ID: 1002284729

View in Genome Browser
Species Human (GRCh38)
Location 5:178154545-178154567
Sequence GCGGTGCAGACGCAGGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002284729_1002284732 -2 Left 1002284729 5:178154545-178154567 CCACTGACCTGCGTCTGCACCGC No data
Right 1002284732 5:178154566-178154588 GCTTTTCCACAGATAGCGTGTGG No data
1002284729_1002284735 18 Left 1002284729 5:178154545-178154567 CCACTGACCTGCGTCTGCACCGC No data
Right 1002284735 5:178154586-178154608 TGGCTCACTCTCATCCCGCAGGG No data
1002284729_1002284734 17 Left 1002284729 5:178154545-178154567 CCACTGACCTGCGTCTGCACCGC No data
Right 1002284734 5:178154585-178154607 GTGGCTCACTCTCATCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002284729 Original CRISPR GCGGTGCAGACGCAGGTCAG TGG (reversed) Intergenic
No off target data available for this crispr