ID: 1002282112

View in Genome Browser
Species Human (GRCh38)
Location 5:178137196-178137218
Sequence GCCTGTCCTCGGGTGTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1105
Summary {0: 1, 1: 0, 2: 1, 3: 67, 4: 1036}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002282106_1002282112 13 Left 1002282106 5:178137160-178137182 CCAGGGCACGCAGCTATGAGACA 0: 1
1: 0
2: 2
3: 3
4: 79
Right 1002282112 5:178137196-178137218 GCCTGTCCTCGGGTGTGCGGCGG 0: 1
1: 0
2: 1
3: 67
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002282112 Original CRISPR GCCTGTCCTCGGGTGTGCGG CGG Intronic