Intergenic
950360223 3:12444730-12444752 GATGCAGATCAGGGCAGGAGGGG - Intergenic
950634947 3:14308003-14308025 GATGGAGACCAGGCCAGCACGGG - Intergenic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
951756733 3:26098897-26098919 GATGGAGGGAACCCCAGGTGGGG - Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951892303 3:27578775-27578797 AAAGAAAAGCAGGCCAGGTGCGG + Intergenic
952619262 3:35316704-35316726 GATAAGGACCAGGCCAGGTGTGG + Intergenic
952814902 3:37438699-37438721 GAAGGAAAGGAGGGCAGGTGGGG + Intergenic
952952101 3:38533462-38533484 GAGGCAGAGCAGGGCTGGTGTGG + Intronic
952967778 3:38631785-38631807 AGTGGAGTGCAGGCCAGGTTGGG - Intronic
953723751 3:45379818-45379840 GATACAGACCTGGCCAGGTGTGG - Intergenic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
954390766 3:50267039-50267061 GAGGGAGAGGAGGGCAGGAGAGG - Intergenic
954645004 3:52125884-52125906 GCTGGAGAGCAGTCCAGGGCGGG + Intronic
954669427 3:52280742-52280764 GATGGACTTTAGGCCAGGTGCGG + Intronic
954693756 3:52409836-52409858 GCTGGAGAGCGACCCAGGTGAGG - Exonic
954810820 3:53246560-53246582 CAAGGAAAACAGGCCAGGTGCGG + Intronic
954937585 3:54341015-54341037 GAGGAAGAGCAGTCTAGGTGAGG - Intronic
955322125 3:57981944-57981966 GGTGGAGAGCAGGGCTGTTGTGG - Intergenic
955382891 3:58454933-58454955 AAAGAAGAGCAGACCAGGTGTGG - Intergenic
956446877 3:69334340-69334362 AATGGTGGGGAGGCCAGGTGCGG + Intronic
957076653 3:75607873-75607895 GGTGGCGATCAGCCCAGGTGGGG + Intergenic
957450620 3:80377285-80377307 GAAGTACAGTAGGCCAGGTGTGG - Intergenic
958600559 3:96291044-96291066 AAAGGAAAACAGGCCAGGTGTGG + Intergenic
958795272 3:98700504-98700526 AAAGGAAAGAAGGCCAGGTGTGG - Intergenic
959667176 3:108935101-108935123 GAGCAAGAACAGGCCAGGTGTGG - Intronic
959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG + Intergenic
960245404 3:115394697-115394719 GATGGAGAGGGAGGCAGGTGAGG - Intergenic
961203884 3:125065826-125065848 GATGCACAGAAGGCCAGGTCTGG + Intergenic
961312322 3:126010892-126010914 GATGGACTGCTGCCCAGGTGGGG - Intronic
961717916 3:128871397-128871419 GAAGGAGAAGAGGCCAGGCGCGG + Intergenic
961739751 3:129025826-129025848 TCTGGAGAGCAGGACAGATGAGG - Intronic
961751215 3:129095896-129095918 GATGGATACCAGGCCAGGTAGGG + Intronic
961847719 3:129781670-129781692 AATGGAGAGCAGACTATGTGGGG + Intronic
961993377 3:131215783-131215805 GATGGTGTGCTGGCCAGGAGAGG + Intronic
962517092 3:136162290-136162312 GAGGGCTACCAGGCCAGGTGTGG + Intronic
964079181 3:152730539-152730561 GCTGCAGAGCTGACCAGGTGCGG + Intergenic
964846491 3:161049805-161049827 GATGGAGGGCAGGGCTGGTGAGG - Intronic
965029151 3:163341158-163341180 CATGGAGAAAAGGCCATGTGAGG + Intergenic
965546693 3:169923451-169923473 GCTGCACTGCAGGCCAGGTGTGG + Intronic
965698554 3:171436114-171436136 GATGGAGGGAAGGTCAGGAGTGG - Intronic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
966608911 3:181849069-181849091 GCTGAATATCAGGCCAGGTGTGG + Intergenic
966685318 3:182687378-182687400 GATGAAATGCAGGCCAGGTATGG + Intergenic
966780759 3:183582050-183582072 AATGGAAAGGGGGCCAGGTGTGG + Intergenic
966857373 3:184204257-184204279 AATGGGGATAAGGCCAGGTGTGG - Intronic
967261676 3:187648839-187648861 GAGGGAGAGCAAGCGAGGGGGGG + Intergenic
967344302 3:188436844-188436866 GATGGTGAGCAGGCAGAGTGGGG + Intronic
967756368 3:193174610-193174632 GATGGACAGCAGGCCAGATTTGG + Intergenic
967963286 3:194941953-194941975 GGTGGAGAGGAGGCCTGGAGGGG - Intergenic
968206809 3:196809590-196809612 GTAACAGAGCAGGCCAGGTGTGG - Intronic
968233338 3:197016913-197016935 GAAGGAGGGCTGGCCAGGAGAGG - Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968427075 4:531289-531311 TCAGGAGAGCAGGCCAGATGGGG + Intronic
968813469 4:2810281-2810303 GGAGAGGAGCAGGCCAGGTGAGG - Intronic
969020108 4:4134167-4134189 GGTGGCGATCAGCCCAGGTGGGG + Intergenic
969726122 4:8919522-8919544 GGTGGGCAGCAGGCCGGGTGTGG - Intergenic
970600815 4:17639660-17639682 GATGGAGAGCAGCCCTGCAGGGG + Intronic
971634888 4:29045715-29045737 ATTGAAGTGCAGGCCAGGTGGGG + Intergenic
971837782 4:31791244-31791266 GGTGGAGAGCAGGGCAGGGAGGG - Intergenic
972086515 4:35223747-35223769 AATGGAAAACAGGCCAGGTGTGG + Intergenic
972362904 4:38345401-38345423 CATGGAGGGCAGGACAGGGGTGG - Intergenic
972426720 4:38940179-38940201 AATGAAAGGCAGGCCAGGTGTGG - Intronic
973622395 4:52740748-52740770 AATGAGGACCAGGCCAGGTGCGG + Intronic
973653075 4:53016816-53016838 GATCAAGATCTGGCCAGGTGCGG + Intronic
973769874 4:54196681-54196703 GATGAAAAACAGGCCAGGTGCGG + Intronic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
973971551 4:56218399-56218421 GAAAGAAAGCAGACCAGGTGAGG - Intronic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
974908958 4:68092074-68092096 ATTGGAGATCTGGCCAGGTGCGG - Intronic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
975587831 4:75968739-75968761 AAAGCAGAACAGGCCAGGTGCGG + Intronic
976427442 4:84921943-84921965 AAATGAAAGCAGGCCAGGTGCGG - Intronic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977785717 4:101032304-101032326 GCTGGGGAGCATGCCAGTTGGGG + Exonic
978603332 4:110451035-110451057 AGTGGTGAGCAGGCCAGGCGTGG - Intronic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979531361 4:121772260-121772282 GATGGAGGGCTGGCCTGGAGTGG - Intergenic
979551304 4:121994064-121994086 AATAAAAAGCAGGCCAGGTGCGG - Intergenic
980496549 4:133592326-133592348 TTTGGAGAGGAGGCCAGCTGGGG + Intergenic
980622952 4:135333376-135333398 TATATAGTGCAGGCCAGGTGTGG + Intergenic
981075296 4:140585414-140585436 GCAGGAGAGCAGGCCGGGTGAGG - Intergenic
981548944 4:145923312-145923334 GATTGAATGCAGGCCAGGTGCGG + Intronic
981636618 4:146888345-146888367 GGTAAAGAGCAGACCAGGTGGGG + Intronic
982106478 4:152015909-152015931 GAGGGAAAGCAGAACAGGTGGGG - Intergenic
983216675 4:165008403-165008425 GAAGGAGAGGAAGCCTGGTGGGG - Intergenic
983630358 4:169843612-169843634 GAGGGAGGGAAGGCCAGGTGTGG - Intergenic
983921251 4:173347764-173347786 GACTATGAGCAGGCCAGGTGTGG + Intergenic
984217248 4:176929036-176929058 GAAAGATTGCAGGCCAGGTGCGG - Intergenic
984475923 4:180234898-180234920 GATGGAGAGCAACCCAGCTGTGG - Intergenic
984756135 4:183327284-183327306 GATGCAGTGAAGGCCAGGTGCGG + Intergenic
985049688 4:185976753-185976775 AATGGAAAAGAGGCCAGGTGCGG + Intergenic
1202771029 4_GL000008v2_random:207763-207785 GAGGGGGAGAAGGCAAGGTGAGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986061067 5:4191840-4191862 GAAGCAGAGGAGCCCAGGTGCGG + Intergenic
986286596 5:6363496-6363518 ACAGGAGAGCATGCCAGGTGAGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
987709788 5:21492409-21492431 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
988536333 5:32072438-32072460 GCTGGAGACCAGGCCGGGCGCGG + Intronic
988749825 5:34181754-34181776 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988878233 5:35471979-35472001 GATGGAGGAAAGGACAGGTGGGG - Intergenic
988984450 5:36603158-36603180 GCTGGAGAACAGGCCAGTAGGGG - Intergenic
989151265 5:38301947-38301969 GGAGGAGATCAGGCCAGGGGCGG + Intronic
989160725 5:38388327-38388349 AATGCAAACCAGGCCAGGTGTGG + Intronic
990805295 5:59653913-59653935 AAGGGAGGGGAGGCCAGGTGTGG + Intronic
991738084 5:69644958-69644980 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991760110 5:69911466-69911488 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
991787222 5:70206634-70206656 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991789660 5:70224684-70224706 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991814409 5:70499794-70499816 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991817544 5:70521086-70521108 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991839341 5:70786517-70786539 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
991879668 5:71207024-71207046 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991882108 5:71225053-71225075 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
992420529 5:76599990-76600012 CCTGGAGATCTGGCCAGGTGTGG + Intronic
992900151 5:81286628-81286650 AAGGTAGAGCGGGCCAGGTGTGG - Intergenic
993964379 5:94343398-94343420 GGTGAAAAGGAGGCCAGGTGTGG + Intronic
994421908 5:99533728-99533750 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
994460934 5:100066853-100066875 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
994485081 5:100380281-100380303 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
995106746 5:108383407-108383429 GTTTGAGAGCAGGCTGGGTGGGG - Intergenic
995294031 5:110497714-110497736 TGTGTAAAGCAGGCCAGGTGGGG - Intronic
995416834 5:111922156-111922178 GAAGGAGAGTAGTCCAGGGGAGG + Intronic
995576890 5:113546028-113546050 AATGGAGATCAGGCCGGGCGCGG - Intronic
995879290 5:116826084-116826106 GATGCAGATCAGGCCAGGCGCGG + Intergenic
995948478 5:117680349-117680371 AAAAGAAAGCAGGCCAGGTGCGG - Intergenic
997455245 5:134011999-134012021 GAAGCAGAGCAGGGCAGGGGTGG + Intergenic
997787712 5:136728762-136728784 GTTGGAGGCCAGGGCAGGTGTGG + Intergenic
997991269 5:138546048-138546070 AAGGAAGAGGAGGCCAGGTGTGG - Intergenic
998223489 5:140307179-140307201 AATGTACATCAGGCCAGGTGTGG + Intergenic
998330362 5:141320733-141320755 GACGGAGGGCCGGCGAGGTGCGG - Exonic
998350683 5:141498639-141498661 GAAGAAGACCTGGCCAGGTGTGG + Intronic
999045444 5:148463468-148463490 CTTGAAAAGCAGGCCAGGTGTGG - Intronic
999100836 5:149024747-149024769 GGTGGAGAGGAGGTCAGGGGTGG - Intronic
999533399 5:152488202-152488224 GATATAGAGTAGGCCAGGCGTGG + Intergenic
1000190907 5:158909646-158909668 GAAGGAGGGGAGGCCGGGTGCGG + Intronic
1000357527 5:160414894-160414916 TCTGTAGAGCAGGCCAGGGGTGG + Intronic
1000897348 5:166871883-166871905 GAGGTAAAGCTGGCCAGGTGCGG + Intergenic
1000922222 5:167151805-167151827 GAAGAAAAGCAGGCCAGGCGCGG - Intergenic
1001076108 5:168629164-168629186 GACTGAGATAAGGCCAGGTGTGG + Intergenic
1001557530 5:172646849-172646871 GAGGGGGAGCAGCACAGGTGTGG + Intronic
1001632832 5:173189006-173189028 AATGGAAATCAGGCCAGGTATGG - Intergenic
1001819644 5:174699905-174699927 GTTGGAGAGAGGGCCAGGCGCGG - Intergenic
1001838733 5:174854855-174854877 GCTGCAGAGCAGGCCAGGCATGG - Intergenic
1002206833 5:177568774-177568796 GAGGCACATCAGGCCAGGTGCGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002362925 5:178687453-178687475 GAGGGAAATCCGGCCAGGTGCGG - Intergenic
1002522571 5:179799804-179799826 CAATGAGAACAGGCCAGGTGGGG + Intronic
1002968535 6:1991358-1991380 TGTGGGGAGTAGGCCAGGTGCGG - Intronic
1003150410 6:3543187-3543209 GATGGTGTCCACGCCAGGTGTGG + Intergenic
1003201903 6:3969216-3969238 GCTTTAGAGCAGGCCGGGTGTGG + Intergenic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1004062614 6:12212763-12212785 GAAGAAAAACAGGCCAGGTGTGG + Intergenic
1004591341 6:17054747-17054769 GAGGCAGAGCATGCCATGTGGGG + Intergenic
1004626814 6:17384722-17384744 GAAGGAAGGAAGGCCAGGTGTGG + Intergenic
1004791146 6:19027750-19027772 GATGGAGCCTTGGCCAGGTGTGG - Intergenic
1004867839 6:19871306-19871328 GAAGGAAAGTTGGCCAGGTGTGG - Intergenic
1005083369 6:21979905-21979927 AATGGATATGAGGCCAGGTGCGG - Intergenic
1005282004 6:24284315-24284337 AATGTAAAGCAGGCCAGGCGTGG + Intronic
1005547891 6:26888097-26888119 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
1006073285 6:31512355-31512377 AAAAGAGAACAGGCCAGGTGCGG - Intergenic
1006149687 6:31980232-31980254 GAGGGAGGGCAGTCCAGGTAGGG + Intronic
1006169331 6:32084142-32084164 GCTGGAGAACAGGGCATGTGGGG - Intronic
1006789895 6:36693103-36693125 GGTGGGGAGCAGGGCCGGTGAGG + Intergenic
1006842639 6:37039654-37039676 GATGCTGAGCAGGCCGGGCGTGG + Intergenic
1007031314 6:38629915-38629937 AAAGGAGACCAGGCCAGGCGTGG + Intronic
1007166876 6:39834799-39834821 GATGGAGGGCAGGGCAGGGAAGG + Intronic
1007221935 6:40285672-40285694 AAAGGAGAGAAAGCCAGGTGAGG - Intergenic
1007781047 6:44254940-44254962 GATGAAGAGCTGGCCACATGCGG + Exonic
1007812024 6:44493157-44493179 GAGGGTGAGAAGGCCAGATGTGG - Intergenic
1008488209 6:52057703-52057725 GATTAAAAGCTGGCCAGGTGTGG - Intronic
1008877397 6:56344673-56344695 GTTGGAGGACAGGCCTGGTGGGG + Intronic
1008933528 6:56964784-56964806 GACTGAGAAGAGGCCAGGTGAGG - Intronic
1009018652 6:57929178-57929200 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
1009421970 6:63473543-63473565 GTGGGAGAGCAGGACTGGTGTGG - Intergenic
1010401950 6:75456004-75456026 GATGGAGAGCATTTTAGGTGAGG - Intronic
1011130962 6:84051565-84051587 GAAGGAAAAGAGGCCAGGTGTGG + Intronic
1011492918 6:87911078-87911100 GATGGAATGCATGCCAGATGTGG - Intergenic
1013247291 6:108298914-108298936 GAAGGAGAGCAGGGCAGCTGAGG + Intronic
1013389023 6:109664742-109664764 AAAGAAGATCAGGCCAGGTGCGG + Intronic
1013702228 6:112786358-112786380 TAGGGAGCTCAGGCCAGGTGCGG - Intergenic
1014780834 6:125562756-125562778 GATGTATACCAGGCCAGATGGGG + Intergenic
1014844599 6:126259485-126259507 AATGTGGTGCAGGCCAGGTGCGG - Intergenic
1015128233 6:129778367-129778389 AATGTACAGCAAGCCAGGTGTGG + Intergenic
1015422804 6:133030359-133030381 GGTGCAGAACAGGCCAGGTGCGG - Intergenic
1015500130 6:133923007-133923029 GATGTTGAGCCGGCCAGGCGCGG - Intergenic
1015988596 6:138911838-138911860 GAGGGAGAGGAGGACAGGCGAGG + Intronic
1016146188 6:140676888-140676910 AAAGTACAGCAGGCCAGGTGCGG - Intergenic
1016373163 6:143394799-143394821 GGTGGAAGGCAGGACAGGTGAGG + Intergenic
1017772087 6:157651362-157651384 GAGGAAGAGAATGCCAGGTGAGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1017962633 6:159234366-159234388 GGTGGAGAAGTGGCCAGGTGGGG - Exonic
1018638854 6:165888572-165888594 GAAAAAAAGCAGGCCAGGTGCGG - Intronic
1018778532 6:167042105-167042127 GATGTAGTACTGGCCAGGTGCGG - Exonic
1018948516 6:168363736-168363758 GCTGGAGATGAAGCCAGGTGTGG + Intergenic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019354033 7:569746-569768 GGTGGACAGCAGGCAGGGTGAGG + Intronic
1019375069 7:686008-686030 AATGGAGAATCGGCCAGGTGTGG + Intronic
1019517662 7:1446922-1446944 GATGGAGAACTGGCCAGGAGAGG + Intronic
1019677797 7:2325535-2325557 GAGGAATATCAGGCCAGGTGGGG + Intronic
1019801790 7:3093170-3093192 ATAGGAGATCAGGCCAGGTGCGG - Intergenic
1019979536 7:4611127-4611149 AATTAACAGCAGGCCAGGTGTGG + Intergenic
1020046202 7:5042477-5042499 AATGCATAGCAGGCCAGGTGCGG + Intronic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020088505 7:5324301-5324323 GATGGAGAGCATGGCAGCCGAGG - Exonic
1020139392 7:5604288-5604310 GAAGGAGAGCAGGGAAGGGGAGG + Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1020803651 7:12761790-12761812 GACTGAGAACAGGCCGGGTGCGG - Intergenic
1021292380 7:18862597-18862619 GATGGAGAGGGGGAAAGGTGAGG - Intronic
1021333297 7:19366479-19366501 GAAGGAGAGCAGATCAGGAGAGG + Intergenic
1021860478 7:24901037-24901059 GAGAGAGAGATGGCCAGGTGTGG + Intronic
1022085376 7:27062474-27062496 AATGCAATGCAGGCCAGGTGTGG + Intergenic
1022734702 7:33064826-33064848 GAAAGAAATCAGGCCAGGTGAGG + Intergenic
1023533558 7:41183734-41183756 AAAGCAGAGCTGGCCAGGTGTGG - Intergenic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1023855939 7:44184052-44184074 GATGAAGAGCAGGAGAGGAGAGG + Intronic
1024234396 7:47386956-47386978 CATGGAGGGCAGGGCATGTGAGG - Intronic
1024619513 7:51145667-51145689 GAGGAATAACAGGCCAGGTGTGG - Intronic
1025063882 7:55836029-55836051 TATGGTAACCAGGCCAGGTGTGG - Intronic
1025205804 7:56992813-56992835 GATGGAGAGCATGGCAGCCGAGG + Intergenic
1025666136 7:63584125-63584147 GATGGAGAGCATGGCAGCCGAGG - Intergenic
1025928112 7:65975117-65975139 GCTGGAGGGCAGGCCGGATGGGG - Intronic
1026220441 7:68391977-68391999 GAAAGAGAAAAGGCCAGGTGTGG + Intergenic
1026405744 7:70063773-70063795 GCTGGAGAGCAGGTGAAGTGTGG - Intronic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026491832 7:70870145-70870167 AATGTAGTACAGGCCAGGTGTGG - Intergenic
1026552688 7:71381486-71381508 CCTGCAGAGCAGGCCAGGTGCGG + Intronic
1026636076 7:72082909-72082931 GCAAGAAAGCAGGCCAGGTGTGG + Intronic
1026683351 7:72487393-72487415 AATAGAGAGGTGGCCAGGTGCGG + Intergenic
1026896579 7:74013173-74013195 GACGGGGACCAGGCCAGGTCAGG + Intergenic
1027117071 7:75489676-75489698 AATGTATAGCAGGCCAGGCGCGG - Intergenic
1027179240 7:75926503-75926525 TATTGAGTGCTGGCCAGGTGTGG + Intronic
1027274738 7:76545928-76545950 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1027353838 7:77337858-77337880 AATCAAGGGCAGGCCAGGTGTGG + Intronic
1027648907 7:80840227-80840249 GATGGTAAAAAGGCCAGGTGTGG + Intronic
1028554905 7:92112537-92112559 GAAGCAGGGAAGGCCAGGTGCGG + Exonic
1028557689 7:92140942-92140964 ATTGGAAAGTAGGCCAGGTGCGG - Intronic
1029016381 7:97319008-97319030 GGTGGAGAACTGGCCAGATGCGG - Intergenic
1029067980 7:97871819-97871841 GAGGGTGAGCGGTCCAGGTGAGG + Exonic
1029078636 7:97955141-97955163 GGTGGCGATCAGCCCAGGTGGGG + Intergenic
1029222978 7:99004895-99004917 GAGGGAGAGCTGGCCAGGACAGG - Intronic
1029435344 7:100561107-100561129 AAGGGAGATCTGGCCAGGTGTGG - Intronic
1029497725 7:100906093-100906115 AATAGAAAGTAGGCCAGGTGCGG - Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1029720432 7:102360386-102360408 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1030192345 7:106822176-106822198 GATGGAGAAATGGCCAGATGTGG + Intergenic
1030950434 7:115784755-115784777 GATGTAGTTCAGGCCAGATGTGG + Intergenic
1031414169 7:121476046-121476068 GCTGGGAAGCATGCCAGGTGTGG + Intergenic
1031712873 7:125071224-125071246 GATAGAGAGCATTCCAGGTCTGG - Intergenic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032328435 7:130954445-130954467 GAGTGAGAGTGGGCCAGGTGTGG + Intergenic
1032419663 7:131767920-131767942 GATGCAGAGAAGGCCAAGGGTGG - Intergenic
1035344203 7:158187983-158188005 AATGGAGAGCAGGCAAGATGGGG + Intronic
1035856535 8:2982063-2982085 TATGGGTAACAGGCCAGGTGCGG + Intronic
1035902088 8:3467704-3467726 GAGAGAGAGCAGCCAAGGTGTGG + Intronic
1035923378 8:3702538-3702560 AATAGAGTGCTGGCCAGGTGCGG + Intronic
1036119190 8:5996975-5996997 GATGAAGAGCTGGCCAGTGGGGG - Intergenic
1036177247 8:6550504-6550526 AATGGTGAGCAGGCCAGTTTTGG - Intronic
1036475110 8:9086121-9086143 CAGGGATAGCGGGCCAGGTGTGG + Intronic
1036523853 8:9517181-9517203 TATAGTAAGCAGGCCAGGTGCGG - Intergenic
1036548105 8:9791637-9791659 GGTTGAGACCTGGCCAGGTGCGG + Intergenic
1037101222 8:15049545-15049567 GATTTAGAGAAGGCCAGGAGTGG + Intronic
1037138033 8:15486731-15486753 GTGGGAGAGGAGGCCAGGCGCGG - Intronic
1037775821 8:21834985-21835007 GATGGAGAGGAAGTCAGGTTGGG - Intergenic
1037800204 8:22029432-22029454 GATGAGAATCAGGCCAGGTGCGG - Intronic
1037943685 8:22973522-22973544 GGGGGAGAGCAGACCAGGTGTGG - Intronic
1038290595 8:26246557-26246579 AATGAAGAGCTGGCCAGGTGTGG + Intergenic
1038549034 8:28449611-28449633 CAAGAAGATCAGGCCAGGTGTGG - Intronic
1039697188 8:39925591-39925613 GTGGCAGAGCTGGCCAGGTGCGG + Intronic
1040762757 8:50870456-50870478 GATGGCTAGAAGGCCAGGAGAGG - Intergenic
1040942100 8:52844345-52844367 GATGGCGAGGAGGCCAGGCACGG + Intergenic
1040982884 8:53263613-53263635 CATGGAGATAAGGCCATGTGAGG - Intergenic
1041202015 8:55458844-55458866 GATGGGGAGCAGGGCAGGCCAGG + Intronic
1042986475 8:74589351-74589373 ATTGTAGACCAGGCCAGGTGTGG - Intergenic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043504085 8:80885818-80885840 GTTGGGGAGCAGGCTTGGTGGGG + Intergenic
1043960542 8:86413114-86413136 GATGGAGAGCTGGCCAGGCATGG - Intronic
1044584241 8:93854492-93854514 GATGGTGAGCAAGACAGATGTGG + Intergenic
1044876069 8:96667637-96667659 AAAGGAGATAAGGCCAGGTGCGG - Intronic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045400345 8:101809833-101809855 AAAAGAGAGCAGGCCAAGTGCGG - Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045553025 8:103189650-103189672 GAGGAAGAGCATTCCAGGTGGGG + Intronic
1045867300 8:106882506-106882528 AAAGGAGACCAGGCCGGGTGCGG - Intergenic
1045891681 8:107165214-107165236 GATGGAGGATGGGCCAGGTGCGG - Intergenic
1047250349 8:123177523-123177545 GTCGGAGCCCAGGCCAGGTGAGG - Intergenic
1047252208 8:123189269-123189291 GATGGATAGCTGGACAGGGGAGG - Intronic
1047508444 8:125497855-125497877 GATGGAGAGTCAGCAAGGTGGGG + Intergenic
1047527106 8:125643064-125643086 GATCTAGAGCAGGCCAGCTCAGG - Intergenic
1047725076 8:127677181-127677203 AAAACAGAGCAGGCCAGGTGCGG - Intergenic
1047768050 8:128005401-128005423 GATGGAGACTGGGCCAGGTGGGG + Intergenic
1047972486 8:130097310-130097332 CCTGGAGAACAGGGCAGGTGAGG - Intronic
1048037318 8:130689500-130689522 CATGGAGAGGAGACCAGGAGAGG - Intergenic
1049024426 8:139979064-139979086 GGTTGACAGCAGGCCAGGTGCGG + Intronic
1049286491 8:141778189-141778211 GGTGGAGAGCAGGCCTGGCATGG + Intergenic
1049487483 8:142874125-142874147 GCTGGAGAAAGGGCCAGGTGGGG + Exonic
1049698306 8:143994361-143994383 GCAGGCGAGGAGGCCAGGTGAGG - Intronic
1049794756 8:144492047-144492069 GCTGGAGGGCAGGCAATGTGGGG + Intronic
1050028134 9:1356912-1356934 GGTGGGGAGCAGGACAGATGGGG - Intergenic
1050529698 9:6577780-6577802 GATGGGGAGCAGGAGAGGAGGGG - Intronic
1050841291 9:10152533-10152555 GAAGGAAATCAGGCCAGGTGTGG + Intronic
1051076002 9:13237150-13237172 AATGGTAAGCAGGCCAGGAGCGG + Intronic
1051135644 9:13917057-13917079 TCTGTTGAGCAGGCCAGGTGTGG - Intergenic
1051291312 9:15548516-15548538 GAAGGAAATTAGGCCAGGTGTGG - Intergenic
1051398977 9:16659105-16659127 GATGGATAGATGGACAGGTGTGG + Intronic
1051840872 9:21396431-21396453 GGAGGAGAGCAGAGCAGGTGAGG - Intergenic
1052300646 9:26948751-26948773 AATGGAAAGCCGGCCAGGCGTGG - Intronic
1052336761 9:27328205-27328227 GAAGGAGAGTAGGACAGGTTAGG + Exonic
1052877355 9:33576812-33576834 CATGGAGAGCAGGCAACATGTGG + Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053432576 9:38052795-38052817 GATGGAGGAGAAGCCAGGTGTGG - Intronic
1053479267 9:38403849-38403871 GGTTAAGAACAGGCCAGGTGCGG - Intergenic
1053498648 9:38567581-38567603 CATGGAGAGCAGGCAACATGTGG - Intronic
1053569021 9:39284859-39284881 AATGGAGTTCAGGCCAGGCGCGG - Intronic
1053676499 9:40435473-40435495 AATGGAATACAGGCCAGGTGTGG + Intergenic
1053926270 9:43061583-43061605 AATGGAATACAGGCCAGGTGTGG + Intergenic
1054128123 9:61334148-61334170 AATGGAGTTCAGGCCAGGCGCGG + Intergenic
1054287220 9:63189421-63189443 AATGGAATACAGGCCAGGTGTGG - Intergenic
1054289568 9:63270996-63271018 AATGGAATACAGGCCAGGTGTGG + Intergenic
1054387597 9:64575542-64575564 AATGGAATACAGGCCAGGTGTGG + Intergenic
1054392201 9:64625938-64625960 AAGGCAGACCAGGCCAGGTGCGG + Intergenic
1054508122 9:65940821-65940843 AATGGAATACAGGCCAGGTGTGG - Intergenic
1054780346 9:69160452-69160474 GAAGGAAAGCAAGCAAGGTGTGG - Intronic
1056168554 9:83960909-83960931 AATGGAGGGTCGGCCAGGTGTGG + Intergenic
1056327506 9:85492165-85492187 AATTGAGAACAGGCCAGGCGTGG + Intergenic
1057117488 9:92539642-92539664 GATGGAGAGGATGCTAAGTGAGG + Intronic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057261085 9:93585123-93585145 CACGGAGAGCATGCCAGGGGTGG - Intronic
1057348678 9:94276065-94276087 AAGAGAGTGCAGGCCAGGTGTGG - Intronic
1057884507 9:98819725-98819747 GTAGGAGGGAAGGCCAGGTGGGG + Intronic
1058070993 9:100600610-100600632 GGTGGAGGGGAGTCCAGGTGAGG - Intergenic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1058919559 9:109600130-109600152 GATGGAGAGCGAGGCAGGAGGGG - Intergenic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059310559 9:113386098-113386120 GATTGAGATAAGGACAGGTGTGG - Intergenic
1059939495 9:119344055-119344077 GATGGAGAGAAGCTCAGGGGAGG + Intronic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1060389520 9:123267333-123267355 GATGGAGAGCAGGAGGTGTGTGG - Intronic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1060725383 9:126002673-126002695 CATGGGGAGGAGGCCAGGGGAGG + Intergenic
1060798145 9:126526526-126526548 GATGGAGAGCAGGCCAGAGCCGG + Intergenic
1061092171 9:128432855-128432877 GCAGGAGGCCAGGCCAGGTGCGG + Intronic
1061432958 9:130542949-130542971 GAGAGAGAGCAGGGCAGGGGAGG + Intergenic
1061537157 9:131257389-131257411 AATGGAGATGTGGCCAGGTGTGG - Intergenic
1061632044 9:131878469-131878491 GATGGAGAGCTGGACATCTGCGG + Intronic
1061708337 9:132470127-132470149 CATGGAGCAAAGGCCAGGTGTGG - Intronic
1061741195 9:132707777-132707799 GAGGGTGCTCAGGCCAGGTGCGG + Intergenic
1061772531 9:132937151-132937173 GCAGGAGCCCAGGCCAGGTGTGG + Intronic
1061812572 9:133171013-133171035 GATGGGGGACAGGCCAGGTGTGG + Intergenic
1061885089 9:133587405-133587427 GGTGGGGACCAGGCCAGGGGGGG - Intergenic
1062051601 9:134450166-134450188 GATGGGCAGCAGGCAAGGAGGGG - Intergenic
1062390381 9:136331415-136331437 GCTGGGGAGGGGGCCAGGTGGGG + Intronic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203703625 Un_KI270742v1:16011-16033 GAGGGGGAGGAGGCAAGGTGAGG - Intergenic
1203547210 Un_KI270743v1:137781-137803 CATGGAGAGCAGGCAACATGTGG - Intergenic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1186977057 X:14918929-14918951 AATGGTAAGCAGGCCAAGTGTGG + Intronic
1187482463 X:19670371-19670393 CATGCAGAGCAAGCCAGCTGTGG - Intronic
1187507376 X:19888073-19888095 GATGGAGACCAGGGCAGGCCCGG + Intergenic
1187819954 X:23276785-23276807 AATGGAGACAAGGCCAGATGTGG + Intergenic
1188414249 X:29913149-29913171 TTCTGAGAGCAGGCCAGGTGAGG - Intronic
1189105361 X:38230084-38230106 GAAGTAGCCCAGGCCAGGTGCGG + Intronic
1189129364 X:38482153-38482175 TATGAAGAGCATTCCAGGTGAGG + Intronic
1189155525 X:38752565-38752587 GATGGAGAGCAGGCTTTGAGTGG + Intergenic
1190063321 X:47224347-47224369 GGGGTAGGGCAGGCCAGGTGGGG - Intronic
1190098900 X:47505087-47505109 AATGGAATGCAGGCCGGGTGTGG + Intergenic
1190281747 X:48935646-48935668 GAGGGATAACAGGCCAGGCGTGG + Intronic
1190640966 X:52482505-52482527 GCTGCACATCAGGCCAGGTGGGG - Intergenic
1190646706 X:52530360-52530382 GCTGCACATCAGGCCAGGTGGGG + Intergenic
1190833160 X:54077399-54077421 AATGGGGAACAGGCCAGGTGTGG + Intronic
1191841225 X:65514748-65514770 GAGGGAGAGAAGACAAGGTGAGG - Intronic
1192567454 X:72177128-72177150 GCTGTGGAGCAGGTCAGGTGGGG + Intergenic
1192621768 X:72683145-72683167 AGTGGAAAACAGGCCAGGTGTGG + Intronic
1193379563 X:80802813-80802835 AATGTCAAGCAGGCCAGGTGCGG + Intronic
1193832351 X:86304723-86304745 GATGGAGAGAAAGTCAGATGGGG + Intronic
1195094605 X:101492136-101492158 GCTGGGGAGCAGGCCAGTGGAGG + Exonic
1197427792 X:126319757-126319779 TAAGGAGGGCTGGCCAGGTGTGG + Intergenic
1198086550 X:133287703-133287725 ATTGGAGAGGAGGCCATGTGGGG + Intergenic
1199606685 X:149584389-149584411 ATTGGAGAGCAGTCCAGGTGAGG - Intronic
1199632438 X:149784979-149785001 ATTGGAGAGCAGTCCAGGTGAGG + Intronic
1200097399 X:153670606-153670628 GAGGGAGATCAGGCCAGGCCTGG + Intronic
1200206243 X:154318407-154318429 GTTCGAGACCAGGCCGGGTGCGG + Intronic
1200214057 X:154359649-154359671 GGAGGAGTGCAGGCCAGGTCAGG + Intronic
1200282346 X:154787760-154787782 AAGGGAAAGCTGGCCAGGTGTGG - Intronic
1202378137 Y:24256333-24256355 CATGAGGAGCCGGCCAGGTGTGG - Intergenic
1202492645 Y:25413788-25413810 CATGAGGAGCCGGCCAGGTGTGG + Intergenic