ID: 1002283414

View in Genome Browser
Species Human (GRCh38)
Location 5:178146605-178146627
Sequence ACATTAGGTCATGAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002283414_1002283418 0 Left 1002283414 5:178146605-178146627 CCGCCTTCCTCATGACCTAATGT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1002283418 5:178146628-178146650 CTTAAACACCACTTGCCTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 130
1002283414_1002283422 14 Left 1002283414 5:178146605-178146627 CCGCCTTCCTCATGACCTAATGT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1002283422 5:178146642-178146664 GCCTTCAGGGGAGATGTGAGTGG 0: 1
1: 0
2: 2
3: 21
4: 243
1002283414_1002283420 2 Left 1002283414 5:178146605-178146627 CCGCCTTCCTCATGACCTAATGT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1002283420 5:178146630-178146652 TAAACACCACTTGCCTTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1002283414_1002283419 1 Left 1002283414 5:178146605-178146627 CCGCCTTCCTCATGACCTAATGT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1002283419 5:178146629-178146651 TTAAACACCACTTGCCTTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002283414 Original CRISPR ACATTAGGTCATGAGGAAGG CGG (reversed) Intronic
900477195 1:2881567-2881589 ACACTGGGGCATGAGGTAGGTGG + Intergenic
901270228 1:7947150-7947172 ACATTAGGTCATGAAGAGACAGG - Intergenic
902045600 1:13521675-13521697 AGAGGAGATCATGAGGAAGGAGG - Intergenic
902136477 1:14310410-14310432 AGAATGGGTCATTAGGAAGGTGG - Intergenic
903401147 1:23050412-23050434 TCATCCGGTCATGAGGAAGTCGG - Exonic
907976322 1:59434752-59434774 TGATTAGGTCATGAAGAAGTAGG - Intronic
908357530 1:63337247-63337269 TGATTAGGTCATGAGGATAGAGG + Intergenic
909519719 1:76553298-76553320 ACAGTGGGAGATGAGGAAGGTGG + Intronic
909842021 1:80338920-80338942 ATATTAGGTTATGAGGAATGAGG - Intergenic
910740016 1:90504801-90504823 ACATAAAGTCCTGAGGTAGGGGG + Intergenic
911425591 1:97707132-97707154 TCATTAGGTCATGACTTAGGAGG + Intronic
912043939 1:105429945-105429967 ACACTAGGTGATAAGGATGGAGG + Intergenic
914259247 1:145985121-145985143 AAATTAGGTCACCTGGAAGGTGG - Intergenic
916277001 1:163005519-163005541 TCATTAAGTAATGAGAAAGGAGG - Intergenic
917265899 1:173220596-173220618 TAATTAGGTCATGAGGGTGGGGG + Intergenic
917273507 1:173304794-173304816 ACACTAGGTTATGAGGCAAGTGG - Intergenic
917734180 1:177905385-177905407 ACATGTGGTCATGATAAAGGAGG + Intergenic
918455750 1:184711793-184711815 ACAATGGGTCATTAGGAAAGAGG + Exonic
920307834 1:205030402-205030424 GCATTAGCTCATGTGGAAGGTGG - Intergenic
920804762 1:209222508-209222530 AAATTAAGTTATGAGGAAGAGGG - Intergenic
920943312 1:210504652-210504674 CCATCAGATCATCAGGAAGGAGG - Intronic
920988605 1:210914425-210914447 AAATAAGGTCATGAAGGAGGCGG + Intronic
923203960 1:231739978-231740000 TGATTAGGTCATGAGGGTGGAGG + Intronic
924859905 1:247910391-247910413 ACAGTAGGTGATGAGGAAAGAGG + Intergenic
1063122340 10:3113789-3113811 ACATTAGGTGAGAAGGAAGGTGG + Intronic
1066534030 10:36370784-36370806 ACACTTGGTAATGATGAAGGTGG + Intergenic
1070600896 10:77865614-77865636 AAATTAGGTCAGGATGAATGGGG + Intronic
1071237489 10:83666184-83666206 AGATGAGGTCATGAGGGTGGGGG + Intergenic
1072307856 10:94124519-94124541 AGAGTAGGTTATGAGGAAGAGGG + Intronic
1073496608 10:103897323-103897345 AGATTAGGTAAGGAGGAAGAAGG + Intronic
1074219513 10:111422488-111422510 CCATTATATCATGAGGCAGGGGG + Intergenic
1079082627 11:17424559-17424581 ACATGAGGGCATGAGGGTGGGGG + Intronic
1079450154 11:20593898-20593920 ACATGATGACCTGAGGAAGGAGG + Intergenic
1087810509 11:102605079-102605101 TCATGAGGTCATGAGGGTGGGGG + Intronic
1087987423 11:104701070-104701092 ACAGTGGGTCAAGATGAAGGAGG + Intergenic
1089701884 11:120249701-120249723 ACAGAGGGTCAGGAGGAAGGAGG + Intronic
1092229638 12:6769392-6769414 ACCTTGGGTCTTGGGGAAGGAGG + Intronic
1092647206 12:10588462-10588484 ACTTTAAGTCATGAGGAATATGG - Intergenic
1094768237 12:33622381-33622403 AAAGTAGGTAATGAGGTAGGAGG - Intergenic
1097588566 12:61545235-61545257 GCAGAAGGTGATGAGGAAGGTGG + Intergenic
1099000433 12:77172610-77172632 ACATTTAGTCATGTGGATGGAGG + Intergenic
1100033831 12:90226321-90226343 ACAATAGGTCATCAGCAAGCTGG + Intergenic
1101546613 12:105719363-105719385 TGATTAGGTCATGAGGATGGTGG - Intergenic
1102011228 12:109619792-109619814 AGATGAGGCCATGAGGAAGATGG + Intergenic
1102539962 12:113611349-113611371 TCATTAGGTTATTAGGAAGGAGG - Intergenic
1103646656 12:122398918-122398940 ATATCTGGTCAGGAGGAAGGGGG - Intronic
1104235075 12:126926636-126926658 GCTTTATGACATGAGGAAGGAGG - Intergenic
1107094356 13:36518686-36518708 TGATTAGGTCATGAGGGTGGAGG - Intergenic
1107736885 13:43408123-43408145 ACATTTGGTGATGATGAAAGGGG + Intronic
1108285274 13:48900752-48900774 ACATGAGGTGATGAAGAAGTGGG + Intergenic
1108311541 13:49196588-49196610 ACATTAGGGAATGAGGTCGGTGG - Intronic
1110285751 13:73748433-73748455 AGATCAGGTCATGAGGGTGGTGG + Intronic
1111743080 13:92229137-92229159 ACATTAGGCTCTGAGGAAAGGGG + Intronic
1112045180 13:95589502-95589524 AGATGAGGTCATGTGGATGGGGG + Intronic
1112610392 13:100949447-100949469 ACATTTTGGCAAGAGGAAGGTGG + Intergenic
1113338050 13:109395548-109395570 TGATTAGGTCATGAGGGAGGAGG + Intergenic
1113338067 13:109395692-109395714 TGATTAGGCCATGAGGGAGGAGG + Intergenic
1113551955 13:111199563-111199585 TCATTTGGACATGAGGAAGATGG - Intronic
1114184806 14:20392506-20392528 AGATGACATCATGAGGAAGGAGG + Intronic
1115522437 14:34246358-34246380 ACAGTAGGTCATCAGGAATGTGG - Intronic
1117825046 14:59693038-59693060 ATATTAGGTCATGAAAATGGAGG + Intronic
1118839947 14:69502510-69502532 ACATTAGTGCAGGTGGAAGGTGG + Intronic
1119632315 14:76243770-76243792 AAATGATGTCATGGGGAAGGTGG - Intronic
1121519160 14:94574030-94574052 TCAGGAGGTCATGAGGAGGGGGG + Intronic
1124499104 15:30211123-30211145 AAATAAGGTCATGTGGGAGGTGG - Intergenic
1124744473 15:32327550-32327572 AAATAAGGTCATGTGGGAGGTGG + Intergenic
1125788680 15:42345776-42345798 ACATTTGCTCATTGGGAAGGAGG + Exonic
1126074985 15:44900500-44900522 ATATTAGGTTAGGATGAAGGTGG - Intergenic
1126083379 15:44987316-44987338 ATATTAGGTTAGGATGAAGGTGG + Intergenic
1128719220 15:69933948-69933970 ACATCATGTCATCAAGAAGGTGG + Intergenic
1128896199 15:71376324-71376346 AAACTAGGGCATAAGGAAGGAGG - Intronic
1129208479 15:74051741-74051763 ACCTAGGGTCATGAAGAAGGTGG + Intergenic
1131125079 15:89853085-89853107 TCATAAGGTTTTGAGGAAGGTGG + Intronic
1131345183 15:91640231-91640253 TGATTAGGTCATGAAGATGGAGG - Intergenic
1131560211 15:93433129-93433151 TGATTAGGTCATGAGGGTGGAGG - Intergenic
1132087809 15:98922460-98922482 CCACTAGGTTGTGAGGAAGGTGG - Intronic
1137584347 16:49655301-49655323 ACACTAGCTCATGAGTAAGTGGG + Intronic
1137737226 16:50733884-50733906 ACAGCAGATCAGGAGGAAGGTGG + Intergenic
1138307599 16:55991905-55991927 TAATTAGGTCATGAGAGAGGAGG + Intergenic
1141867712 16:86762177-86762199 AAAGTAGGTCATGAAGAAGCAGG + Intergenic
1141877945 16:86839021-86839043 ACATCCGGGCAGGAGGAAGGAGG + Intergenic
1143198683 17:5097333-5097355 ACATAAGGGAAGGAGGAAGGTGG + Intergenic
1143395218 17:6589196-6589218 AGATGAGGTCATGAGGGTGGAGG + Intronic
1143775234 17:9195055-9195077 AAATGAGGGAATGAGGAAGGTGG - Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1149381725 17:56101008-56101030 AGATTAGGTCATGAGAGTGGAGG + Intergenic
1149835941 17:59912509-59912531 ACAGCAGGTCAAGAGGAGGGTGG - Intronic
1153285964 18:3453918-3453940 ACAATAGGAAATGAGTAAGGAGG + Intronic
1153917533 18:9759094-9759116 ACGTTCAGACATGAGGAAGGTGG + Intronic
1157137892 18:45075231-45075253 AGATTAGGTCATAAGGTTGGAGG - Intergenic
1158493327 18:57929979-57930001 ACCTTAGTTCTTGTGGAAGGAGG + Intergenic
1159203875 18:65225143-65225165 AGGTTAGATCATGAGGAAGGAGG + Intergenic
1160213767 18:76907873-76907895 ACAGTAGGTGATGAGGCTGGAGG + Intronic
1160257623 18:77260465-77260487 TAATTAGGTCATGAGGTGGGGGG - Intronic
1160996170 19:1883026-1883048 ACATCAGGTCCTGAGGGAGCAGG - Intronic
1163066595 19:14801183-14801205 ATATTAGGTAATGAGGAATGAGG - Intronic
1163776888 19:19224226-19224248 AGACTAGCTCATGGGGAAGGAGG + Intronic
1165319502 19:35076656-35076678 ACCTCAGGTCCTGAGGAAGGTGG - Intergenic
1166702176 19:44888581-44888603 ACCTTATCTCATGAGGCAGGAGG + Exonic
928985460 2:37176918-37176940 CCTTTAGGTCATGAAAAAGGAGG - Intronic
930524385 2:52508654-52508676 AAATTATGTCATAATGAAGGAGG + Intergenic
931979253 2:67677011-67677033 ACATTGGGTGGTGAGGAAAGAGG - Intergenic
932206380 2:69887059-69887081 TGAATAGGTCATGAGGATGGGGG - Intergenic
933384887 2:81597467-81597489 TCCTGAGGTCAGGAGGAAGGGGG + Intergenic
936921729 2:117696069-117696091 AGATTAGGTCCCCAGGAAGGAGG + Intergenic
941724961 2:168850815-168850837 ACCTAAGTTTATGAGGAAGGGGG - Exonic
941875991 2:170433904-170433926 ACATTAGGTCATGTCCAAGTGGG + Intronic
942608449 2:177716289-177716311 AAATTAGGTGATGTGGAATGAGG - Intronic
942819083 2:180089740-180089762 ACATTAGGTAAGAAGGAATGGGG + Intergenic
944412369 2:199457472-199457494 ACATTAGGACCTGGGGAAGAGGG - Exonic
944535072 2:200700917-200700939 ACCTTAGTTCATGGGGAAGCAGG + Intergenic
947569522 2:231221385-231221407 ACATGAGGTCATTGGGAATGGGG - Intronic
948515310 2:238499847-238499869 TCATTAGGGGATGAGCAAGGCGG + Intergenic
1170349551 20:15424077-15424099 TGATTAGGTCATGAGGGTGGAGG - Intronic
1170555197 20:17509170-17509192 AGATGAGGTCATGAGGATGGGGG + Intronic
1170663253 20:18363073-18363095 GCACGAGGACATGAGGAAGGAGG + Intergenic
1170940197 20:20842326-20842348 ACATTAATTCCTGAAGAAGGAGG - Intergenic
1172012902 20:31856788-31856810 ACAGTGGGACATGAGGAAGTAGG + Intronic
1172345440 20:34194897-34194919 AAATAAGGAGATGAGGAAGGAGG - Intronic
1174603199 20:51741230-51741252 ACATCAGTTCAAGAGTAAGGTGG - Intronic
1177566571 21:22830791-22830813 ACCCCAGGTCCTGAGGAAGGTGG - Intergenic
1178221182 21:30661990-30662012 ACATTATGTAAGGAGGAAAGGGG - Intergenic
1178331179 21:31693469-31693491 ACATTAGGTCACCAAAAAGGAGG - Exonic
1178369902 21:32018717-32018739 AAATTTGGTCATGAGAATGGAGG - Intronic
1180712128 22:17846557-17846579 CCATTAGTTGATGAGGGAGGAGG - Intronic
1181811659 22:25406865-25406887 CCATGAGGTCAGGCGGAAGGGGG - Intergenic
1182353831 22:29713306-29713328 CCATCAGGTCAGGAGGAAGAGGG - Intergenic
1184762864 22:46554797-46554819 CCATGAGGTCACCAGGAAGGGGG + Intergenic
1185004552 22:48268057-48268079 ACACCCGGCCATGAGGAAGGAGG + Intergenic
949773829 3:7609306-7609328 ATTTTAGATCATGAGGAAAGTGG + Intronic
949840999 3:8319842-8319864 ACCTTAGGTCATGTGGAAAATGG - Intergenic
950891426 3:16408153-16408175 ACATGAGGGCCTGAGGCAGGAGG - Intronic
951243355 3:20312584-20312606 ACATTAGGTCATGAACATTGTGG - Intergenic
951727628 3:25777466-25777488 ACATGGGGTCTTGAGGAATGTGG - Intronic
952952485 3:38536335-38536357 AAATGAGGTCATGATGAAGAGGG - Intronic
954368419 3:50157846-50157868 AAATGAGGTCATGGGGAGGGGGG + Intronic
954747201 3:52794047-52794069 ACATAAGGTCATGACAAAGCAGG + Intergenic
955787234 3:62553397-62553419 AAACTAAGTCATGGGGAAGGTGG + Intronic
956033639 3:65066753-65066775 GCATGAGGTCATGAAGATGGTGG + Intergenic
956426820 3:69144702-69144724 ACCTTAGGGCAGGAGGCAGGAGG + Intergenic
959892293 3:111570411-111570433 ACCTTATCTCATGAGGCAGGAGG - Intronic
960473869 3:118100265-118100287 ACATTTATTCCTGAGGAAGGTGG + Intergenic
961251877 3:125514076-125514098 TGATTAGATCATGAGGATGGAGG - Intronic
961314531 3:126025596-126025618 AGGTGAGGTCATGAGGATGGGGG + Intronic
961321292 3:126078218-126078240 CGAGAAGGTCATGAGGAAGGTGG - Intronic
961497695 3:127306374-127306396 TGATTGGGTCATGAGGATGGGGG + Intergenic
962188738 3:133288154-133288176 ACATTTGATTGTGAGGAAGGTGG - Intronic
962991409 3:140580712-140580734 AGATTGAGTCATTAGGAAGGTGG - Intergenic
963543713 3:146627859-146627881 TGATTAGGTCATGAGGATGAAGG - Intergenic
965848062 3:172987615-172987637 ATATTAGGTCATGCTGAAAGGGG + Intronic
966476969 3:180360357-180360379 TGATTAAGTCATGAGGATGGAGG + Intergenic
966921076 3:184611797-184611819 ACACTAGGTCATAAGGAATTAGG - Intronic
967314684 3:188140471-188140493 AGATGAGCTTATGAGGAAGGAGG - Intergenic
970756513 4:19433351-19433373 GAATTAGGTCATGAGGGTGGAGG - Intergenic
971228695 4:24779419-24779441 AGATGAGGTCATGAGGGTGGGGG + Intergenic
972088425 4:35249920-35249942 ACATGAGGTCACGAAGGAGGAGG - Intergenic
972244040 4:37225844-37225866 CAATTAGGTCGTGAGGAAGTGGG - Intergenic
976771275 4:88655678-88655700 ACTCTAGATCATGAGGAGGGTGG - Intronic
977647914 4:99435173-99435195 TCATTAGGTCATGATGAGGAGGG + Intronic
978344741 4:107755459-107755481 ACGGAAGGTGATGAGGAAGGAGG - Intergenic
979069547 4:116184851-116184873 TGATCAGGTCATGAGGTAGGTGG + Intergenic
979132547 4:117065672-117065694 AATTTAGATCATTAGGAAGGGGG + Intergenic
979135145 4:117102158-117102180 AGATTAGATCATGAGTATGGAGG - Intergenic
980698048 4:136385686-136385708 ACTTCAGGGGATGAGGAAGGAGG + Intergenic
980966542 4:139526660-139526682 ACATTTGGTAATGAGGAAACAGG + Intronic
982546887 4:156745030-156745052 ACATTAGGACATTATCAAGGAGG - Intergenic
984593722 4:181644292-181644314 GCACCAGGTCATGAGGAGGGAGG + Intergenic
984905745 4:184624428-184624450 ACATTTGGTCATGAAAATGGTGG - Intergenic
984985251 4:185322418-185322440 AGATTTGGTCTTGGGGAAGGTGG + Intronic
985733140 5:1562814-1562836 AGCTTAGGTCATGAGGGCGGAGG - Intergenic
986440955 5:7781382-7781404 AGATGAGGTCATGCTGAAGGAGG + Intronic
988208511 5:28171964-28171986 ACAGTAGGTCATCTGGAAGCTGG - Intergenic
988429139 5:31099424-31099446 ATATCTGGTAATGAGGAAGGTGG + Intergenic
988739924 5:34059998-34060020 CAATCAGGTCCTGAGGAAGGTGG - Intronic
989547588 5:42692556-42692578 ACATTGGTTCATGAAGAAAGAGG + Intronic
992734778 5:79708024-79708046 TGATTAAGTCATGAGGATGGAGG - Intronic
993233741 5:85275543-85275565 ACATGATTTCATGAAGAAGGAGG + Intergenic
993996976 5:94734885-94734907 ACCATAGGTCATGATGAAGCTGG - Intronic
994381670 5:99079007-99079029 AGATTAGGTCATGAGGGTGGGGG - Intergenic
998041969 5:138956300-138956322 ACATTAAGGCATAAGCAAGGTGG - Intronic
999299238 5:150480901-150480923 AAATTAGGTAAAGGGGAAGGTGG + Intergenic
999633997 5:153600936-153600958 TCTTTATCTCATGAGGAAGGTGG + Intronic
1000158470 5:158575463-158575485 ACATAAGGTCATGAGGGTGGGGG + Intergenic
1002283414 5:178146605-178146627 ACATTAGGTCATGAGGAAGGCGG - Intronic
1002585580 5:180244949-180244971 ACATGAGGAGATGAGGACGGGGG - Intronic
1004593154 6:17073281-17073303 TGATTAGGTCATGAAGATGGAGG + Intergenic
1004811421 6:19268471-19268493 AAATTAGGACTTCAGGAAGGTGG + Intergenic
1005002972 6:21261292-21261314 ACATTAGCTAAAGAAGAAGGAGG + Intergenic
1005804768 6:29463910-29463932 TGATTAGGTCATGAGGGAAGAGG - Exonic
1006811305 6:36822191-36822213 ACCTCAGGCCAAGAGGAAGGAGG + Intronic
1008730090 6:54471532-54471554 ACACTAGGTAATGAGAAAAGTGG + Intergenic
1014003154 6:116387462-116387484 ACGGCAGGTTATGAGGAAGGAGG + Intronic
1014056382 6:117019974-117019996 ACATTATATCTTCAGGAAGGAGG + Intergenic
1017525879 6:155241033-155241055 ACTTTAGGTGATGAGGAACTTGG + Intronic
1017557056 6:155583062-155583084 ACATTCTGCCATGGGGAAGGAGG + Intergenic
1017617299 6:156258996-156259018 ACCTGGGGTCAAGAGGAAGGGGG - Intergenic
1017735431 6:157358686-157358708 AGAATGGGGCATGAGGAAGGAGG - Intergenic
1018153491 6:160963056-160963078 ACATTAGGTCTAGAGACAGGTGG - Intergenic
1019075854 6:169387667-169387689 AGAGAAGGTGATGAGGAAGGAGG - Intergenic
1019757380 7:2782806-2782828 ATAAAAGGTCAGGAGGAAGGAGG - Intronic
1021241372 7:18206420-18206442 AAATTAGGTCAGGAGTAAGCAGG + Intronic
1023837701 7:44078040-44078062 ACATAAGGTCCTGCAGAAGGCGG + Intronic
1023895954 7:44432995-44433017 TGATTAGGTCATGAGGGTGGAGG + Intronic
1024720029 7:52125871-52125893 ACAGCAGGTCTTGAGAAAGGAGG - Intergenic
1024963513 7:55002973-55002995 ACACTAGGGGCTGAGGAAGGAGG - Intergenic
1027441838 7:78227664-78227686 ACATCATTTCATTAGGAAGGTGG - Intronic
1030436071 7:109522295-109522317 AGATTAGGTCATGATAGAGGAGG + Intergenic
1030693518 7:112559381-112559403 AGATTAGGTCATAAGAATGGAGG - Intergenic
1031310763 7:120194440-120194462 ACAGAAGGTGAAGAGGAAGGAGG - Intergenic
1032546900 7:132751365-132751387 ACATTTGGTGAGGAGGCAGGGGG - Intergenic
1032762438 7:134956409-134956431 CAATTAGGTCATGAGGGTGGAGG + Intronic
1032986379 7:137342555-137342577 ACATTATGTCATGGAGAAAGGGG + Intronic
1033805053 7:144944530-144944552 TGATTAGGTCATGAGGGTGGGGG - Intergenic
1033973078 7:147067335-147067357 TAATTAGGTCATGAGGGTGGAGG - Intronic
1034155494 7:148953056-148953078 ACATTCGGTCCATAGGAAGGTGG - Intergenic
1034511245 7:151536703-151536725 TGATTAGGTCATGAGGGTGGGGG + Intergenic
1034758534 7:153647846-153647868 AGATGAGGAAATGAGGAAGGAGG + Intergenic
1038124894 8:24662533-24662555 ACTTTTGGTCCTGAGGAAAGTGG - Intergenic
1038987843 8:32832846-32832868 ACATTGTGTCCTGAGGAAGATGG + Intergenic
1039009760 8:33080168-33080190 ACATCAAGTCATGTGGAAGTAGG + Intergenic
1040840666 8:51781026-51781048 TGATTAGGTCATGAAGATGGAGG - Intronic
1041244329 8:55876375-55876397 GCATGAGGGCTTGAGGAAGGTGG + Intergenic
1041362480 8:57067507-57067529 GCATGAGGACATGAGGAATGGGG + Intergenic
1044020206 8:87096398-87096420 AAATTAGGTCATAAGGTTGGGGG - Intronic
1044749158 8:95399785-95399807 CTATGAGGTCATGAGGATGGGGG + Intergenic
1045296579 8:100876625-100876647 TGATTCGGTCATGAGGATGGAGG - Intergenic
1045449713 8:102310255-102310277 ACTTTTGGAAATGAGGAAGGAGG - Intronic
1045574613 8:103406776-103406798 ACATTTGTTTATGATGAAGGTGG - Intronic
1046354718 8:113066898-113066920 ACATTAGATCAGGAGTAGGGTGG + Intronic
1047520523 8:125592287-125592309 CCATTTTATCATGAGGAAGGGGG - Intergenic
1047823364 8:128546560-128546582 TCATTAGAGCATGAGGAAAGGGG + Intergenic
1049938499 9:522537-522559 CCTTTTGCTCATGAGGAAGGGGG + Intronic
1050046153 9:1547746-1547768 CCAGTAAGTCATGAAGAAGGTGG + Intergenic
1052248240 9:26364797-26364819 ATCTTAGGGCATGAGGATGGAGG + Intergenic
1053547353 9:39037237-39037259 CCATTAGTTCATGAGAAAGCTGG - Intergenic
1056902790 9:90615792-90615814 AGATGAGGTCATGAGGAGGCTGG - Intronic
1057415494 9:94858699-94858721 TGATTAGGTCATGAGGGTGGAGG + Intronic
1059263616 9:113004480-113004502 TAATTAGGTCATGATGATGGAGG + Intergenic
1187461285 X:19489543-19489565 TGATTAGGTCATGAGGATGGAGG + Intronic
1192594182 X:72388736-72388758 AAATAAGGTCATGGTGAAGGGGG + Intronic
1195407133 X:104527130-104527152 AGTTTAGGTCATGAGGATAGAGG - Intergenic
1197342502 X:125289636-125289658 TAATTAGGTCATGAGGGAGTGGG + Intergenic
1198407491 X:136328858-136328880 ACTTTTCGTGATGAGGAAGGAGG - Intronic
1198671769 X:139088836-139088858 TTATTAGGTCATGAGGTTGGAGG + Intronic
1201537919 Y:15071097-15071119 ACATGTGGACATGAGGGAGGGGG - Intergenic