ID: 1002284904

View in Genome Browser
Species Human (GRCh38)
Location 5:178155651-178155673
Sequence CCTTCCATGTAAGAGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002284904_1002284907 2 Left 1002284904 5:178155651-178155673 CCCTTCAGCTCTTACATGGAAGG No data
Right 1002284907 5:178155676-178155698 AAAGAAAGTTAACATTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002284904 Original CRISPR CCTTCCATGTAAGAGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr