ID: 1002289589

View in Genome Browser
Species Human (GRCh38)
Location 5:178190648-178190670
Sequence GAAATGCTTGGGTTAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002289583_1002289589 19 Left 1002289583 5:178190606-178190628 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1002289589 5:178190648-178190670 GAAATGCTTGGGTTAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002289589 Original CRISPR GAAATGCTTGGGTTAAGAAA GGG Intergenic
No off target data available for this crispr