ID: 1002283900

View in Genome Browser
Species Human (GRCh38)
Location 5:178149649-178149671
Sequence TGGGCTGGCAGCAGGACGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002283900_1002283909 12 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283909 5:178149684-178149706 GGCAGGTGCCCAGGTGCTACCGG 0: 3
1: 0
2: 4
3: 28
4: 244
1002283900_1002283904 -5 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283904 5:178149667-178149689 GCCCAATAGCTTCCAGCGGCAGG 0: 1
1: 1
2: 2
3: 3
4: 52
1002283900_1002283907 3 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283907 5:178149675-178149697 GCTTCCAGCGGCAGGTGCCCAGG 0: 2
1: 1
2: 3
3: 20
4: 207
1002283900_1002283913 26 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283913 5:178149698-178149720 TGCTACCGGAGCCCCTCATAGGG 0: 1
1: 2
2: 0
3: 2
4: 48
1002283900_1002283912 25 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283912 5:178149697-178149719 GTGCTACCGGAGCCCCTCATAGG 0: 1
1: 2
2: 0
3: 7
4: 36
1002283900_1002283902 -9 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283902 5:178149663-178149685 GCCAGCCCAATAGCTTCCAGCGG 0: 1
1: 0
2: 2
3: 8
4: 109
1002283900_1002283914 27 Left 1002283900 5:178149649-178149671 CCAGTCGTCCTGCTGCCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1002283914 5:178149699-178149721 GCTACCGGAGCCCCTCATAGGGG 0: 1
1: 2
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002283900 Original CRISPR TGGGCTGGCAGCAGGACGAC TGG (reversed) Exonic
900392240 1:2438758-2438780 TGGGCAGGCAGCGGGACGGGGGG - Intronic
901231794 1:7645751-7645773 TGGGCGGGCGGCAGGAGGGCTGG + Intronic
901281460 1:8039032-8039054 TGGCCTGGTAGTAGGACAACTGG + Intergenic
902548933 1:17208005-17208027 TGGGCTGGCAGCAGGAGGAAGGG + Intronic
902923894 1:19683139-19683161 AGGGCTGGCAGCAGCAGGAAGGG + Exonic
903340956 1:22653989-22654011 AGGGCTGCCAGAAGGATGACAGG - Intronic
904061708 1:27716165-27716187 TGGGGTGGCAGAAGGAGGGCTGG - Intergenic
904616389 1:31752451-31752473 TGGTCTGGCAGCAGGAAGTGGGG - Intronic
906477611 1:46180547-46180569 TGGGCAGGCAGAGGGACGCCTGG - Exonic
906479480 1:46190694-46190716 GGGGCTGGCAGCAGGGCAAGGGG - Intronic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
907490303 1:54805149-54805171 TGGGCTGGAAGCAGGGCCTCTGG + Intergenic
907566980 1:55444570-55444592 AGGGCAGACAGCAGGACGGCAGG - Intergenic
908822508 1:68102833-68102855 TGGTCTGGCAGCTGGAGGAGTGG + Intronic
914950446 1:152109344-152109366 GGCGCTGGCAGCAGCGCGACAGG - Exonic
915087548 1:153398443-153398465 TGTGGTGGCAGCAGGAAGAGAGG - Intergenic
915431529 1:155870806-155870828 CGGGCTGGCTGCAGGGGGACAGG - Intronic
916866453 1:168864660-168864682 TGAGATGGCAGCAGGAAGAGAGG + Intergenic
922549602 1:226484338-226484360 AGGGCTGACAGCAGGAGGTCTGG - Intergenic
922568593 1:226618422-226618444 TTGGCAGGCAGCAGGAGGAGAGG + Intergenic
923261447 1:232272077-232272099 AGGCCCAGCAGCAGGACGACAGG - Intergenic
1063088356 10:2839563-2839585 AGGGCTGGGATCAGGACAACAGG + Intergenic
1070340617 10:75494959-75494981 CAGGCTGGCAGCAGGAAGAAAGG + Intronic
1070541598 10:77419138-77419160 TGGGGTGGCACCAGGGGGACTGG + Intronic
1070784115 10:79153303-79153325 TGGGCTGCCAGGAGGACCACGGG - Intronic
1070963282 10:80514231-80514253 TGAGCTGGCGGCAGGACTCCTGG + Intronic
1072099650 10:92216835-92216857 TGGGCTGACGGCAGGACGACTGG + Intronic
1073057211 10:100710360-100710382 TGGGCTGGCAGCAGGAGCGCGGG - Intergenic
1075961219 10:126568947-126568969 CGGGCTGGCAGGAGGAGGTCTGG + Intronic
1076235745 10:128862678-128862700 TGGGTTGGGAGCTGGAGGACAGG + Intergenic
1076872789 10:133201852-133201874 TGGGGCGGCAGCAGGCGGACGGG + Exonic
1077098495 11:810175-810197 TGGGCCGGCAGGAGGCCGCCGGG + Intronic
1077259417 11:1607926-1607948 TGGGCTTGCAGCAGCTGGACTGG + Exonic
1079512262 11:21225131-21225153 TGGGATGGCAGCAGGACCCCAGG + Intronic
1079992988 11:27266234-27266256 TGGCCTGGCCCCAGGAGGACGGG + Intergenic
1080499178 11:32852399-32852421 TGGCCAGGCAGCAGGACTGCAGG + Intronic
1080989363 11:37511665-37511687 TTGGCTGGCAGTAGGATGGCTGG + Intergenic
1081670149 11:44938225-44938247 TGGGCGGGGAGGATGACGACGGG - Exonic
1083655610 11:64227740-64227762 TGGGCTGGCAGGAGGCCTGCAGG + Intronic
1083953288 11:65968649-65968671 AGGGGTGGCAGCAGGTGGACAGG + Intronic
1084778834 11:71395778-71395800 TGGCCTGGCAGCAGGACCCCTGG + Intergenic
1084958411 11:72703524-72703546 TGGGCTGGGAGCAGGACGCCTGG + Intronic
1089611807 11:119673416-119673438 TGGGCTGGGGGCAGGAGGGCCGG - Intronic
1089615937 11:119694805-119694827 TGGGGGGGCAGCAGGACACCTGG - Intronic
1089629102 11:119772734-119772756 TGGGGTGGCAGCAGGAGGAGGGG + Intergenic
1090482111 11:127078019-127078041 TGGGCTGGGGGCAGGAGGATGGG - Intergenic
1091990717 12:4953589-4953611 TGAGCTACCAGCAGGAAGACAGG - Intergenic
1093805180 12:23423323-23423345 GGGGCAGGAAGCAGGATGACAGG - Intergenic
1095633592 12:44405601-44405623 TGGGCAGGCAGCAGGAGGCATGG + Intergenic
1096014665 12:48258738-48258760 GGGGCTGGCAGGAGGAGGAATGG + Intergenic
1096196656 12:49652944-49652966 TGGGCTGGTAGGAGGAGGCCTGG + Intronic
1096559879 12:52428496-52428518 TGGGCTGTCAGCAGGACTCATGG - Intronic
1096761532 12:53845713-53845735 TGGGCTGGCAGCTGGTAAACAGG + Intergenic
1101960839 12:109248657-109248679 CGCGCTGGCAGCTGGATGACTGG + Intronic
1101995636 12:109523296-109523318 TGGGCTGGCGAGAGGAAGACAGG - Intronic
1102329747 12:112018979-112019001 GGGGCTGGGAGGAGGAAGACTGG + Intronic
1102875458 12:116445280-116445302 TGGGCTAGCAGCTGGAGAACAGG + Intergenic
1103607625 12:122098842-122098864 TGGGCTGGGAGGAGGACCACTGG + Intronic
1103710669 12:122910200-122910222 AGGGCTGGCAGCAGGCAGATGGG + Intergenic
1104371558 12:128228330-128228352 TGGGGTGGCAGGAGGACCCCTGG + Intergenic
1104731316 12:131107026-131107048 TGTGCTGGCAGCAGGAGGGGAGG + Intronic
1104810928 12:131620022-131620044 GGGGCTGGCAGCATCAGGACAGG + Intergenic
1105606505 13:21930593-21930615 TGGGCTGGGGGCAGGAGGCCTGG + Intergenic
1106256056 13:28022891-28022913 TGGGCTGGCAGCAGTCCTGCAGG - Intronic
1108505979 13:51112805-51112827 TGGGCTGGAAGCTGGACAATTGG - Intergenic
1108572739 13:51767216-51767238 TGTGCTGGCAGCACCAGGACGGG - Exonic
1109951641 13:69508050-69508072 TGGGCTGGGAGAATGACTACAGG - Intergenic
1113562902 13:111298039-111298061 TGGGCTCAAAGCAGGACAACTGG + Intronic
1116577498 14:46593104-46593126 TGGGCTGGTAGCAAGAAGACAGG + Intergenic
1118347201 14:64948935-64948957 TGGGGTGGCAGCTGGAAGAATGG - Intronic
1120872618 14:89351619-89351641 GGAACTGGCAGCAGGCCGACGGG + Intronic
1122825301 14:104367738-104367760 TGGGCGGGCAGCAGGGTGACAGG + Intergenic
1122881252 14:104691456-104691478 GGGGCTGGCAGCAGGGAGTCAGG - Intronic
1124621265 15:31275429-31275451 TGGGCTGGCAGCAGAGGGGCTGG + Intergenic
1124623781 15:31296792-31296814 TGGCCTGCCACCAGGACGCCGGG + Intergenic
1125710065 15:41777578-41777600 TGGTCTGGCAGCAAAATGACTGG + Intronic
1126792772 15:52236223-52236245 TGGGCTGGCAGCAGGCCCCGTGG + Intronic
1131282740 15:91034151-91034173 TGAACCGGCAGCAGGACGAGAGG - Intergenic
1132333534 15:101028790-101028812 TGGGCTGGCAGCCTGATCACAGG - Intronic
1133002865 16:2859902-2859924 TAGGGTGGCAGCAGGACGACTGG + Intergenic
1133326169 16:4943637-4943659 TGGTCTGGCTGCAGGAACACAGG - Intronic
1134063944 16:11214980-11215002 TGGGGTGGCTGGGGGACGACAGG - Intergenic
1135406194 16:22199725-22199747 TGGGAGGCCAGCAGGGCGACGGG - Intergenic
1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG + Intronic
1137253447 16:46757017-46757039 TGGGCTGGGAGGAGGTCCACTGG - Intronic
1139178080 16:64713756-64713778 TGGGCTGGTGGAAGGAGGACAGG + Intergenic
1140319875 16:73939976-73939998 GGGGCAGGCAGCAGGAAGAAAGG + Intergenic
1141609381 16:85172491-85172513 CGGGCGGGCAGCAGGAAGGCAGG - Intronic
1142007798 16:87697995-87698017 CGGGCTGGCCCCAAGACGACCGG - Exonic
1142132164 16:88436123-88436145 TGGGTTGGCAGCGGGAGCACCGG - Exonic
1143980480 17:10865205-10865227 TACTCTGGCAGGAGGACGACAGG - Intergenic
1144236686 17:13268386-13268408 TGTGATGGAAGCAGGACCACTGG - Intergenic
1144270522 17:13610914-13610936 TGTGCTGGGAGCAGGAAAACAGG - Intergenic
1144721944 17:17477053-17477075 TGGGGTGGCAGCCGGGCGACAGG + Exonic
1146004477 17:29152246-29152268 TGGGCTGTCAGGAGCAAGACAGG + Intronic
1146685746 17:34840579-34840601 TGGGAGGGCAGCAGGAAGCCAGG - Intergenic
1147512636 17:41084506-41084528 TGGGCTGGCAGCACACAGACTGG - Exonic
1147513873 17:41097718-41097740 TGGGCTGGCAGCACACAGACTGG + Exonic
1147513890 17:41097823-41097845 TGGGCTGGCAGCACACAGACTGG + Exonic
1147513902 17:41097898-41097920 TGGGCTGGCAGCACACAGACTGG + Exonic
1147514372 17:41101891-41101913 TGGGGTGGCAGCAGGTGGGCTGG + Exonic
1147514416 17:41102150-41102172 TGGGCTGGCAGCACACAGACTGG + Exonic
1147514825 17:41105808-41105830 TGGGCTGGCAGCACACAGACTGG - Exonic
1147515968 17:41117904-41117926 TGGGGTGGCAGCAGGTGGGCTGG + Exonic
1147515969 17:41117919-41117941 TGGGCTGGCAGCACACAGACTGG + Exonic
1147515985 17:41118024-41118046 TGGGCTGGCAGCACATAGACTGG + Exonic
1147516002 17:41118129-41118151 TGGGCTGGCAGCACACAGACTGG + Exonic
1147516592 17:41123708-41123730 TGGGCTGGCAGCACACAGACTGG + Exonic
1147516613 17:41123828-41123850 TGGGCTGGCAGCACACAGACTGG + Exonic
1147517974 17:41140181-41140203 TGGGCTGGCAGCACACAGACTGG + Exonic
1147517996 17:41140313-41140335 TGGGCTGGCAGCACACAGACTGG + Exonic
1147518893 17:41149413-41149435 TGGGCTGGCAGCACACAGACTGG + Exonic
1147519839 17:41160337-41160359 TGGGCTGGCAGCACACAGACTGG + Exonic
1147519860 17:41160442-41160464 TGGGCTGGCAGCACACAGACTGG + Exonic
1147521538 17:41177990-41178012 TGGGCTGGCAGCACACAGACTGG + Exonic
1147522774 17:41190288-41190310 TGGGCTGGCAGCAGGTAGGCTGG - Exonic
1147906342 17:43825572-43825594 TGGGGTGGCAGCAGGAGGAGGGG - Intronic
1148069379 17:44899191-44899213 TGGGAAGGCACGAGGACGACAGG + Intronic
1148103880 17:45109077-45109099 TAGGCTGGAGCCAGGACGACAGG + Exonic
1148463019 17:47848843-47848865 TGGGCTGACAGCAGGTCTGCAGG - Intronic
1148564728 17:48626107-48626129 TGGGCTGGAAGCTGCACGAGGGG + Exonic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151500010 17:74482426-74482448 AGGGCTGGCACCAGGGTGACAGG + Intronic
1151706947 17:75774192-75774214 TGGGCCGTCAGCAGGACCACAGG + Intergenic
1151882244 17:76902813-76902835 TAGGCTTTCAGCAGGACAACTGG + Intronic
1152095560 17:78269807-78269829 GGTGCTGGCAGCAGGGCCACGGG - Intergenic
1152403350 17:80082722-80082744 TTGGCTGGTAGCAGCACGGCTGG - Intronic
1157592615 18:48844596-48844618 AGGGCTGGCAGCCAGACCACAGG + Intronic
1157665164 18:49479833-49479855 TGGGCTGAAAGCAGGATGAGGGG + Intronic
1160870386 19:1275228-1275250 CGGGCTGGCAGCGGGGAGACGGG - Intergenic
1161101062 19:2422124-2422146 GGGGCTGCCAGCAGGGTGACGGG + Exonic
1161398651 19:4058242-4058264 TGGGCAGGCAGGAGGTGGACAGG - Intronic
1161545423 19:4877744-4877766 TGGGCTCGCTGCAGGAAGCCAGG + Intergenic
1163170553 19:15528094-15528116 GGAGCTGGCAGCTGGACGTCAGG - Intronic
1163552549 19:17973846-17973868 TGGGCTCGCTGCAGGCCGCCCGG - Exonic
1163786572 19:19277775-19277797 TGGGCTGGAAGGAGGGCGAGGGG - Exonic
1164162226 19:22634644-22634666 TGCGCTGGCAGCCGGACCCCCGG + Intronic
1166068672 19:40375262-40375284 TGGGCTGGAAACAGGATGAGGGG + Intronic
1166305564 19:41935228-41935250 TGGGCTGGGGTCAGGCCGACAGG + Intergenic
1167511173 19:49896050-49896072 AGGGCTGGGAGGAGGAGGACAGG + Exonic
1167654742 19:50756173-50756195 TGGGATGGAAGCAGGAGGCCGGG - Intergenic
1167656421 19:50767252-50767274 TGGGATGGAAGCAGGAGGCCGGG - Intergenic
1202636011 1_KI270706v1_random:45050-45072 CTAGCTGACAGCAGGACGACAGG - Intergenic
927441302 2:23119825-23119847 GGGGCTGGAGGCAGGATGACTGG - Intergenic
932773139 2:74512942-74512964 TGGGCTGGCAGCCTGGCGCCTGG - Intergenic
934574251 2:95390524-95390546 TGGGCTGGCAGCAGTGCCTCTGG - Intergenic
934656965 2:96121432-96121454 TGGGCTGGAAGCAGAACAGCCGG - Intergenic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
938062046 2:128261934-128261956 GGGGCTGGGAGCAGGATGGCAGG + Intronic
939940276 2:148341152-148341174 TGGGGTGGGAGGAGGATGACAGG - Intronic
946313740 2:218896778-218896800 GGCGCTGGCAGCAGGAAGCCGGG - Intronic
946394128 2:219434858-219434880 CGGGCGGGCAGCAGGAAGGCAGG + Exonic
1170413551 20:16116057-16116079 TAGGCTGACAGCAGGAGGTCTGG + Intergenic
1172274174 20:33670794-33670816 TGGGGTGGCAGGGGGAGGACAGG + Intronic
1173457023 20:43211131-43211153 TGAGCTGGCAGCTGGACATCAGG - Intergenic
1174284241 20:49461089-49461111 TGGGCTGGCAGCAGAACGTGGGG - Intronic
1174287196 20:49482075-49482097 GGGCCTGGCAGCAGGACTCCAGG + Exonic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1175698227 20:61118506-61118528 TGGGCTGGAAGCGAGAGGACTGG - Intergenic
1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG + Intronic
1179769466 21:43603652-43603674 GGTGCTGCCAGCAGGATGACTGG - Intronic
1179831694 21:44001002-44001024 AGGGCTGGGGGCTGGACGACAGG + Intergenic
1179937076 21:44612790-44612812 TGGGCTGGCAGGAGGAGGCAGGG - Exonic
1180072691 21:45444257-45444279 TGGGCTTGCAGCAGGAGCACGGG + Intronic
1180127926 21:45804797-45804819 TGTGGTGGCAGCAGAAGGACAGG - Intronic
1180181252 21:46119599-46119621 AGGGCTGGCAGCAGAGCCACTGG + Intronic
1180717891 22:17884313-17884335 CAGGCAGGCAGCAGGACGGCTGG + Intronic
1180791541 22:18577868-18577890 CGGGCTGGCGGCAGGCGGACGGG - Intergenic
1181230199 22:21417443-21417465 CGGGCTGGCGGCAGGCGGACGGG + Intronic
1181248450 22:21517420-21517442 CGGGCTGGCGGCAGGCGGACGGG - Intergenic
1181394710 22:22612866-22612888 TGTGCTGGGAGCAGGAGGTCAGG - Intergenic
1183317855 22:37146667-37146689 TAGGCTGGCAGCAGCAGGGCCGG + Intronic
1183506814 22:38214041-38214063 TGGGCTGGGACCAGGAGGCCTGG + Intronic
1185159211 22:49212722-49212744 TGGGCTGGCACCATGGCGGCCGG + Intergenic
1185344090 22:50303947-50303969 TGGGCTGGGATCAGGGCGCCTGG - Intronic
950920238 3:16686609-16686631 TGGGAAGGCAGAAGGAAGACCGG + Intergenic
950921777 3:16702373-16702395 TGGGGTGGGAGCAGGACGTGGGG + Intergenic
952970078 3:38645238-38645260 TGGGCTGGCAGCAGGCTGTGGGG + Intronic
953417715 3:42732446-42732468 TGGGCTGGCAGTAGGAACAAAGG + Intronic
960814677 3:121660494-121660516 TGAGCTGGGAGGAGGACCACAGG - Intronic
961451690 3:127005066-127005088 TGGGCAGGCAGCAGGAGGCATGG - Intronic
962745769 3:138396415-138396437 TGGTCAGGCAGCAGGGGGACTGG + Intronic
964473239 3:157076235-157076257 TGGGCTGGCAGCAGATCCTCAGG - Intergenic
967085407 3:186090804-186090826 AGGGCTGGGATCAGGACGAGAGG + Intronic
968384736 4:125721-125743 GGGGCTGGCAGCAGGATGCGGGG - Intronic
968938875 4:3627739-3627761 TGCGCTGGCAGCTGGATGAATGG + Intergenic
969226922 4:5804783-5804805 TCGTCGGGCAGCAGGACGGCAGG + Exonic
969298369 4:6282639-6282661 TGGGCTGGGAGCAGGGCAGCTGG - Intronic
972914151 4:43855224-43855246 TGGGATGGGAGCAGGACAAAAGG - Intergenic
976260314 4:83139155-83139177 GGGCCTGGCAGCAGAATGACAGG + Intergenic
976369171 4:84267272-84267294 TGGGGTGGCAGCTGGAATACTGG - Intergenic
979646800 4:123079220-123079242 TGGCATGGCAGGAGGAAGACTGG - Intronic
982693620 4:158574980-158575002 TGAACTGCCAGCAGGTCGACGGG - Intronic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
984713095 4:182902513-182902535 CAGGCTGGCAGGAGGAAGACAGG - Intronic
984812578 4:183807750-183807772 TGGGCTGTCAGCAGGGAGATGGG + Intergenic
985048752 4:185969435-185969457 TGGGCTGGCAGCTGCAGGGCAGG - Intergenic
985552077 5:538803-538825 TGGGCTGGCAGGAGGGGCACGGG + Intergenic
985812866 5:2103124-2103146 TGGCCAGGCAGCAGGAGGCCGGG + Intergenic
990381616 5:55225890-55225912 TGGGATGGGAGCAAGAAGACAGG + Intronic
990514707 5:56520444-56520466 TGGGTTTGCAGCAGGACACCAGG - Intronic
991976029 5:72184304-72184326 TGGGCTGGCACCAGGTCACCTGG + Intronic
997363599 5:133311334-133311356 TGGGCGGGGAGGAGGATGACGGG + Intronic
999494585 5:152084586-152084608 TGGGATGGCATCAGGAGGCCTGG + Intergenic
999734976 5:154506262-154506284 GAGGCAGGCAGCAGGAGGACTGG - Intergenic
1001219720 5:169890124-169890146 GAGGCTGGCAGCAGGAAGACAGG - Intronic
1001694319 5:173658833-173658855 TAGGCTGGCAGCAGGATGCCTGG - Intergenic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1002518367 5:179775630-179775652 TGTCCTGGCAGCAGGACCCCAGG + Exonic
1004396116 6:15248109-15248131 CGGGCTTGCAGCCGGACGCCCGG - Intronic
1006121749 6:31811126-31811148 TGGCCTGGGTGCTGGACGACAGG + Exonic
1006122646 6:31816575-31816597 TGGCCTGGGTGCTGGACGACAGG - Exonic
1006124509 6:31828769-31828791 TGGCCTGGGTGCTGGACGACAGG - Exonic
1006673959 6:35748819-35748841 TGGGCTGGCAGGAGGAGGGCCGG - Exonic
1008772091 6:54991786-54991808 TGGGCTCCCAGAAGGACAACAGG - Intergenic
1011041754 6:83037120-83037142 GGGGCTGGAAGCAGGATGATTGG - Intronic
1016908988 6:149178430-149178452 TGGGCAGGCACCAGGACTCCGGG + Intergenic
1019068319 6:169321393-169321415 AGGGATGGCAGCAGGAGGAAAGG - Intergenic
1019329468 7:455488-455510 TGGGCTGGACGCAGGACGTGGGG + Intergenic
1019427765 7:985371-985393 TGGGCGTGCAGCAGGAGGACGGG + Intronic
1019930346 7:4218670-4218692 AGGGCTGACAGCAGGAGGGCAGG + Intronic
1022083964 7:27048670-27048692 TGGGCTGACGGCGGGACGACCGG + Intergenic
1022530890 7:31066230-31066252 TGGGTTGGGAGCAGGACACCTGG - Intronic
1023093755 7:36640112-36640134 GGGGGTGGCAGCAGGAAGCCAGG + Intronic
1025776170 7:64562734-64562756 TGGGCTGACAGCCGGACCCCGGG - Intronic
1026747093 7:73022214-73022236 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1026750743 7:73050357-73050379 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1026754392 7:73078467-73078489 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1026758044 7:73106500-73106522 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1026881460 7:73909148-73909170 AGGGCTGGCAGCAGGGGGAGGGG + Intergenic
1026990062 7:74579963-74579985 TGGGATGGCAGAAGAACCACAGG + Intronic
1027033196 7:74906785-74906807 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1027089359 7:75286984-75287006 TGGGCTGGAGGCTGGACGAGGGG + Intergenic
1027093004 7:75314912-75314934 TGGGCTGGAGGCTGGACGAGGGG + Intergenic
1027096647 7:75342879-75342901 TGGGCTGGAGGCTGGACGAGGGG + Intergenic
1027322700 7:77024801-77024823 TGGGCTGGAGGCTGGACGAGGGG - Intergenic
1029397765 7:100319853-100319875 TGGGCTGGAGGCTGGACGAGGGG + Intronic
1035271321 7:157721779-157721801 TGGGGTGGGAGCAGGAGCACAGG - Intronic
1035383040 7:158452536-158452558 TGGGGTGGCAGGAGGCCGCCCGG - Intronic
1035604420 8:920265-920287 TGGGCTCCCAGCAGGACAGCAGG + Intergenic
1037733074 8:21545413-21545435 TGGGCTGGCGGCAGGAAGAATGG + Intergenic
1039828663 8:41195496-41195518 GGGGCTGCCAGCAGGAGGAGAGG + Intergenic
1039906608 8:41791009-41791031 TGGGCTGACAGCAGGACAGAGGG + Intronic
1040308556 8:46224810-46224832 TGGGCGGGCAGCAGGGACACAGG + Intergenic
1040313689 8:46249824-46249846 TGGGCGGGCAGCAGGAACTCAGG + Intergenic
1040337355 8:46422837-46422859 TGGGCTGGCTGCAGGTACACAGG + Intergenic
1040340758 8:46439433-46439455 TAGGCTGGCAGCAGGGAGTCAGG - Intergenic
1040995847 8:53401262-53401284 TCGGCTTTCAGCAGGATGACAGG - Intergenic
1042530523 8:69810269-69810291 TGGGCTGGGAGAAGGAAGCCAGG + Intronic
1048855219 8:138681085-138681107 TGGGGTGGCAGCAAGAAGGCAGG - Intronic
1049372192 8:142273216-142273238 TGGGACGGCAGGAGGACGATGGG - Intronic
1049440208 8:142606148-142606170 TGGACTGGGAGCAGGGCCACTGG + Intergenic
1049464672 8:142745386-142745408 TGGGCTGGCACCAGGAGTCCTGG + Intergenic
1049495132 8:142926492-142926514 TGGGCTGGTTGGAGGACGACGGG - Intergenic
1049495363 8:142928410-142928432 TGGGATGGCAGCGTGACGGCCGG - Intergenic
1049574678 8:143384689-143384711 CTGGCTGGCAGCAGGACCTCAGG - Intergenic
1050744166 9:8857810-8857832 TGGGCTGGCCGCACGAGGGCTGG - Intronic
1054451867 9:65407581-65407603 TGTGCTGGCAGCTGGATGAATGG - Intergenic
1056759724 9:89405910-89405932 TGGGCTGGTAGCTGGAGGAGCGG - Intronic
1057421344 9:94915527-94915549 TGGTCAGGCAGCAGGACGTCGGG - Intronic
1057526525 9:95808003-95808025 TGGGCTGGGAGCTGGAGGGCAGG - Intergenic
1059540248 9:115123120-115123142 GGGGCTGGCAGCAGGGAGAGGGG + Intergenic
1062097871 9:134712143-134712165 TGGGCAGGAAGGAGGAGGACAGG - Intronic
1062419467 9:136472899-136472921 GTGGCTCGCAGCAGGAGGACCGG + Intronic
1062502825 9:136858589-136858611 TGGGTGGGCAGCAGGAGGCCAGG - Intronic
1062528358 9:136987809-136987831 GGGGCTGGCAGCAGGACGGAGGG - Intergenic
1062579066 9:137221665-137221687 AGCGCTGGCTGCAGGAGGACCGG + Intergenic
1190913682 X:54794217-54794239 TGGTCTGGCAGCAGGACACTGGG + Intronic
1192541246 X:71975086-71975108 TATGCTGGCCGCAGGACTACTGG + Intergenic
1197355319 X:125432208-125432230 TGGGCTGGCAGCAGATGGATGGG + Intergenic
1199767506 X:150952092-150952114 TGAGCTGCTAGCAGGATGACTGG + Intergenic
1201792628 Y:17858974-17858996 TGGGCTTGCTGCAGGAGGCCAGG - Intergenic
1201808926 Y:18047012-18047034 TGGGCTTGCTGCAGGAGGCCAGG + Intergenic