ID: 1002290569

View in Genome Browser
Species Human (GRCh38)
Location 5:178197866-178197888
Sequence GCTGCTAGGGAGGTTGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002290562_1002290569 25 Left 1002290562 5:178197818-178197840 CCAAACACTGTGTAGGACTGGGT No data
Right 1002290569 5:178197866-178197888 GCTGCTAGGGAGGTTGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002290569 Original CRISPR GCTGCTAGGGAGGTTGAAGC GGG Intergenic
No off target data available for this crispr