ID: 1002290089

View in Genome Browser
Species Human (GRCh38)
Location 5:178194469-178194491
Sequence GGTCTGATTAGACCAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002290084_1002290089 -4 Left 1002290084 5:178194450-178194472 CCCTTGTCTCTTTCCCTTGGGTC No data
Right 1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG No data
1002290085_1002290089 -5 Left 1002290085 5:178194451-178194473 CCTTGTCTCTTTCCCTTGGGTCT No data
Right 1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG No data
1002290083_1002290089 -3 Left 1002290083 5:178194449-178194471 CCCCTTGTCTCTTTCCCTTGGGT No data
Right 1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG No data
1002290080_1002290089 7 Left 1002290080 5:178194439-178194461 CCTCGGAGTGCCCCTTGTCTCTT No data
Right 1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002290089 Original CRISPR GGTCTGATTAGACCAAAGGC TGG Intergenic
No off target data available for this crispr