ID: 1002291975

View in Genome Browser
Species Human (GRCh38)
Location 5:178206168-178206190
Sequence ATGAAAATACAGATTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1286
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 1208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002291966_1002291975 13 Left 1002291966 5:178206132-178206154 CCCAAAGCCGGAGGTTATGTTCC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG 0: 1
1: 0
2: 5
3: 72
4: 1208
1002291967_1002291975 12 Left 1002291967 5:178206133-178206155 CCAAAGCCGGAGGTTATGTTCCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG 0: 1
1: 0
2: 5
3: 72
4: 1208
1002291969_1002291975 6 Left 1002291969 5:178206139-178206161 CCGGAGGTTATGTTCCGGTTTTT 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG 0: 1
1: 0
2: 5
3: 72
4: 1208
1002291973_1002291975 -8 Left 1002291973 5:178206153-178206175 CCGGTTTTTGAGGGGATGAAAAT 0: 1
1: 0
2: 0
3: 28
4: 245
Right 1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG 0: 1
1: 0
2: 5
3: 72
4: 1208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002291975 Original CRISPR ATGAAAATACAGATTAAGCT GGG Intronic
900783047 1:4630327-4630349 ATAACAGTACAGACTAAGCTGGG + Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901285648 1:8076582-8076604 CTAAAAATACAGAATTAGCTGGG + Intergenic
901486545 1:9566865-9566887 ATAAAAATACAAAATTAGCTGGG + Intronic
901977446 1:13006442-13006464 ATAAAAATACAAAATTAGCTGGG - Intronic
902004638 1:13222493-13222515 ATAAAAATACAAAATTAGCTGGG + Intergenic
902103365 1:14012517-14012539 TTAAAAATACATATTAGGCTGGG + Intergenic
902159874 1:14521164-14521186 ATGCAAATAAAGATCAGGCTTGG + Intergenic
902342545 1:15793537-15793559 ATAAAAATACAAAATTAGCTGGG + Intergenic
902887676 1:19417973-19417995 ATGAAAACACAAAATTAGCTGGG + Intronic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
903089482 1:20898889-20898911 CTAAAAATACAAAATAAGCTGGG - Intronic
903116415 1:21182128-21182150 CTGAAAATACAAAATTAGCTGGG - Intergenic
903347568 1:22697102-22697124 ATAAAAATACAAAATTAGCTGGG - Intergenic
903489103 1:23714370-23714392 CTAAAAATACAAAATAAGCTGGG + Intergenic
904113116 1:28142196-28142218 ATAAAAATACAAAATTAGCTGGG + Intergenic
904142786 1:28367099-28367121 ATGAAAATAAAGATAAAACCGGG - Intergenic
904166495 1:28559465-28559487 CTGAAAATACAAAATTAGCTGGG + Intronic
904198484 1:28803721-28803743 ATGGAAAGACAGAATAAGCCTGG - Intergenic
904791833 1:33028340-33028362 CTGAAAATACAAAATTAGCTGGG + Intronic
904793002 1:33037674-33037696 CTGAAAATACAAAATTAGCTGGG + Intronic
905129261 1:35740712-35740734 AAGAAAATACAGTATAGGCTGGG - Intronic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905397051 1:37673607-37673629 ATAAAAATAAAAAATAAGCTGGG - Intergenic
905411113 1:37768692-37768714 AAGAAAATACAGTTTAGGCCAGG - Intergenic
905624851 1:39482632-39482654 CTAAAAATACAGAATTAGCTGGG + Intronic
905788376 1:40776028-40776050 AAGAAAATACATCTAAAGCTTGG + Intergenic
906030137 1:42712849-42712871 CTAAAAATACAGAATTAGCTGGG - Intergenic
906101260 1:43264658-43264680 ATGAAAAAACTGGTTAGGCTGGG - Intronic
906454059 1:45978216-45978238 ATGAAAATGCAAAAGAAGCTGGG + Intronic
906780312 1:48567462-48567484 ATGTTAATACAGAATAATCTAGG + Intronic
906881134 1:49592407-49592429 CTGAAAATACAAAATTAGCTGGG + Intronic
906980667 1:50625060-50625082 ATTAAAATACAAAATTAGCTGGG - Intronic
906984609 1:50669958-50669980 ATAAAAATACAAAATAAGCCAGG + Intronic
907182365 1:52582138-52582160 ATCAAAAGACAGATTAATCCTGG + Intergenic
908223416 1:62032181-62032203 AAGAAAATAGAGAATAAGCCTGG - Intronic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908299655 1:62751585-62751607 ATAAAAATATATATAAAGCTAGG - Intergenic
908423744 1:63984713-63984735 ATGAAAATACATATTGAGTCAGG - Intronic
908447539 1:64215068-64215090 ACTAAAATACAGAATTAGCTGGG + Intronic
908521800 1:64951268-64951290 ATGAAAATACTGCTTATGCTAGG - Intronic
908869314 1:68590231-68590253 AGGAAAATAGCAATTAAGCTGGG - Intergenic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
909653117 1:77997946-77997968 GTGAAAATACAAAATTAGCTGGG - Intronic
909925151 1:81430052-81430074 CTGAAAATACAAAATAAGCCAGG - Intronic
910142717 1:84043992-84044014 CTGAAAATACAAAATTAGCTGGG + Intergenic
910415997 1:86999337-86999359 CTGAAAATACAAAATTAGCTGGG - Intronic
910537112 1:88310885-88310907 ATCCAAATAGAGATTAAGATTGG - Intergenic
910896539 1:92075877-92075899 CTGAAAATACAAAATTAGCTGGG - Intergenic
911501110 1:98685625-98685647 CTTAAAATACAGATTATACTAGG - Intronic
911603509 1:99873593-99873615 CTAAAAATACAGAATTAGCTGGG - Intronic
912364140 1:109119056-109119078 ATAAAAATACAAAATTAGCTGGG - Intronic
912924527 1:113902324-113902346 ATGAAAAGTCAAATTAGGCTGGG - Intronic
912998424 1:114554913-114554935 ATGAAAATACAGAGAAAGATGGG + Intergenic
913143423 1:115964993-115965015 CTAAAAATACAAATTTAGCTGGG + Intergenic
913201676 1:116499658-116499680 GTGAAAATACAAAATTAGCTGGG - Intergenic
913798513 1:122660711-122660733 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
913844669 1:123488720-123488742 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
913859838 1:123761828-123761850 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
913869783 1:123940085-123940107 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
913890811 1:124316414-124316436 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
913908143 1:124627255-124627277 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
914719490 1:150277934-150277956 GTAAAAATACAGAATTAGCTGGG + Intronic
914760952 1:150597800-150597822 CTGAAAATACAAAATTAGCTGGG + Intergenic
915060846 1:153183246-153183268 CTGAAAATACAAAATTAGCTGGG - Intergenic
915171295 1:153979385-153979407 CTAAAAATACAGAATTAGCTGGG + Intergenic
915179597 1:154046895-154046917 CTGAAAATACAAAATTAGCTGGG + Intronic
915385375 1:155487002-155487024 ATGAAAATACAAAATTAGCCGGG + Intronic
915959069 1:160249027-160249049 ATTAAAATACAAAATTAGCTGGG + Intronic
916081786 1:161237984-161238006 AATAAAATACAGATAATGCTGGG - Intronic
916173645 1:162020685-162020707 CTGAAAATACAAAATTAGCTGGG - Intronic
916347580 1:163811303-163811325 CTAAAAATACAAAATAAGCTGGG + Intergenic
916740635 1:167644316-167644338 CTGAAAATACAAAATTAGCTGGG + Intronic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917443345 1:175085711-175085733 CTAAAAATACAAAATAAGCTGGG + Intronic
917884759 1:179372842-179372864 ATAAAAATACAAAATTAGCTGGG - Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919029492 1:192222411-192222433 ATGAAAATACATAGTAATCTTGG - Intergenic
919217657 1:194580339-194580361 CTGAAAATACAAAATTAGCTGGG + Intergenic
919644968 1:200086462-200086484 ATAAAAATACAAAATTAGCTGGG - Intronic
919842055 1:201616646-201616668 CTGAAAATACAAAATTAGCTGGG - Intergenic
920042219 1:203107851-203107873 TTGAAACTACAGATTAATATAGG + Intronic
920329760 1:205198030-205198052 TTAAAAATACAGAATTAGCTGGG + Intronic
920384816 1:205563658-205563680 CTGAAAATACAAAATTAGCTAGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
920880458 1:209875677-209875699 AGGAAAACACAGTTCAAGCTGGG - Intergenic
920940687 1:210479131-210479153 ATGAAGTTACAGAATAATCTGGG - Intronic
921223582 1:212994118-212994140 CTGAAAATACAAAATTAGCTGGG + Exonic
921744385 1:218721775-218721797 TTGAAAATACATATTATGTTTGG - Intergenic
922183233 1:223252628-223252650 ATGAAAATACAGACTGATGTAGG + Intronic
922359372 1:224807530-224807552 TTGAAAATACAAAATAAGCCTGG - Intergenic
922418577 1:225443982-225444004 CTAAAAATACAGAATTAGCTTGG - Intergenic
922883583 1:229001040-229001062 CTGAAAATAAAAATTTAGCTGGG + Intergenic
923397913 1:233585180-233585202 ATTAAAATAAAGATTAAAATGGG + Intergenic
924111800 1:240707343-240707365 ATAAAAATACAAAATTAGCTGGG - Intergenic
924555797 1:245117582-245117604 CTAAAAATACAGAATTAGCTGGG - Intronic
924675409 1:246171712-246171734 ATAAAAATACAGTATAAGGTTGG + Intronic
924782677 1:247167096-247167118 ATAAAAATACACAATAAACTAGG + Intronic
924838302 1:247677941-247677963 ATAAAAATACAAAATTAGCTGGG + Intergenic
1063265778 10:4448928-4448950 CTAAAAATACAAATTTAGCTGGG + Intergenic
1063332123 10:5170361-5170383 ATTAAAAGACAGATTATGGTAGG + Intergenic
1063586901 10:7360304-7360326 ACGAAAATACAAAATTAGCTAGG + Intronic
1063641650 10:7836433-7836455 CTGAAAATACAAAATTAGCTGGG - Intronic
1063644300 10:7863447-7863469 CTGAAAATACAAAATTAGCTGGG + Intronic
1063860285 10:10299826-10299848 ATAAAAATACAAAATTAGCTGGG - Intergenic
1063938099 10:11099903-11099925 CAGAAAAAACAGCTTAAGCTGGG + Intronic
1064079683 10:12298461-12298483 GTGAAAATACAAAATTAGCTGGG - Intergenic
1064080348 10:12303092-12303114 ATGAAAATAAAAAATTAGCTGGG + Intergenic
1064186482 10:13166472-13166494 CTGAAAATACAAAATTAGCTGGG + Intronic
1064408089 10:15082123-15082145 CTGAAAATACAAAATTAGCTGGG + Intronic
1064435659 10:15308973-15308995 ATGGAAATACTGATTAAAATAGG - Intronic
1064728400 10:18304249-18304271 ATGAAAACACTGATTAGGCCGGG - Intronic
1064880914 10:20052756-20052778 AAGAAAAGAAAGATTTAGCTAGG + Intronic
1064999889 10:21328856-21328878 CTGAAAATACAAAATTAGCTGGG - Intergenic
1065029447 10:21570068-21570090 CTGAAAATACAAAATTAGCTGGG - Intronic
1065217739 10:23466370-23466392 ATTAAAATAAAGAATTAGCTGGG - Intergenic
1065303637 10:24348190-24348212 CTGAAAATACAAAATTAGCTGGG + Intronic
1065467008 10:26035112-26035134 AGGAAGAAACAGATAAAGCTGGG + Intronic
1065504360 10:26414564-26414586 CTGAAAATACAAAATTAGCTGGG + Intergenic
1065568996 10:27048800-27048822 AGGAAAATAAAGAGTATGCTAGG - Exonic
1065620620 10:27577259-27577281 CTGAAAATACAAAATTAGCTGGG + Intergenic
1065764776 10:29018157-29018179 ATAAAAATACAAAATTAGCTGGG + Intergenic
1065958453 10:30713788-30713810 CTGAAAATACAAAATTAGCTGGG - Intergenic
1065994670 10:31046635-31046657 AGGAAAATACAAAATTAGCTGGG + Intergenic
1066320517 10:34298781-34298803 AATAAAATACAGATTAAGGATGG + Intronic
1066872876 10:40547292-40547314 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1066910118 10:41281934-41281956 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1066982116 10:42426545-42426567 ATGAAAATACAGACTCAGGCTGG + Intergenic
1067065025 10:43099348-43099370 AAGAAAATACAAAATTAGCTGGG + Intronic
1067096962 10:43307732-43307754 CTGAAAATACAAAATTAGCTGGG + Intergenic
1067202167 10:44182486-44182508 CTAAAAATACAGAATTAGCTGGG + Intergenic
1067557090 10:47279920-47279942 ATGAAAATTAAGAATAACCTGGG - Intergenic
1068229074 10:54147306-54147328 ATGAAAATAAATGTGAAGCTAGG + Intronic
1068273071 10:54755091-54755113 CTGAAAATACAAAATAAGCCAGG - Intronic
1068570845 10:58626941-58626963 ATAAAAATACAAAGTTAGCTGGG + Intronic
1068876745 10:62005155-62005177 ATGAAAATACACATTCTGCTGGG + Intronic
1069013143 10:63397372-63397394 CTGAAAATACAAAATAAGCCGGG - Intronic
1069236313 10:66079456-66079478 AAGAAAATACATATAAAACTAGG - Intronic
1069270805 10:66524886-66524908 CTGAAAATACAAAATTAGCTGGG + Intronic
1069946578 10:71990522-71990544 ATAAAAATACAAAATTAGCTGGG - Intronic
1069959496 10:72071348-72071370 CTGAAAATACAAAATTAGCTGGG - Intronic
1069983624 10:72269239-72269261 CTCAAAATACAAAATAAGCTGGG + Intergenic
1069999907 10:72368569-72368591 ATGAAAATACAGTATATGCCAGG + Intronic
1070049207 10:72870575-72870597 AAGAAAATATAGGTAAAGCTGGG - Intronic
1070178174 10:73990259-73990281 CTGAAAATACAAAATTAGCTGGG - Intergenic
1070293198 10:75135289-75135311 CTAAAAATACAAATTTAGCTGGG + Intronic
1070393820 10:75994148-75994170 ATGAAAATACAAATATTGCTGGG - Intronic
1071050896 10:81448097-81448119 CTAAAAATACAAAATAAGCTGGG - Intergenic
1071548699 10:86549163-86549185 CTGAAAATACAAAATTAGCTGGG - Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1072458007 10:95593424-95593446 ATAAAAATACAAAATTAGCTGGG + Intergenic
1072536942 10:96371158-96371180 CTGAAAATACAAAATTAGCTAGG + Intronic
1072604401 10:96967290-96967312 ATGAAAATACAAAATTAGCTGGG - Intronic
1072668257 10:97410257-97410279 CTAAAAATACAAAATAAGCTAGG + Intronic
1072699070 10:97626916-97626938 CTGAAAATACAAAATTAGCTGGG - Intronic
1072926889 10:99623595-99623617 ATCAAAATACTGCTGAAGCTAGG - Intergenic
1073172189 10:101519832-101519854 CTAAAAATACAGAATTAGCTGGG + Intronic
1073195296 10:101685796-101685818 ATCAAAATACCTATTATGCTAGG - Intronic
1073202377 10:101746214-101746236 CTGAAAATACAAAATTAGCTGGG - Intergenic
1073244739 10:102081771-102081793 CTGAAAATACAAAATTAGCTGGG - Intergenic
1073538218 10:104296938-104296960 CTGAAAATACAAAATTAGCTGGG - Intronic
1073672283 10:105605737-105605759 ATAAAAATAGAGCTGAAGCTAGG - Intergenic
1073781490 10:106843590-106843612 ATACAAAAACAGAATAAGCTGGG - Intronic
1074398083 10:113116538-113116560 ATGAAAGTACAGATTAAGCCTGG + Intronic
1074530908 10:114298080-114298102 AAAAAAATACAGTTCAAGCTGGG + Intronic
1074566916 10:114588106-114588128 ATGAAAACCCTGGTTAAGCTAGG - Intronic
1074569130 10:114608506-114608528 CTGAAAATACAAAATTAGCTGGG + Intronic
1074912757 10:117926497-117926519 AGGAAAATACAGAATAAGAATGG + Intergenic
1075246175 10:120823972-120823994 ATAAAAATACAAAATTAGCTGGG - Intergenic
1075250995 10:120873258-120873280 ATGAAAACACAGATTTAGTGTGG + Intronic
1075866949 10:125731192-125731214 AGGAAAACAAAGAATAAGCTTGG + Intronic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1076391118 10:130103137-130103159 CTAAAAATACAGAATTAGCTGGG - Intergenic
1077070597 11:669473-669495 CTGAAAATACAAAATTAGCTGGG + Intronic
1077120724 11:906865-906887 CTGAAAATACAAAATTAGCTGGG + Intronic
1077813629 11:5664038-5664060 CTGAAAATACAAATTTAGCCAGG + Exonic
1078061507 11:8048560-8048582 AAGAAAACAAAGATTTAGCTGGG - Intronic
1078234686 11:9473228-9473250 ATAAAAATACAAAATTAGCTGGG + Intronic
1079112935 11:17615765-17615787 CTAAAAATACAAAATAAGCTGGG + Intronic
1079563057 11:21847089-21847111 ATTAAAATACAGGTTAAGCTTGG - Intergenic
1079791870 11:24748618-24748640 CTGAAAATACAAAATTAGCTGGG - Intronic
1080010142 11:27450625-27450647 ATAAAAATACAAAATTAGCTGGG + Intronic
1080625207 11:34022898-34022920 ATCAAAATACAAAATTAGCTGGG + Intergenic
1080999690 11:37653593-37653615 ATGAAAGTACAGATAACTCTTGG - Intergenic
1081093242 11:38899355-38899377 ATGTAAAAACATTTTAAGCTTGG - Intergenic
1081093250 11:38899502-38899524 ATGTAGAAACATATTAAGCTTGG - Intergenic
1081192881 11:40126178-40126200 ATGAAAATGCAGAGTCAGGTGGG - Intronic
1081687715 11:45054276-45054298 ATGCAAATACAGCTTATGCATGG + Intergenic
1081721656 11:45294014-45294036 CTGAAAATACAAAATTAGCTGGG - Intergenic
1081722303 11:45299315-45299337 ATAAAAATACAAAATTAGCTGGG - Intergenic
1081908396 11:46683799-46683821 CTGAAAATACAAAATTAGCTGGG - Intronic
1081976925 11:47241354-47241376 CTGAAAATACAAAATCAGCTGGG + Intronic
1082061965 11:47868500-47868522 ATAAAAATACAAAATTAGCTGGG + Intergenic
1082863243 11:57874752-57874774 CTGAAAATACAAAATTAGCTGGG + Intergenic
1083392179 11:62360933-62360955 ATGAAAAGAATGATTAGGCTTGG - Intronic
1083439910 11:62669214-62669236 TTGAAAGTACAGATTAAGGCTGG - Intronic
1084081309 11:66827209-66827231 CTGAAAATACAAAATTAGCTGGG - Intronic
1084135701 11:67179432-67179454 CTAAAAATACAAAATAAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084762287 11:71281586-71281608 CTGAAAATACAAAATTAGCTGGG - Intergenic
1084842944 11:71872427-71872449 ATGAGATTACAGATTGAGCTAGG - Intronic
1084906997 11:72356121-72356143 AAAAAAATACAAATTTAGCTGGG + Intronic
1084950898 11:72664965-72664987 CTAAAAATACAGAATTAGCTGGG - Intronic
1084983565 11:72847519-72847541 ATGAAAACTAAGATTAAGTTTGG + Intronic
1085189694 11:74608274-74608296 ATAAAAATAAAAAATAAGCTGGG - Intronic
1085639114 11:78180363-78180385 ATTAAAAAACACATAAAGCTGGG + Intronic
1085880127 11:80457430-80457452 AGGAAAACACAGGTCAAGCTGGG - Intergenic
1085991564 11:81852978-81853000 AAGAAAATGCACATGAAGCTGGG + Intergenic
1086110193 11:83191183-83191205 ATAACAATACAGATTAAGTTGGG + Intergenic
1086194597 11:84122157-84122179 CTGAAAATACAAATTTAGTTGGG + Intronic
1086340869 11:85846893-85846915 CTGAAAATACAAAATTAGCTGGG - Intergenic
1086347405 11:85911008-85911030 ATAAAAATACAAAATTAGCTGGG + Intronic
1086436223 11:86783540-86783562 GGGAAAATACAGATGCAGCTTGG - Intergenic
1087340034 11:96892816-96892838 CTAAAAATACAAAATAAGCTGGG + Intergenic
1087355656 11:97090705-97090727 GTGAAAAAACAAATTAAGATTGG + Intergenic
1087478073 11:98662724-98662746 CTGAAAATACAAAATTAGCTGGG + Intergenic
1087760470 11:102099668-102099690 CTGAAAATACAAAATTAGCTGGG + Intergenic
1087760730 11:102101897-102101919 CTGAAAATACAAAATTAGCTTGG + Intergenic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1087876552 11:103365198-103365220 CTGAAAATACAAAATTAGCTGGG + Intronic
1088166433 11:106943908-106943930 ATAAAAAAACAGGTTAGGCTGGG + Intronic
1088520465 11:110692846-110692868 ATGAAAATCCAGGTTGACCTTGG + Intronic
1088554577 11:111048866-111048888 ATAAAAATACAAAATTAGCTGGG - Intergenic
1088587721 11:111374533-111374555 ATGAAAATGCAAAATTAGCTGGG + Intronic
1088823987 11:113478310-113478332 CTGAAAATACAAAATTAGCTGGG - Intergenic
1089040960 11:115449313-115449335 ATGAAAATAATGATTGTGCTTGG + Intronic
1089398075 11:118148758-118148780 GTGAAAATACAGATCAATGTGGG - Intronic
1089429909 11:118414338-118414360 ATTAAAACACAGATTGTGCTAGG - Intronic
1089592947 11:119556479-119556501 ACAAAAAAAAAGATTAAGCTGGG + Intergenic
1089663170 11:119998942-119998964 CTGAAAATACAAAATTAGCTGGG - Intergenic
1089717126 11:120371325-120371347 CTAAAAATACAGAATTAGCTGGG + Intronic
1090008500 11:123024069-123024091 CTGAAAATACAAAATTAGCTAGG + Intergenic
1090016381 11:123089935-123089957 TTGAAAATACAAAATTAGCTGGG + Intronic
1090370263 11:126245833-126245855 ATAAAAATACATAATTAGCTGGG + Intronic
1090477204 11:127034130-127034152 ATGAAAATACAGAGTAGGGTGGG - Intergenic
1090548229 11:127789574-127789596 CTGAAAATACAAAATTAGCTGGG + Intergenic
1090588020 11:128235143-128235165 ATGAGGAAACAGATAAAGCTGGG + Intergenic
1091276070 11:134351504-134351526 CTGAAAATACAAAATTAGCTGGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092297492 12:7212124-7212146 ATAAAAATACAAAATTAGCTGGG - Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1093094870 12:14960662-14960684 CTGAAAATACAAAATTAGCTGGG - Intronic
1093144928 12:15554031-15554053 CTGAAAATACAAAATTAGCTGGG + Intronic
1093504909 12:19853848-19853870 ATAAAAACACAGGTTAGGCTGGG - Intergenic
1094151392 12:27288041-27288063 CTAAAAATACAGAATTAGCTGGG - Intronic
1094340458 12:29405478-29405500 ATAAAAATACATATAAACCTAGG + Intergenic
1094625509 12:32119708-32119730 TTAAAAATACAGAATTAGCTGGG + Intronic
1094881992 12:34797975-34797997 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1094882912 12:34815467-34815489 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1095001024 12:36734876-36734898 ATGAAAAGAAAGCTTAAACTCGG - Intergenic
1095140295 12:38654352-38654374 CTGAAAATACAAAATTAGCTGGG + Intronic
1095448735 12:42307431-42307453 AAGAAAATAAAGATTCAGCCTGG - Intronic
1095462340 12:42456094-42456116 CTAAAAATACAAAATAAGCTGGG + Intronic
1095880108 12:47126195-47126217 ATAAAAACTCACATTAAGCTAGG - Intronic
1096136005 12:49201615-49201637 AACAAAATAGAGAATAAGCTTGG + Intronic
1096169667 12:49457592-49457614 CTAAAAATACAGAATTAGCTGGG - Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1096409549 12:51367100-51367122 CTGAAAATACAAAATTAGCTGGG + Intronic
1096471671 12:51881523-51881545 ATTAAAATACAAAATTAGCTGGG + Intergenic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097109584 12:56648284-56648306 CTGAAAATACAAAATTAGCTGGG + Intergenic
1097725310 12:63069013-63069035 AGGAAAATACTGAATAAGCTGGG + Intergenic
1098132927 12:67369233-67369255 CTGAAAATACAAAATTAGCTGGG + Intergenic
1098417155 12:70247315-70247337 CTGAAAATACAAAATTAGCTGGG - Intronic
1098918399 12:76280358-76280380 AGGAAAATACAGTTTAACCAAGG + Intergenic
1099127390 12:78779924-78779946 ATAAAAATACAAAATTAGCTGGG - Intergenic
1099349992 12:81554436-81554458 AAGAAAATAAAGATTTAGGTAGG - Intronic
1099405821 12:82260896-82260918 ATGAAATTACAGATTAATAGCGG - Intronic
1099445134 12:82743145-82743167 ATGAAAAAGCAGATGTAGCTGGG + Intronic
1099707210 12:86171206-86171228 CTAAAAATACAAAATAAGCTGGG + Intronic
1100019718 12:90054855-90054877 AGGAAATTAAAGTTTAAGCTAGG - Intergenic
1100249593 12:92804713-92804735 ATGAAAATACATTGTAAGATGGG + Intronic
1100474012 12:94919023-94919045 CTAAAAATACAAAATAAGCTGGG - Intronic
1100487863 12:95048551-95048573 ATCAAGATACTGAATAAGCTGGG - Intronic
1100584144 12:95963866-95963888 ATTAAAATACAAATTTAGCTGGG + Intronic
1101106260 12:101443622-101443644 ATAAAAATACAAAATTAGCTGGG - Intergenic
1101160149 12:101965063-101965085 CTAAAAATACAAATTTAGCTAGG + Intronic
1101162879 12:101997061-101997083 CTGAAAATACAAAATAAGCCGGG - Intronic
1101259777 12:103016986-103017008 TTGAAAATAAAGATTGAGCTGGG - Intergenic
1101466566 12:104956096-104956118 ATGAAAATACCAATTAAGGGTGG + Intronic
1101497618 12:105270343-105270365 AGGAAAATAGAGATTCAGCGTGG - Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101670958 12:106872505-106872527 CTGAAAATACAAATTTAGCCGGG + Intronic
1102073910 12:110044810-110044832 TTGAAAATACAAAATTAGCTGGG + Intronic
1102334308 12:112064871-112064893 CTAAAAATACAGAATTAGCTGGG + Intronic
1102464960 12:113124055-113124077 ATGAAAATACAAAAAAAGTTAGG + Intronic
1102603676 12:114052567-114052589 AGGAAAATACACAATAAGGTAGG + Intergenic
1102860843 12:116335256-116335278 CTAAAAATACAAATTTAGCTGGG - Intergenic
1103317745 12:120070681-120070703 ATCAAGATACAGATTAAAATGGG + Intronic
1103355449 12:120316481-120316503 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103391918 12:120580665-120580687 ATGTAAATACAGGATGAGCTAGG - Intronic
1103498382 12:121380896-121380918 CTGAAAATACAAATTCAGCCAGG - Intronic
1103777130 12:123374415-123374437 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103813779 12:123636754-123636776 CTGAAAATACAAAATTAGCTGGG + Intronic
1104023645 12:125010613-125010635 CTGAAAATACAAAATTAGCTGGG + Intronic
1104431017 12:128716256-128716278 AAAAAAATTCAGATTAAGTTAGG + Intergenic
1105058791 12:133129338-133129360 CTAAAAATACAGAATTAGCTGGG + Intronic
1105381820 13:19894504-19894526 CTGAAAATACAAAATTAGCTGGG - Intergenic
1105756938 13:23474599-23474621 CTAAAAATACAGAATTAGCTGGG + Intergenic
1106047476 13:26156937-26156959 ATTAAAAAATAAATTAAGCTGGG + Intronic
1106330806 13:28737833-28737855 ATGAAAATAGAGGCTAGGCTAGG + Intergenic
1106369751 13:29120477-29120499 ATGAAAATAGAAAGTAATCTAGG - Intronic
1106976457 13:35222968-35222990 ATAAAAATACAGAATTATCTGGG + Intronic
1107075002 13:36314146-36314168 ATGAACATGCAGATTAACCCTGG + Intronic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1107521033 13:41181553-41181575 CTGAAAATACAAAATTAGCTGGG + Intergenic
1107945410 13:45413713-45413735 ATTAAAATACAAAATTAGCTGGG - Intronic
1107982949 13:45750885-45750907 ATAAAAATACAGTTTATCCTGGG - Intergenic
1108082624 13:46752511-46752533 ATTAAAATACATTTTAAGTTAGG - Intronic
1108171204 13:47744017-47744039 ATAAAAATACAGAAATAGCTGGG + Intergenic
1108205677 13:48087202-48087224 CTGAAAATACAAAATTAGCTGGG + Intronic
1108211097 13:48140696-48140718 CTGAAAATACAAAATTAGCTGGG + Intergenic
1108374691 13:49803134-49803156 CTGAAAATACAAAATTAGCTGGG - Intergenic
1108414852 13:50187177-50187199 ATGAAATTGTAGGTTAAGCTGGG + Intronic
1109341147 13:61060575-61060597 ATGAAAATACAGGTCAGGCACGG - Intergenic
1109588210 13:64438375-64438397 ATGAAAAGTCAGATAAAACTAGG - Intergenic
1109838080 13:67885518-67885540 ATGTAATTACACATTAAGGTAGG + Intergenic
1110111279 13:71749143-71749165 CTGAAAATACAAAATTAGCTGGG - Intronic
1110194375 13:72769841-72769863 CAGAAAAAACAGGTTAAGCTTGG + Intronic
1110283036 13:73717923-73717945 ATGAAAATAAATATTGATCTTGG + Intronic
1110370675 13:74736902-74736924 ATGCACATACAGATTAAGAATGG - Intergenic
1110429944 13:75412199-75412221 ATGATAATCCAGTTTAAGTTAGG + Intronic
1110944707 13:81397625-81397647 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111183566 13:84699563-84699585 ATAAAAATACAAAATTAGCTGGG + Intergenic
1111561195 13:89949675-89949697 ATAAAAATACAAAATTAGCTAGG - Intergenic
1111591256 13:90350199-90350221 CTGAAAATACAAAATTAGCTGGG + Intergenic
1111591544 13:90353818-90353840 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111696833 13:91635149-91635171 ATTAAAATAGAAATTAAGGTTGG - Intronic
1111901040 13:94199993-94200015 CTGAACATACAAATTTAGCTGGG + Intronic
1112145326 13:96693463-96693485 ATAAAAATACAAAATTAGCTGGG - Intronic
1112190063 13:97168124-97168146 CTGAAAATACAAAATTAGCTGGG - Intergenic
1112335779 13:98514453-98514475 ATGAAAGTACAGGTTATTCTGGG - Intronic
1112697595 13:101968376-101968398 AAAAAAATACAGCTTAGGCTGGG + Intronic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1113000608 13:105631368-105631390 ATTAAAATACAAAATTAGCTGGG + Intergenic
1113141597 13:107158262-107158284 CTAAAAATACAGAATTAGCTGGG + Intergenic
1113143514 13:107181648-107181670 ATTAAAATAGCGATTAAGCATGG - Intronic
1113491302 13:110694185-110694207 CTAAAAATACAGAATTAGCTGGG - Intronic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1113939642 13:114011759-114011781 ATAAAAATACAAAATTAGCTGGG + Intronic
1114140522 14:19904468-19904490 ATCAAAGTACAGATAATGCTAGG + Intergenic
1114151935 14:20050702-20050724 GATAAAATACAGATTCAGCTAGG - Intergenic
1114310307 14:21460772-21460794 CTGAAAATACAAAATTAGCTGGG - Exonic
1114440581 14:22743548-22743570 CTGAAAATACAAAATTAGCTGGG - Intergenic
1114468716 14:22943654-22943676 ATAAAAATACAAAATTAGCTGGG + Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1115588131 14:34835830-34835852 CTGAAAATACAAAATTAGCTGGG - Intronic
1115844913 14:37518774-37518796 GGGAAAATACAGAGTAATCTGGG + Intronic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116108997 14:40551114-40551136 ATAAAAATACAAAATTAGCTGGG + Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117134136 14:52716590-52716612 CTGAAAATACAAAATTAGCTGGG + Intronic
1117345863 14:54831846-54831868 CTGAAAATACAAAATTAGCTGGG - Intergenic
1117356186 14:54925900-54925922 CTAAAAATACAAATTTAGCTGGG + Intergenic
1117407836 14:55421622-55421644 CTGAAAATACAAAATTAGCTGGG - Intronic
1117505764 14:56401350-56401372 ATAAAAATACAAAGTTAGCTGGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118125272 14:62895489-62895511 AAGAAAATACAAAATTAGCTGGG - Intronic
1118230667 14:63945783-63945805 GTAAAAATACAGAATTAGCTGGG - Intronic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1119473716 14:74914871-74914893 CTGAAAATACAAAATTAGCTGGG - Intronic
1119810469 14:77513732-77513754 CTGAAAATACAAAATTAGCTGGG + Intronic
1120267136 14:82265543-82265565 AAGAAGATACAGATTAAAATTGG + Intergenic
1120752660 14:88212277-88212299 CTAAAAATACAGAATTAGCTGGG + Intronic
1120795628 14:88630189-88630211 CTAAAAATACAGAATTAGCTAGG - Intronic
1120924931 14:89788322-89788344 CTAAAAATACAGAATTAGCTGGG + Intergenic
1120924956 14:89788456-89788478 CTAAAAATACAGAATTAGCTGGG + Intergenic
1121179405 14:91917281-91917303 ATGAAAAAACAAATTAGGCTGGG + Intronic
1121542573 14:94739659-94739681 ATAAAAATACAAAATTAGCTGGG - Intergenic
1121633048 14:95434816-95434838 CTGAAAATACAAAATTAGCTGGG - Intronic
1121910934 14:97791839-97791861 CTAAAAATACAGAATTAGCTGGG + Intergenic
1122359028 14:101147338-101147360 ATGAAAACACACAATAAACTAGG - Intergenic
1122518847 14:102328191-102328213 TTAAAAATACAAAATAAGCTGGG + Intronic
1122731347 14:103801009-103801031 CTAAAAATACAGAATTAGCTGGG - Intronic
1122750684 14:103930346-103930368 CTAAAAATACAAAATAAGCTGGG - Intronic
1122907702 14:104809722-104809744 CTGAAAATACAAAATTAGCTGGG - Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1123483718 15:20663509-20663531 AAGAAAATACATATTATGGTGGG + Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1123701558 15:22918040-22918062 ATGAAAATACAAATTACTCTGGG + Intronic
1123813574 15:23954066-23954088 TTGAAAATACAAAATTAGCTGGG + Intergenic
1124339010 15:28877790-28877812 ATGAAAATACAAAATTAGCCAGG + Intergenic
1124829945 15:33138552-33138574 ATGAAAATACAAAGTTTGCTAGG - Intronic
1124942502 15:34231199-34231221 CTGAAAATACAAAATTAGCTGGG + Intronic
1125151575 15:36538397-36538419 ATAAAAATACAAAATTAGCTGGG - Intergenic
1125209215 15:37192693-37192715 ATGAAAATACAAAATACGCTGGG - Intergenic
1125487290 15:40120928-40120950 ATTAAAACACAGATTGAGCTGGG - Intergenic
1125527403 15:40385954-40385976 ATGAAAATAAAGATTTGGCCAGG + Intronic
1125669161 15:41457370-41457392 ATAAAAATACAAAATTAGCTGGG + Intronic
1126120540 15:45247633-45247655 CTAAAAATACAAAATAAGCTGGG - Intergenic
1126401322 15:48273722-48273744 ATGAAAATTCAGACTTACCTAGG + Intronic
1126485106 15:49171241-49171263 ATGAAAATACAAAATTAGCCGGG - Intronic
1126650773 15:50919369-50919391 CTAAAAATACAGAATTAGCTGGG + Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1126768535 15:52032843-52032865 CTAAAAATACAGAATTAGCTGGG - Intronic
1126782800 15:52152789-52152811 ATAGAAATACAGAATCAGCTGGG - Intronic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127184089 15:56459827-56459849 CTAAAAATACAGAATTAGCTGGG + Intronic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1127446264 15:59066447-59066469 CTAAAAATACAAAATAAGCTGGG + Intronic
1127573856 15:60271525-60271547 CTGAAAATACAAAATTAGCTGGG - Intergenic
1128031161 15:64481479-64481501 CTAAAAATACAGAATTAGCTAGG - Intronic
1128066680 15:64769262-64769284 CTAAAAATACAGAATTAGCTGGG + Intronic
1128196525 15:65762166-65762188 CTGAAAATACAAAATTAGCTGGG - Intronic
1128204512 15:65838868-65838890 CTAAAAATACAGAATTAGCTAGG - Intronic
1128463149 15:67886647-67886669 ATAAAAATAAAAATTTAGCTGGG - Intergenic
1128945673 15:71818768-71818790 CTGAAAATACAAAATTAGCTGGG - Intergenic
1128993322 15:72278512-72278534 ATAAAAATACAAAGTTAGCTGGG - Intronic
1129005203 15:72367102-72367124 CTGAAAATACAAAATTAGCTGGG - Intronic
1129774312 15:78225102-78225124 TTTAAAATACAGTTTTAGCTAGG + Intronic
1129794678 15:78367101-78367123 TTGAAAATACACTTTCAGCTGGG - Intergenic
1130374409 15:83315453-83315475 ATCAAAATATAAATTAAACTGGG - Intergenic
1130404894 15:83589994-83590016 ATGAAAATGCAAATTAAGACTGG - Intronic
1131246713 15:90800517-90800539 CTAAAAATACAAAATAAGCTGGG + Intronic
1131416102 15:92259849-92259871 AGGAAAAAAAAGATTAAACTTGG - Intergenic
1131541201 15:93276837-93276859 ATAAAAATACAAAATGAGCTGGG + Intergenic
1131583373 15:93666866-93666888 ATAAAAATACAAAATTAGCTGGG - Intergenic
1132174170 15:99695696-99695718 CTAAAAATACAGAATTAGCTGGG + Intronic
1132489984 16:222789-222811 CTGAAAATACAAAATTAGCTGGG - Intronic
1132490350 16:225645-225667 ATTAAAATACAAAATTAGCTGGG - Intronic
1133068158 16:3225282-3225304 CTAAAAATACAAAATAAGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133472114 16:6085431-6085453 ATAAAAATACAAAATTAGCTGGG - Intronic
1133484231 16:6203069-6203091 AGGAAAATCAACATTAAGCTGGG - Intronic
1134064032 16:11215513-11215535 TTGAAAATACAAAATTAGCTGGG - Intergenic
1134148208 16:11784691-11784713 CTGAAAATACAAAATTAGCTGGG + Intronic
1134269166 16:12718665-12718687 CTGAAAATGCACATTCAGCTGGG + Intronic
1134281915 16:12824673-12824695 CTAAAAATACAAATTTAGCTGGG - Intergenic
1134318526 16:13141521-13141543 CTGAAAATACAAATTTAGCCAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135098340 16:19583559-19583581 TTAAAAATACACAATAAGCTGGG + Intronic
1135958482 16:26976387-26976409 CTAAAAATACAAATTTAGCTGGG + Intergenic
1135969992 16:27065394-27065416 CTGAAAATACAAAATTAGCTGGG + Intergenic
1136087168 16:27893738-27893760 ATGAAAATAAAAAATTAGCTGGG - Intronic
1136102332 16:28005272-28005294 CTAAAAATACAGAATTAGCTGGG - Intronic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1136280791 16:29210015-29210037 ATAATCATACAGATTAAGGTAGG - Intergenic
1137044640 16:35643798-35643820 CTGAAAATACAAAATTAGCTGGG - Intergenic
1137049613 16:35696709-35696731 ATGAAAATAAAAATTTAACTTGG - Intergenic
1137201646 16:38050144-38050166 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1137242333 16:46666427-46666449 CTGAAAATACAAAATTAGCTGGG - Intronic
1137989352 16:53137265-53137287 AGAAAAATACAGATTAGGCCAGG - Intronic
1138381133 16:56603394-56603416 ATGACAATACAAAATTAGCTGGG + Intergenic
1138453206 16:57106009-57106031 AAGAAACTACAGCTTAGGCTGGG - Intronic
1138493015 16:57387668-57387690 ATAAAAATACAAAATTAGCTGGG + Intergenic
1138665905 16:58568205-58568227 AAGAAAATACAAAATTAGCTGGG + Intronic
1138819032 16:60236003-60236025 ATGAAATTAAAGTTTAAGGTAGG + Intergenic
1139080952 16:63520209-63520231 ATTAAAATACAAAATTAGCTGGG + Intergenic
1139717345 16:68824156-68824178 CTGAAAATACAAAATTAGCTGGG - Intronic
1139736577 16:68994878-68994900 TTGAAAATACAAAATAAGCTGGG - Intronic
1139813261 16:69641737-69641759 TTTAAAATACAGTTTAAGCAAGG + Intronic
1139913272 16:70411831-70411853 CTGAAAATACAAAATTAGCTGGG + Intronic
1140510058 16:75500655-75500677 CTAAAAATACAAATTTAGCTGGG - Intergenic
1140520671 16:75578429-75578451 CTGAAAATACAAAATTAGCTGGG - Intergenic
1140727669 16:77828500-77828522 ATAAAAATACAAAATTAGCTGGG + Intronic
1140771579 16:78210102-78210124 ATGACAAAATAGATGAAGCTCGG - Intronic
1140943205 16:79742342-79742364 ATGAAAACACACAATAAACTAGG + Intergenic
1141045122 16:80709086-80709108 TTGAAAATACAAATTTAGCCAGG + Intronic
1141226176 16:82118117-82118139 AAGAAAATAAAGAGTAAACTAGG + Intergenic
1141334640 16:83142940-83142962 CTGAAAATACAAAATTAGCTGGG + Intronic
1141335563 16:83151799-83151821 CTAAAAATACAAATTTAGCTGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141592932 16:85080631-85080653 CTAAAAATACAAAATAAGCTGGG + Intronic
1142428380 16:90012618-90012640 CTAAAAATACAGAATTAGCTGGG - Intronic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1142479689 17:211442-211464 CTAAAAATACAGAATTAGCTGGG + Intergenic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142739064 17:1919947-1919969 CTGAAAATACAAAATTAGCTGGG + Intergenic
1142788707 17:2245975-2245997 ATAAAAATCCAGATTCAGCCAGG - Intronic
1142816769 17:2432570-2432592 ATAAAAAAAAAAATTAAGCTTGG + Intronic
1142969073 17:3599076-3599098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1143139007 17:4730198-4730220 CTAAAAATACAGAATTAGCTGGG - Intergenic
1143194999 17:5069344-5069366 CTGAAAATACAAAATTAGCTGGG - Intergenic
1143825177 17:9599900-9599922 CTGAAAATACAAAATTAGCTGGG - Intronic
1144075525 17:11716242-11716264 CTGAAAATACAAAATTAGCTGGG - Intronic
1144364008 17:14524639-14524661 ATGAAAATAAATATTATGTTTGG - Intergenic
1144567090 17:16368672-16368694 CTGAAAATACAAAATTAGCTGGG + Intergenic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1145038323 17:19556717-19556739 CTGAAAATACAAAATTAGCTGGG - Intronic
1145200854 17:20943434-20943456 ATGAAAACACAGATTAGGCCGGG - Intergenic
1145763491 17:27441732-27441754 CTAAAAATACAAAATAAGCTGGG + Intergenic
1145944706 17:28764585-28764607 CTGAAAATACAAAATTAGCTGGG + Intronic
1146151176 17:30474001-30474023 ATAAAAATACAAAATTAGCTGGG + Intergenic
1146391191 17:32424733-32424755 CTAAAAATACAGAATTAGCTGGG + Intergenic
1146422956 17:32706436-32706458 ATGAAAATACACTTAAAGCCAGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147287280 17:39412387-39412409 CTAAAAATACAGAATTAGCTGGG - Intronic
1147353815 17:39874726-39874748 ATTAAAATTAAGATTAGGCTGGG - Intronic
1147356238 17:39899821-39899843 CTAAAAATACAGAATTAGCTGGG - Intergenic
1147791560 17:43017001-43017023 CTGAAAATACAAAATTAGCTGGG + Intronic
1148064114 17:44856231-44856253 ATGAAAGTAAGGTTTAAGCTGGG + Intronic
1148293069 17:46473598-46473620 ATTAAAACAAAGATTAGGCTGGG + Intergenic
1148315253 17:46691297-46691319 ATTAAAACAAAGATTAGGCTGGG + Intronic
1148329860 17:46807319-46807341 CTGAAAATACAAAATTAGCTGGG + Intronic
1148509696 17:48158014-48158036 ATAAAAATACAAAATTAGCTGGG + Intronic
1148570476 17:48664291-48664313 CTGAAAATACAAAATTAGCTGGG - Intergenic
1148608750 17:48949775-48949797 CTAAAAATACAGAATTAGCTGGG - Intergenic
1148653625 17:49267403-49267425 CTGAAAATACAAAGTTAGCTGGG + Intergenic
1148723541 17:49772310-49772332 ATCAAAATCCAGTTCAAGCTGGG + Intronic
1148947318 17:51275034-51275056 CTGAAAATACAAAATTAGCTGGG + Intronic
1148994177 17:51694041-51694063 CTGAAAATACAAAATTAGCTAGG + Intronic
1149159933 17:53680394-53680416 ATAAAAATACAAAATTAGCTGGG - Intergenic
1149243446 17:54678112-54678134 ATAAAAATAAAAATTTAGCTAGG - Intergenic
1149365247 17:55937375-55937397 CTGAAAATACAAAATTAGCTGGG + Intergenic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1149824385 17:59814139-59814161 CTAAAAATACAGAATTAGCTGGG - Intronic
1149984135 17:61334502-61334524 CTGAAAATACAAAATTAGCTGGG + Intronic
1150340357 17:64361590-64361612 CTGAAAATACAAAATTAGCTGGG + Intronic
1150341130 17:64368548-64368570 ATGAAAATATATATAAACCTGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150536562 17:66048768-66048790 CTAAAAATACAGAATTAGCTGGG - Intronic
1150735355 17:67732322-67732344 AAGAAAATACAGAATTAGCCGGG + Intronic
1150913093 17:69409689-69409711 CTAAAAATACAAAATAAGCTGGG + Intergenic
1151252789 17:72850291-72850313 ATAAAAATAAAGAATTAGCTAGG + Intronic
1151273791 17:73017550-73017572 CTAAAAATACAAATTTAGCTGGG + Intronic
1151598928 17:75094523-75094545 CTGAAAATACAAAATTAGCTGGG + Intronic
1151612444 17:75185061-75185083 CTGAAAATACAAAATTAGCTGGG + Intergenic
1151621573 17:75248623-75248645 CTAAAAATACAGAATTAGCTGGG + Intronic
1151639607 17:75381430-75381452 ATGAAAATAAAGATACGGCTGGG + Intronic
1152441153 17:80310711-80310733 CTAAAAATACAGAATTAGCTGGG - Intronic
1152498503 17:80692480-80692502 CTGAAAATACAAAATTAGCTGGG - Intronic
1152620091 17:81358975-81358997 CTGAAAATACAAAATTAGCTGGG + Intergenic
1152689078 17:81709508-81709530 ATAAAAATACAAAATTAGCTGGG - Intergenic
1152991101 18:364620-364642 ATGAAAATGCAGCTCTAGCTTGG + Intronic
1153084899 18:1273820-1273842 AGGAAAGTACAGAGTGAGCTTGG - Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153585536 18:6616468-6616490 CTAAAAATACAAATTTAGCTGGG - Intergenic
1153671014 18:7412040-7412062 CTGAAAATACAAAATTAGCTGGG - Intergenic
1153685740 18:7542995-7543017 ATGAAAATACTTATTAAGTAAGG + Intergenic
1154040366 18:10849171-10849193 CTGAAAATACAAAATGAGCTGGG - Intronic
1154161370 18:11982631-11982653 CTGAAAATACAAAATTAGCTGGG + Intronic
1154222394 18:12467786-12467808 CTAAAAATACAAAATAAGCTGGG + Intronic
1154363079 18:13681318-13681340 ATGAGAAAACAGATTAGGCAAGG - Intronic
1155105087 18:22656011-22656033 CTGAAAATAGAGATTAAGTAAGG - Intergenic
1155261840 18:24050708-24050730 CTGAAAATACACAGTTAGCTGGG + Intronic
1155281332 18:24243066-24243088 CTGAAAATACAAAATAAGCCAGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1157692634 18:49696451-49696473 ATGAAAAAAGAGAATAAGATAGG - Intergenic
1158093625 18:53745224-53745246 ATGAAAATAATGGTTATGCTGGG + Intergenic
1158459537 18:57634094-57634116 CTAAAAATACAAAATAAGCTGGG - Intergenic
1158574473 18:58624613-58624635 CTGAAAATACAAAATTAGCTGGG - Intronic
1158619187 18:59016128-59016150 ATGAAAACACAGATCAAGAAGGG + Intergenic
1159687430 18:71440236-71440258 TTGAAAATAAAGATTAAAATTGG + Intergenic
1159767402 18:72507325-72507347 CTGAAAATACAAAATTAGCTGGG - Intergenic
1159974597 18:74694844-74694866 ATGAAAATACAGACTGAAATAGG - Intronic
1160032881 18:75278140-75278162 CTGAAAAGACAGAGTAAACTGGG - Intronic
1160978111 19:1803733-1803755 CTGAAAATACAAAATTAGCTGGG + Intronic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1161489030 19:4551666-4551688 CTAAAAATACAAAATAAGCTGGG + Intronic
1161810639 19:6469190-6469212 CTAAAAATACAGAATTAGCTGGG - Intronic
1161931498 19:7343590-7343612 CTGAAAATACAAAATTAGCTGGG + Intergenic
1162057014 19:8070859-8070881 CTAAAAATACAGAATTAGCTGGG + Intronic
1162077252 19:8196037-8196059 ATAAAAATAAAAATTAAGCCAGG - Intronic
1162353222 19:10164302-10164324 CTAAAAATACAGAATTAGCTGGG - Intronic
1162523749 19:11196217-11196239 CTAAAAATACAGAATTAGCTAGG - Intronic
1162529278 19:11226495-11226517 CTGAAAATACAAAATTAGCTGGG + Intronic
1162560228 19:11413372-11413394 ATAAAAATACAAAATTAGCTGGG + Intronic
1162603571 19:11689425-11689447 CTAAAAATACAGAATTAGCTGGG + Intergenic
1162882839 19:13672981-13673003 CTAAAAATACAGAATTAGCTGGG - Intergenic
1163099433 19:15085329-15085351 CTGAAAATACAAAATTAGCTAGG - Intergenic
1163269753 19:16245189-16245211 ATCAAAATGCAGATTTGGCTGGG - Intronic
1163607627 19:18283732-18283754 TTGAAAATAAAAATTAGGCTGGG + Intergenic
1163841060 19:19610250-19610272 CTGAAAATACAAAATTAGCTGGG + Intronic
1163948249 19:20560617-20560639 CTAAAAATACAGAATTAGCTGGG + Intronic
1164070307 19:21762015-21762037 GTGAAAATACAAAATCAGCTGGG + Intronic
1164103831 19:22085248-22085270 ATGAAAATACAAAATTAGCCAGG - Intronic
1164208776 19:23079316-23079338 CTAAAAATACAAAATAAGCTGGG - Intronic
1164313789 19:24069165-24069187 ATAAAAATACAAAATTAGCTGGG - Intronic
1164466445 19:28491102-28491124 CTGAAAATACAAAATTAGCTGGG + Intergenic
1165039094 19:33056271-33056293 CTGAAAATACAAAATTAGCTGGG - Intronic
1165484581 19:36087827-36087849 ATAAAAATAAAAAATAAGCTGGG + Intronic
1165505724 19:36227713-36227735 ATAAAAATACAAAATTAGCTGGG - Intronic
1165527467 19:36368305-36368327 CTAAAAATACAGAATTAGCTGGG + Intronic
1165650252 19:37481581-37481603 TTGAAAATACAGAATAACCAGGG - Intronic
1165891462 19:39114933-39114955 GTAAAAATACAAATTTAGCTGGG + Intergenic
1166006155 19:39908503-39908525 ATAAAAATAAAGAATAAGCCGGG - Intronic
1166012021 19:39949678-39949700 ATTAAAATAAAGCTTAAGCCAGG - Intergenic
1166034831 19:40160506-40160528 TTAAAAATACAAAATAAGCTGGG + Intergenic
1166079999 19:40437990-40438012 CTGAAAATACAAAATCAGCTGGG + Intergenic
1166443377 19:42835942-42835964 CTGAAAATACAAAATTAGCTGGG + Intronic
1166451047 19:42901025-42901047 CTGAAAATACAAAATTAGCTGGG + Intronic
1166463063 19:43006596-43006618 CTGAAAATACAAAATTAGCTGGG + Intronic
1166469205 19:43063151-43063173 CTGAAAATACAAAATTAGCTGGG + Intronic
1166480345 19:43166683-43166705 CTGAAAATACAAAATTAGCTGGG + Exonic
1166490157 19:43252228-43252250 CTGAAAATACAAAATTAGCTGGG + Intronic
1166527622 19:43522640-43522662 CTAAAAATACAAAATAAGCTGGG - Intronic
1166691475 19:44823847-44823869 ATAAAAATAAAAATTTAGCTGGG - Intergenic
1166776698 19:45317446-45317468 CTAAAAATACAGAATTAGCTGGG - Intronic
1166823481 19:45595113-45595135 CTAAAAATACAAAATAAGCTAGG + Intronic
1167270935 19:48505698-48505720 CTAAAAATACAAAATAAGCTGGG + Intronic
1167444592 19:49529915-49529937 ATAAAAATACAAAATTAGCTGGG - Intronic
1167517942 19:49934077-49934099 CTGAAAATACAAAATTAGCTGGG + Intronic
1167763775 19:51465709-51465731 CTAAAAATACAGAATTAGCTGGG + Intergenic
1167881244 19:52459926-52459948 ATAAAAATACAAAATTAGCTGGG - Intronic
1167911024 19:52701635-52701657 ATAAAAATACAAAATTAGCTAGG + Intergenic
1167919877 19:52774266-52774288 CTGAAAATACAAAATTAGCTGGG + Intronic
1167933290 19:52885743-52885765 ATAAAAATACAAAATTAGCTGGG + Intronic
1168037179 19:53729266-53729288 CTGAAAATACAAACTTAGCTAGG - Intergenic
1168052477 19:53839698-53839720 CTGAAAATACAAAATTAGCTGGG + Intergenic
1168054322 19:53853381-53853403 CTAAAAATACAGAATTAGCTGGG - Intergenic
1168225226 19:54989821-54989843 CTGAAAATACAAAATTAGCTGGG + Intronic
1168289372 19:55349964-55349986 CTAAAAATACAAAATAAGCTGGG + Exonic
1168333588 19:55584284-55584306 CTAAAAATACAAAATAAGCTGGG - Intergenic
1168375520 19:55875874-55875896 AAAAAAATACAGAATTAGCTGGG + Intronic
1168594697 19:57665754-57665776 CTAAAAATACAAAATAAGCTGGG + Intergenic
1168610747 19:57797666-57797688 CTGAAAATACAAAATCAGCTGGG + Intronic
1168711804 19:58505258-58505280 CTGAAAATACAAAATTAGCTGGG - Intronic
1168712032 19:58506768-58506790 CTGAAAATACAAAATTAGCTGGG - Intronic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
926607899 2:14915721-14915743 CTAAAAATACAAAATAAGCTGGG - Intergenic
926853279 2:17224609-17224631 AAGAAAATACAGAATGAACTTGG + Intergenic
926882595 2:17563567-17563589 AAAAAAATACAGTTTTAGCTGGG + Intronic
928531366 2:32195835-32195857 ATGAAAATATAAAGTAGGCTGGG - Intronic
928554968 2:32414128-32414150 CTGAAAATACAAAATTAGCTGGG + Intronic
928721805 2:34130033-34130055 ATAAAAATACAAAATTAGCTGGG - Intergenic
928979696 2:37125171-37125193 CTGAAAATACAAAATTAGCTGGG - Intronic
929343051 2:40846361-40846383 ATAAAAATACAAAATTAGCTGGG - Intergenic
929923291 2:46188857-46188879 ATAAAAATACAAAATTAGCTGGG + Intergenic
930214742 2:48683083-48683105 ATGTAAATACACACTAAGCCAGG + Intronic
931563892 2:63593253-63593275 CTAAAAATACAGAATTAGCTGGG - Intronic
931585108 2:63817493-63817515 CTGAAATTACACATTAAGGTAGG + Intronic
931838530 2:66125644-66125666 ATGATAACCCAGATTGAGCTGGG + Intergenic
932665881 2:73698627-73698649 CTGAAAATACAAAATTAGCTGGG - Intergenic
932938124 2:76130347-76130369 CTGAAAATACAAAATTAGCTGGG - Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933661438 2:84930669-84930691 ATGAAAATACAGGTCAGGCGCGG + Intergenic
934668153 2:96188434-96188456 CTGAAAATACAAAATTAGCTGGG - Intronic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
935102291 2:100008145-100008167 TTGAAAATTCAGATTTGGCTCGG + Intronic
935517046 2:104052757-104052779 ATGGAAAAAGAGATAAAGCTTGG + Intergenic
935950000 2:108320045-108320067 CTAAAAATACAAAGTAAGCTGGG + Intergenic
936437337 2:112519967-112519989 CTGAAAATACAAAATTAGCTGGG + Intronic
937418716 2:121737620-121737642 CTAAACATACAAATTAAGCTGGG - Intronic
937435039 2:121873410-121873432 CTGAAAATACAAAATTAGCTGGG - Intergenic
937923897 2:127153121-127153143 TTGAAAATACAAAATTAGCTTGG + Intergenic
939042004 2:137200962-137200984 ATCAAAATACAGGTTTTGCTGGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939916612 2:148052369-148052391 CTGAAAATACACAATTAGCTGGG - Intronic
940476917 2:154174300-154174322 ATGCAATTACAGTTTAAGCTGGG + Intronic
940519242 2:154722373-154722395 ATGAGATCACAGTTTAAGCTTGG + Intronic
940601045 2:155860764-155860786 ATAAAAATACAAAATTAGCTGGG + Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940854792 2:158721663-158721685 ATGAATATAGAGTTTAAGTTTGG + Intergenic
940881661 2:158953077-158953099 ATTAAAATACAAAATTAGCTGGG - Intergenic
941499529 2:166253541-166253563 TTTAAAATACAGATTAATCCAGG + Intronic
941689066 2:168479767-168479789 CTGAAAATACAAAATTAGCTGGG - Intronic
941903657 2:170700946-170700968 ATGAAATTACAGATACACCTTGG - Intergenic
941958757 2:171231883-171231905 GTGAAAATACAAAATTAGCTGGG + Intergenic
943181505 2:184548447-184548469 ATGATAATACACATTAAATTGGG + Intergenic
943223398 2:185139033-185139055 ATGCAAAAACAGAATTAGCTGGG - Intergenic
943342552 2:186697970-186697992 GTGAAAATAAAGACTAAGGTTGG + Intronic
943771991 2:191727973-191727995 AACAAAACACAGATTAAGCAGGG - Intergenic
943871899 2:193010485-193010507 ATTAAAATGCAAATTAAGTTTGG + Intergenic
944283126 2:197921619-197921641 ATGAAAATAGAGATTTTGGTGGG - Intronic
944293034 2:198029859-198029881 CTGAAAATACAAAATTAGCTGGG - Intronic
944597350 2:201273218-201273240 ATAAAAATACAAAATTAGCTAGG - Intronic
944664325 2:201947076-201947098 CTGAAAATACAAAATTAGCTGGG + Intergenic
944714307 2:202363239-202363261 ATAAAAATAGTGATTAGGCTGGG - Intergenic
945619291 2:212113107-212113129 ATGAAAATACAGATCGAATTTGG + Intronic
946222173 2:218237358-218237380 ATAAAAATACAAAATTAGCTGGG - Intronic
946223920 2:218252060-218252082 CTAAAAATACAGAATTAGCTAGG + Intronic
946246756 2:218392223-218392245 CTGAAAATACAAAATTAGCTGGG - Intronic
946320476 2:218951206-218951228 TTAAAAATACAAAATAAGCTGGG + Intergenic
946654934 2:221936297-221936319 AGGAGAATACAGAGTAGGCTTGG + Intergenic
946832787 2:223742923-223742945 CTAAAAATACAAATTTAGCTGGG - Intergenic
946894150 2:224305953-224305975 ATAAAAATACAAAATCAGCTGGG + Intergenic
947024820 2:225725536-225725558 ATGAAAATTCAAATACAGCTGGG - Intergenic
947166876 2:227271631-227271653 CTGAAAATACAAAATTAGCTGGG - Intronic
947221003 2:227792307-227792329 ATAAAAATAAAAATTTAGCTGGG - Intergenic
947233973 2:227920839-227920861 CTAAAAATACAAATTTAGCTTGG - Intronic
947691420 2:232140089-232140111 ATGAACATACACACTCAGCTTGG - Intronic
947787955 2:232841609-232841631 ATGAAAATACAAATGAAGGCAGG - Intronic
1169148658 20:3271780-3271802 CTAAAAATACAAAATAAGCTGGG - Intronic
1169344585 20:4820348-4820370 ATAAAAATAAAAATTTAGCTGGG + Intronic
1169373481 20:5046624-5046646 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169439253 20:5620380-5620402 CTGAAAATACAAAATTAGCTGGG - Intergenic
1169441263 20:5635828-5635850 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169495348 20:6109738-6109760 AAAAAAATACAAATTTAGCTGGG + Intronic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170688673 20:18592313-18592335 CTTGAAATACAGATTTAGCTGGG + Intronic
1171946927 20:31387100-31387122 CTGAAAATACACAATAGGCTGGG - Intronic
1171985261 20:31656001-31656023 GTAAAAATACAAATTTAGCTGGG + Intergenic
1172086910 20:32392441-32392463 CTAAAAATACAGAATTAGCTGGG - Intronic
1172241515 20:33415945-33415967 ATAAAAATACAAAATTAGCTGGG + Intronic
1172707459 20:36892493-36892515 ATAAAAGTTCAGAGTAAGCTGGG + Exonic
1172722524 20:37010974-37010996 ATGAAAATAAAAAATTAGCTGGG - Intronic
1172739609 20:37155558-37155580 ACAAAAATACAGAATTAGCTGGG - Intronic
1172925393 20:38529534-38529556 ATAAAAATAAAAATAAAGCTTGG + Intronic
1173286723 20:41678666-41678688 CTGAAAATACAAAATTAGCTGGG + Intergenic
1173320165 20:41980506-41980528 ATGAAAATGCAGAATAATATGGG - Intergenic
1174005102 20:47404223-47404245 CTGAAAATACAAAATTAGCTGGG + Intergenic
1174256425 20:49258940-49258962 CTAAAAATACAAAATAAGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175613795 20:60374883-60374905 CTGAAAATACAAAATTAGCTGGG + Intergenic
1176136491 20:63524573-63524595 AACAAAAGACAGATTAAACTGGG + Intergenic
1176261521 20:64183979-64184001 CTGAAAATACAAAATTAGCTGGG - Intronic
1177555270 21:22680655-22680677 ATAAAAATACAAAATTAGCTGGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1178308231 21:31508550-31508572 CTGAAAATACAAAATTAGCTGGG - Intronic
1178415906 21:32404961-32404983 CTGAAAATACAAAATTAGCTGGG - Intergenic
1178428780 21:32500972-32500994 CTGAAAATACAAAGTTAGCTGGG - Intronic
1178445559 21:32638399-32638421 TTGAAAATTCAGAGTAGGCTGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178511567 21:33209488-33209510 AGGAAAAGACAGAGTAAACTAGG + Intergenic
1178547014 21:33500853-33500875 ATAAAAATAAAAAATAAGCTGGG - Intergenic
1179455291 21:41495326-41495348 ACAAAAATACAGATTTGGCTGGG + Intronic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1179672330 21:42958445-42958467 CTGAAAATACAAAATTAGCTGGG + Intergenic
1180510968 22:16088825-16088847 CTGAAAATACAAAATTAGCTGGG - Intergenic
1180792087 22:18580701-18580723 CTGAAAATACAAAATTAGCTGGG + Intergenic
1180927036 22:19562510-19562532 AATAAAATACAGACTCAGCTGGG - Intergenic
1181229647 22:21414608-21414630 CTGAAAATACAAAATTAGCTGGG - Intergenic
1181249002 22:21520258-21520280 CTGAAAATACAAAATTAGCTGGG + Intergenic
1181565815 22:23736687-23736709 ATAAAAATACAAAATAAGCTGGG + Intergenic
1181641009 22:24198568-24198590 CTGAAAATACAAAATTAGCTCGG + Intergenic
1181819499 22:25464539-25464561 CTGAAAATACAAAATTAGCTGGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182402176 22:30087020-30087042 CTGAAAATACAAAATTAGCTGGG - Intronic
1182633242 22:31703956-31703978 CTAAAAATACAGAATTAGCTGGG - Intronic
1183268892 22:36848613-36848635 CTGAAAATACAAAATTAGCTGGG + Intergenic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184539312 22:45109614-45109636 CTAAAAATACAGAATTAGCTGGG - Intergenic
1184581541 22:45421132-45421154 CTGAAAATACAAAATTAGCTGGG + Intronic
1184752738 22:46498085-46498107 ATAAAAATACAAAATTAGCTGGG + Intronic
1184756432 22:46518608-46518630 ATGAAGATATAAATTAAGATGGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
949128626 3:475085-475107 ATAAAAATGCAGATTAAAATGGG - Intergenic
949187801 3:1214727-1214749 AAGAAAACTCAGAATAAGCTGGG - Intronic
949556686 3:5159439-5159461 CTGAAAATACAAAATTAGCTGGG + Intronic
949588931 3:5473106-5473128 ATAAAAATACAGATTGAGATTGG + Intergenic
949764238 3:7508275-7508297 TAGAAAATAAAGATTAAGCCAGG + Intronic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951297944 3:20962392-20962414 CTGAAAATACAAAATTAGCTGGG + Intergenic
951304783 3:21045420-21045442 ATGATAATACAGGTAAAACTAGG - Intergenic
951488533 3:23242068-23242090 ATAAAAATAAAAATTTAGCTAGG - Intronic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
952327431 3:32334137-32334159 CTGAAAATACAAAATTAGCTGGG - Intronic
952352810 3:32556856-32556878 ATGAAAATAGAGATTGTGGTTGG - Intronic
952464381 3:33565649-33565671 CTAAAAATACAAATTTAGCTGGG + Intronic
952524892 3:34199532-34199554 ATGTAATGACAGAATAAGCTTGG + Intergenic
952557056 3:34544100-34544122 ATGAAGATAGAGATGAAGATTGG - Intergenic
952865270 3:37851086-37851108 TTGAAAAGACAGATTAGGCTGGG + Intergenic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
953061480 3:39431601-39431623 CTAAAAATACAAATTTAGCTGGG - Intergenic
953316784 3:41935385-41935407 AAAAAAATACAAATTTAGCTGGG - Intronic
953689368 3:45104890-45104912 CTGAAAATACAAAATTAGCTGGG + Intronic
953994230 3:47507198-47507220 ATGAAAATACAAAATTAGCCGGG + Intronic
954051748 3:47984984-47985006 ATAAAAATAAAAATTAGGCTGGG + Intronic
954247884 3:49345981-49346003 TTGAAAATACAGAATTATCTGGG + Intergenic
954251350 3:49369904-49369926 CTGAAAATACAAAATTAGCTGGG + Intronic
955207204 3:56907140-56907162 CTGAAAATACAAAATTAGCTGGG - Intronic
955583859 3:60455091-60455113 TTCAAAATACAAATTAAGATGGG + Intronic
955609477 3:60741809-60741831 ATCAAAGTACAGATTCAGTTTGG - Intronic
956110505 3:65865799-65865821 CTAAAAATACAGAATTAGCTGGG - Intronic
956119145 3:65948530-65948552 ATGAAATTACAGTTTGAGTTAGG + Intronic
956127489 3:66024643-66024665 ATAAAAATACAAAATTAGCTGGG + Intronic
956339017 3:68199427-68199449 TTGAAATTATAGATCAAGCTGGG + Intronic
956646885 3:71465144-71465166 TTGAAAATACAAAATTAGCTGGG + Intronic
957113399 3:75994166-75994188 ATGAAACTCCAGATTAAATTTGG - Intronic
957392000 3:79587226-79587248 ATGAAAAAAAAAATTGAGCTGGG + Intronic
957896641 3:86429287-86429309 ATGGAAATAAAAATTAGGCTGGG + Intergenic
957940166 3:86993036-86993058 CTAAAAAAACAAATTAAGCTGGG - Intergenic
958216351 3:90584456-90584478 ATAAAAACACAGGTTAAACTCGG + Intergenic
958217618 3:90610167-90610189 ATCAAAATAAAGGTTAAACTCGG + Intergenic
958221657 3:90692735-90692757 ATGAAAAGAAAGGTTAAACTCGG + Intergenic
958335711 3:92560698-92560720 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
958496785 3:94854351-94854373 ATGAAAATACAAAATAAGCTGGG + Intergenic
958674969 3:97257315-97257337 ATGAAAATAAAGGGTAAGCTGGG + Intronic
958730591 3:97956654-97956676 CTGAAAATACAAAATTAGCTGGG - Intronic
958946343 3:100366642-100366664 ATGAAATTGCAGATTATCCTAGG - Intronic
958978684 3:100696138-100696160 ATGAAAATTAAGCTTAAGTTAGG + Intergenic
959417439 3:106093335-106093357 ATAAACACACAGATTAACCTAGG + Intergenic
960106928 3:113807967-113807989 CTAAAAATACAGAATTAGCTGGG + Intronic
960690737 3:120343732-120343754 ATAAAAATATACGTTAAGCTGGG + Intronic
961157326 3:124691265-124691287 CTAAAAATACAGAATTAGCTGGG + Intronic
961757341 3:129136848-129136870 AAGAAAATACAAAATTAGCTGGG - Intronic
962093535 3:132270211-132270233 ACAAAAATACAAAATAAGCTGGG + Intronic
962704055 3:138026482-138026504 CTGAAAATACAAAATTAGCTGGG + Intronic
962775118 3:138651925-138651947 ATGAAAATACAGGTTTGGCTGGG + Intergenic
962873917 3:139521032-139521054 CTGAAAATACAAAATTAGCTGGG + Intronic
962963443 3:140332316-140332338 AGGAAAAAAGAGATGAAGCTGGG + Intronic
963097079 3:141555098-141555120 CTAAAAATACAGAATTAGCTGGG + Intronic
963155800 3:142095149-142095171 CTGAAAATACATAATTAGCTGGG - Intronic
963241405 3:143006592-143006614 CTGAAAATACAAAATTAGCTGGG + Intronic
963739822 3:149066205-149066227 CTGAAAATACAAAATTAGCTGGG - Intronic
964015451 3:151939819-151939841 ATTAAAATACTAATTAGGCTGGG - Intergenic
964166637 3:153714911-153714933 ATGAATAGACAAATTAAACTAGG - Intergenic
964342476 3:155722321-155722343 CTGAAAATACAAAATTAGCTGGG - Intronic
964489549 3:157220849-157220871 AGGAAGATGCAGATGAAGCTAGG + Intergenic
964683413 3:159367229-159367251 CTAAAAATACAAAATAAGCTGGG + Intronic
964740647 3:159961873-159961895 ATAAAAATAAAGATTAAAATAGG - Intergenic
964750212 3:160047486-160047508 CTAAAAATACAGAATTAGCTGGG + Intergenic
964938698 3:162127272-162127294 ATTAAAATACAGATAAAGGAGGG + Intergenic
964963682 3:162461951-162461973 ATAAAAATACAAAATTAGCTGGG + Intergenic
965147487 3:164925320-164925342 ATAAAAATACAAAATTAGCTGGG - Intergenic
965499137 3:169436409-169436431 ATGAAAATACAAAATTAGCCAGG - Intronic
965689213 3:171337471-171337493 ATGTAAATACGGTTTAAGCCTGG + Intronic
965920727 3:173909837-173909859 CTGAAAATACAAAATTAGCTGGG - Intronic
966350261 3:179026545-179026567 CTGAAAATACAAAATTAGCTGGG - Intronic
966418697 3:179716083-179716105 CTAAAAATACAGAATTAGCTTGG - Intronic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
966841716 3:184094736-184094758 CTAAAAATACAGAATTAGCTGGG + Intergenic
966865389 3:184256111-184256133 ATTAAAATACAAAATTAGCTGGG + Intronic
967287395 3:187886588-187886610 CTGAAAATACAAAATTAGCTGGG - Intergenic
967331826 3:188297718-188297740 ATGAAATTAAGGATTAAGCTGGG - Intronic
967458397 3:189716957-189716979 CTGAAAATACAAAATTAGCTGGG - Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
968637505 4:1688784-1688806 CTGAAAATACAAAATTAGCTAGG - Intergenic
968784706 4:2611567-2611589 AAGAAAATGCAGATTAAGCCGGG - Intronic
969784035 4:9438481-9438503 TTGAGATTACAGATTGAGCTAGG - Intergenic
969853787 4:9983027-9983049 CTGAAAATACAAAATTAGCTGGG - Intronic
969955535 4:10886392-10886414 ATGAACATACACATTATGCCAGG - Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970063828 4:12068245-12068267 ATGGAAATACATTTTAGGCTGGG + Intergenic
970755511 4:19421225-19421247 ATGAAAAGACAAATTCATCTAGG - Intergenic
970811350 4:20098224-20098246 AGAAAAATATAGATAAAGCTAGG - Intergenic
970988657 4:22187944-22187966 CTAAAAATACAGAATTAGCTGGG + Intergenic
971212230 4:24629786-24629808 ATAAAAATACAAAATTAGCTGGG + Intergenic
971431146 4:26569088-26569110 ATGATAATACAGATTTTACTGGG - Intergenic
971802391 4:31308843-31308865 ATGAAAATACAGTTAAGGCTGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971923282 4:32971646-32971668 AGGAAAATACAGATTAGGAAGGG - Intergenic
972013584 4:34215636-34215658 ATGAAGATACAAAATTAGCTGGG + Intergenic
972280420 4:37596907-37596929 GTAAAAATACAGAATTAGCTGGG - Intronic
972586647 4:40443554-40443576 ATAAAAATACAAAATTAGCTGGG + Intronic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974850482 4:67398693-67398715 ATGAAAAGAAAGGTTAAACTCGG + Intergenic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
974882577 4:67778165-67778187 CTGAAAATACAAAATTAGCTGGG - Intergenic
975129371 4:70817368-70817390 ATGAAAATCAAGAATAGGCTAGG - Exonic
975224881 4:71859618-71859640 ATGAAAAGAAAAATTAAGCCAGG - Intergenic
975565304 4:75748066-75748088 CTGAAAATACAAAATTAGCTGGG - Intronic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
975841027 4:78474392-78474414 ATGAAAATTCAGATAAAAATTGG + Intronic
975888990 4:79001579-79001601 ATAAAAATACAAAATTAGCTGGG - Intergenic
975935111 4:79570247-79570269 CTAAAAATACAGAATTAGCTGGG - Intergenic
976044802 4:80932273-80932295 AGGAAAATACAGATAATGGTTGG - Intronic
976169284 4:82286217-82286239 CTGAAAATACAAAATTAGCTGGG - Intergenic
976300837 4:83514060-83514082 CTGAAAATACAAAATTAGCTGGG + Intronic
976314175 4:83641788-83641810 CTGAAAATACAAAATTAGCTGGG + Intergenic
976461736 4:85320211-85320233 ATGAAAAAACAGCTTAAGTGTGG + Intergenic
976479884 4:85529348-85529370 ATGAAAATACTGGCTTAGCTTGG + Intronic
976527983 4:86115620-86115642 CTAAAAATACAAAATAAGCTGGG - Intronic
976544950 4:86324248-86324270 ATGAAAATACAAAATTAGCCAGG + Intronic
976756543 4:88504378-88504400 TTGGAAATACAGATTATGATTGG + Exonic
977088271 4:92633319-92633341 ATGAAAATACAACTTAAATTTGG + Intronic
977234131 4:94486704-94486726 ATAAAAAAACAGATTAGGCCAGG + Intronic
977413364 4:96696592-96696614 ATAAAAATACAAAATTAGCTGGG - Intergenic
977428815 4:96904997-96905019 TTGAAACTACAGATTAAACTGGG - Intergenic
977470825 4:97439157-97439179 ATAAAAATAATGATTAAGTTGGG - Intronic
977693636 4:99944870-99944892 AAAAAAATACTGATTAGGCTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
978862008 4:113461483-113461505 GTGAAAATGCAGAGTATGCTTGG + Intronic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980020034 4:127697957-127697979 CTAAAAATACAAAATAAGCTGGG + Intronic
980075980 4:128293355-128293377 ATGAAAATACAAATTCAAATAGG - Intergenic
980120562 4:128723839-128723861 CTGAAAATGCAAATTTAGCTGGG + Intergenic
980122597 4:128743272-128743294 CTAAAAATACAAAATAAGCTGGG - Intergenic
980341590 4:131555798-131555820 ATGAAAATATTAATTAACCTAGG + Intergenic
980834425 4:138173471-138173493 CTAAAAATACAAAATAAGCTGGG + Intronic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981277369 4:142916572-142916594 ATGAATATACAGAATAGGCTGGG + Intergenic
981406187 4:144372450-144372472 CTGAAAATACAAAATTAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982168881 4:152642078-152642100 CTGAAAATACAAAATTAGCTGGG - Intronic
982280311 4:153677568-153677590 CTGAAAATACAAAATTAGCTGGG - Intergenic
982689731 4:158534406-158534428 ATAAAAATACAAAATTAGCTGGG - Intronic
982854170 4:160360932-160360954 CTAAAAATACAGAATTAGCTGGG - Intergenic
982955575 4:161761695-161761717 ATGATGATACAACTTAAGCTGGG + Intronic
983059135 4:163135627-163135649 ATAAAAATACAAAATTAGCTGGG + Intronic
983405067 4:167317474-167317496 ATTAAACTATAGATTAAGATAGG + Intergenic
983773717 4:171580700-171580722 ATGGACAAACAGATTAAGATTGG - Intergenic
983943547 4:173561954-173561976 ATAAAAATCCAGATTAGGCCGGG + Intergenic
984006607 4:174318222-174318244 ATAAAAATACAAAATTAGCTGGG - Intronic
984200863 4:176719896-176719918 ATTAAAATACAAAATCAGCTGGG + Intronic
984387227 4:179076894-179076916 ATAAAAATACAAAATTAGCTTGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985956869 5:3272274-3272296 TTAAAAATACAGAATTAGCTGGG - Intergenic
986108796 5:4689496-4689518 CTGAAAATACAAAATCAGCTGGG + Intergenic
986470578 5:8070228-8070250 AAGAAAATACACAATAAGCCTGG + Intergenic
986821371 5:11470271-11470293 ATTAAAATACAAAATTAGCTGGG + Intronic
986884653 5:12218124-12218146 CTAAAAATACAGTTTAGGCTGGG + Intergenic
987047944 5:14124963-14124985 CTGAAAATACAAAATTAGCTGGG + Intergenic
987489554 5:18560290-18560312 CTGAAAATACAAAATTAGCTGGG - Intergenic
987815717 5:22899317-22899339 GTCAAAATACAAATTAAGCGTGG - Intergenic
987976493 5:25021418-25021440 ATGAAATTCCATATTGAGCTGGG + Intergenic
988292422 5:29305621-29305643 CTAAAAATACAGAATTAGCTAGG - Intergenic
988474199 5:31568234-31568256 ATAAAAATACAAAATTAGCTCGG + Intergenic
988575220 5:32416451-32416473 CTAAAAATACAGAATTAGCTGGG + Intronic
988822523 5:34901599-34901621 CTAAAAATACAGAATTAGCTGGG + Intergenic
989054510 5:37354305-37354327 CTAAAAATACAAAATAAGCTGGG - Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989388484 5:40876530-40876552 CTAAAAATACAGAATTAGCTGGG + Intergenic
989569018 5:42927665-42927687 CTGAAAATACAAAATTAGCTGGG + Intergenic
989788473 5:45361471-45361493 CTGAAAATACAAAATTAGCTGGG - Intronic
989910090 5:49624401-49624423 ATGAAAAGAAAGGTTAAACTCGG + Intergenic
990132054 5:52597787-52597809 ATGAATATTCAGATTATGCATGG + Intergenic
990588800 5:57240811-57240833 CTAAAAATACAAATTTAGCTGGG + Intronic
991061329 5:62379499-62379521 CTAAAAATACAGAATTAGCTGGG + Intronic
991063103 5:62399303-62399325 CTAAAAATACAAATTTAGCTGGG + Intronic
991441984 5:66660225-66660247 CTGAAAATACAAAATTAGCTGGG + Intronic
991444276 5:66682864-66682886 ATTAAAATCCAGATGAAGCGGGG - Intronic
991720182 5:69488103-69488125 CTGAAAATACAAAATTAGCTGGG + Intergenic
991770913 5:70040040-70040062 CTTAAAATACAGAATTAGCTGGG - Intronic
991850207 5:70915457-70915479 CTTAAAATACAGAATTAGCTGGG - Intronic
992264001 5:74999620-74999642 TTGAACATACAGATTAAGTTGGG + Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
992667793 5:79027999-79028021 CTGAAAATACAAAATTAGCTGGG - Intronic
993165391 5:84347709-84347731 AGGAAAATACAGCTTAATATTGG - Intronic
993483043 5:88448805-88448827 CTGAAAATACAAAATTAGCTGGG + Intergenic
993614653 5:90096739-90096761 AGCAAAGTACAGATTCAGCTGGG + Intergenic
993681164 5:90879784-90879806 CTGAAAATACAAAATTAGCTGGG + Intronic
993860238 5:93127030-93127052 TTAAAAATACAGTTTAGGCTTGG + Intergenic
993935842 5:94001213-94001235 ATGAACCTATAGATTAAGTTGGG + Intronic
994400157 5:99269027-99269049 ATGAAACTAGAAATTAGGCTGGG - Intergenic
994411595 5:99413227-99413249 ATTAAAATGCAGATTATCCTGGG - Intergenic
994482231 5:100352023-100352045 ATTAAAATGCAGATTATCCTGGG + Intergenic
994625850 5:102217767-102217789 ATGAGAAGACAGATTAGGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994857803 5:105147162-105147184 AACAAAATATAAATTAAGCTAGG + Intergenic
994932999 5:106213665-106213687 CTAAAAATACAAAATAAGCTGGG + Intergenic
994937430 5:106272965-106272987 CTGAAAATACAAAATTAGCTGGG + Intergenic
995239209 5:109866599-109866621 TTGAACATACAGACTACGCTTGG - Intronic
995891451 5:116957188-116957210 ATGAATATATAGATTAATTTAGG - Intergenic
996378392 5:122839644-122839666 CTAAAAATACAAATTTAGCTGGG - Intergenic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
996547442 5:124695304-124695326 CTGAAAATACAAAGTAAGCCTGG + Intronic
996558936 5:124808073-124808095 CTAAAAATACAAATTTAGCTGGG - Intergenic
996708725 5:126523048-126523070 CTGAAAATACAAAATTAGCTGGG - Intergenic
996996791 5:129706406-129706428 CTGAAAATACAAAATTAGCTGGG + Intronic
997007421 5:129834495-129834517 AGAAAAATACAAATTAAGCTTGG - Intergenic
997146778 5:131443103-131443125 CTAAAAATACAGAATTAGCTGGG - Intronic
997159427 5:131592016-131592038 ATTAAAATACAAAATTAGCTAGG - Intronic
997300591 5:132801059-132801081 AACAAAACACAGATTATGCTGGG - Intronic
997551486 5:134757325-134757347 CTAAAAATACAAAATAAGCTGGG + Intergenic
997776325 5:136610119-136610141 CTAAAAATACAGAATTAGCTGGG + Intergenic
998147279 5:139737020-139737042 ATGAAAATAGAATTTTAGCTGGG + Intergenic
998259084 5:140614345-140614367 CTAAAAATACAGAATTAGCTGGG + Intergenic
998703193 5:144729383-144729405 ATGAAACAACAGATTAAACAAGG - Intergenic
998724342 5:144992297-144992319 AGAAAAATACAAATTAGGCTGGG - Intergenic
998727653 5:145036290-145036312 CTGAAAATACAAAATTAGCTAGG - Intergenic
998825181 5:146094241-146094263 CTGAAAATACAAAATTAGCTGGG - Intronic
998826126 5:146103318-146103340 CTAAAAATACAGAATTAGCTGGG - Intronic
998834319 5:146189385-146189407 CTAAAAATACAGAATTAGCTGGG - Intergenic
999128208 5:149262457-149262479 ATGAAAATACAGATGCTGATTGG - Intergenic
999168907 5:149576082-149576104 CTGAAAATACAAAATTAGCTGGG + Intronic
999386776 5:151159131-151159153 CTAAAAATACAGAATTAGCTGGG - Intergenic
999879054 5:155840848-155840870 CTGAAAATACAAAATTAGCTGGG + Intergenic
1000323354 5:160152725-160152747 CTAAAAATACAGAATTAGCTGGG - Intergenic
1000603570 5:163303462-163303484 ATGGAAATATGCATTAAGCTAGG - Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001046846 5:168380307-168380329 ATAAAAATACAGAATCAGCTGGG + Intronic
1001593293 5:172881084-172881106 ATAAAAATACAAAATTAGCTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002606611 5:180386940-180386962 ATAAAAATACAAAATTAGCTGGG + Intergenic
1003385887 6:5667217-5667239 ATAAAAATAAAGATTAAATTTGG + Intronic
1003423074 6:5975342-5975364 AAGAAAAAGCAGATTGAGCTGGG + Intergenic
1003545549 6:7055470-7055492 ATAAAAATACAAAATAAGCCAGG - Intergenic
1004227801 6:13803220-13803242 CTGAAAATACAAAATTAGCTGGG - Intronic
1004302367 6:14470040-14470062 CTGAAAATACAAAATTAGCTAGG + Intergenic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004394184 6:15233873-15233895 CTGAAAATACAAAATTAGCTGGG - Intergenic
1004591306 6:17054501-17054523 CTAAAAATACAAAATAAGCTGGG - Intergenic
1004654631 6:17646898-17646920 AAGAAAATACAGAATTAGCCAGG - Intronic
1004937160 6:20519022-20519044 ATAAAAATACAAAATTAGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005087288 6:22020239-22020261 ATGAAGATACAGGTTTATCTGGG - Intergenic
1005263066 6:24082506-24082528 CTGAAAATACAAAATTAGCTAGG + Intergenic
1005310300 6:24552764-24552786 CTGAAAATACAAAATTAGCTGGG - Intronic
1005387339 6:25298913-25298935 CTAAAAATACAAAATAAGCTGGG - Intronic
1005565009 6:27082585-27082607 CTGAAATTACAGATTCAGTTCGG + Intergenic
1005626670 6:27668960-27668982 TTAAAAATACAAAATAAGCTGGG + Intergenic
1005728253 6:28670812-28670834 CTGAAAATACAAAATTAGCTGGG - Intergenic
1005970912 6:30761010-30761032 ATAAAAATACAGAATTAGCCGGG - Intergenic
1006189566 6:32199268-32199290 ATGATAATATAGATTGAGGTTGG + Intronic
1006214274 6:32426289-32426311 CTAAAAATACAAATTTAGCTGGG + Intergenic
1006298779 6:33182111-33182133 ATAAAAATACAAAATTAGCTGGG + Intronic
1006769098 6:36536695-36536717 CTAAAAATACAGAATTAGCTGGG - Intronic
1006819101 6:36876561-36876583 CTAAAAATACAAAATAAGCTGGG + Intronic
1006890097 6:37419702-37419724 ATAAAAATACAAAATTAGCTGGG + Intergenic
1006895356 6:37465105-37465127 CTGAAAATACAAAATTAGCTGGG + Intronic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1007013826 6:38442828-38442850 CTAAAAATACAAATTTAGCTGGG - Intronic
1007437170 6:41822682-41822704 CTAAAAATACAAATTTAGCTGGG + Intronic
1008192991 6:48482751-48482773 CTAAAAATACAAAATAAGCTGGG + Intergenic
1008202938 6:48614820-48614842 CTAAAAATACAAATTTAGCTGGG + Intergenic
1008320001 6:50099815-50099837 ATGGAAATTCAGATAAATCTTGG + Intergenic
1008471136 6:51886491-51886513 GTGACAATACAGATAAACCTGGG + Intronic
1008958333 6:57240261-57240283 CTAAAAATACAAATTTAGCTGGG - Intergenic
1009218191 6:60948287-60948309 CTAAAAATACAGAATTAGCTGGG - Intergenic
1009257056 6:61421811-61421833 ATCAAAAGAAAGGTTAAGCTCGG - Intergenic
1010005078 6:70986754-70986776 CTAAAAATACAAATTTAGCTGGG - Intergenic
1010228611 6:73514808-73514830 CTGAAAATACAAAATTAGCTGGG - Intergenic
1011421422 6:87177164-87177186 CTAAAAATACAGAATTAGCTGGG + Intronic
1011467062 6:87668994-87669016 ATAAAAATACAAAATTAGCTGGG + Intergenic
1011605373 6:89099694-89099716 CTGAAAATACAAAGTTAGCTGGG - Intronic
1011932691 6:92733900-92733922 ATGAAAATACAGAGCAAACGTGG + Intergenic
1013042720 6:106452104-106452126 ATGATAATAAAGAATGAGCTTGG + Intergenic
1013373026 6:109486736-109486758 ATGAAAATACCATTTAAGATGGG + Intergenic
1013525222 6:110967982-110968004 TTTAAAATACAGTTTAGGCTGGG + Intergenic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1014460868 6:121693870-121693892 CTAAAAATACAGAATTAGCTGGG + Intergenic
1015695197 6:135972071-135972093 CTGAAAATACACAATTAGCTGGG + Intronic
1015759992 6:136648523-136648545 ATGAAATTACATAATAAGCATGG - Intronic
1016031186 6:139340275-139340297 CTGAAAATACAAAATTAGCTGGG - Intergenic
1016456682 6:144237995-144238017 CTGAAAATACAAAATTAGCTGGG - Intergenic
1016555831 6:145336678-145336700 CTGAAAATACAAAATTAGCTGGG + Intergenic
1017385362 6:153876476-153876498 CTAAAAATACAGAATTAGCTGGG + Intergenic
1017446077 6:154509148-154509170 ATGAAAATACAGATTGTTCTTGG + Intronic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1017867773 6:158459267-158459289 CTGAAAATACAAAATTAGCTGGG + Intronic
1017914560 6:158821076-158821098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1017959438 6:159209006-159209028 ATAAAAATACAAAATTAGCTGGG - Intronic
1018105185 6:160479086-160479108 GTAAAAATACAAAATAAGCTGGG + Intergenic
1018302023 6:162413544-162413566 GTGAAAATACAGATAATGTTTGG - Intronic
1018314794 6:162546262-162546284 CTAAAAATACAAATTTAGCTGGG - Intronic
1018819671 6:167364264-167364286 GTGAAAATTCAGATTTAACTGGG - Intronic
1018994439 6:168700607-168700629 ACGAAAATACAAAATTAGCTGGG - Intergenic
1019168286 6:170113705-170113727 ATGAAGATACAGATACAGATAGG + Intergenic
1019367668 7:643559-643581 ATAAAAATACAAAATTAGCTGGG + Intronic
1019405273 7:880178-880200 CTAAAAATACAGAATTAGCTGGG + Intronic
1019442336 7:1053664-1053686 CTGAAAATACAAAATTAGCTGGG + Intronic
1019554533 7:1622213-1622235 CTGAAAATACAAAATTAGCTGGG + Intergenic
1020018793 7:4848975-4848997 ATGAAAATACAAAATTAGCCGGG + Intronic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1020102662 7:5403319-5403341 CTAAAAATACAAATTTAGCTGGG - Intronic
1020172083 7:5852912-5852934 ATGAAAATATAGACTCAGCCTGG - Intergenic
1020199758 7:6070334-6070356 CTGAAAATACAAAATTAGCTGGG + Intergenic
1020407497 7:7854192-7854214 CTAAAAATACAGAATTAGCTGGG + Intronic
1020484774 7:8707884-8707906 ATGAAAATAAAGAATAAGAAAGG - Intronic
1020506588 7:8997085-8997107 ATGAAAACACATTGTAAGCTAGG + Intergenic
1020579394 7:9975986-9976008 CTAAAAATACAAATTTAGCTGGG - Intergenic
1020895817 7:13938104-13938126 CTGAAAATACAAAATTAGCTGGG - Intronic
1021285247 7:18772685-18772707 ATGAAAATCCAGATACAGTTAGG - Intronic
1021492078 7:21230160-21230182 CTAAAAATACAAAATAAGCTGGG + Intergenic
1021511140 7:21433777-21433799 CTAAAAATACAGAATTAGCTGGG + Intronic
1021720385 7:23499164-23499186 CTAAAAATACAGAATTAGCTGGG - Intergenic
1021729612 7:23583983-23584005 CTGAAAATACAAAATTAGCTGGG + Intergenic
1021738283 7:23660246-23660268 ATAAAAATACAAAATTAGCTGGG + Intergenic
1022049900 7:26656336-26656358 AGAAAAATACAAATAAAGCTTGG - Intergenic
1022084274 7:27051306-27051328 CTGAAAATACAAAATTAGCTGGG - Intergenic
1022124301 7:27340757-27340779 CTGAAAATACAAAATTAGCTGGG + Intergenic
1022210297 7:28202248-28202270 TTAAAAATACAAAATAAGCTGGG + Intergenic
1023040519 7:36168821-36168843 ATGAAGAGACAGATTTAACTGGG + Intronic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1023917954 7:44604563-44604585 CTAAAAATACAAAATAAGCTGGG + Intergenic
1023936467 7:44743558-44743580 CTAAAAATACAGAATTAGCTGGG - Intergenic
1024269788 7:47633689-47633711 CTGAAAATACAAAATTAGCTGGG - Intergenic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1024634839 7:51278539-51278561 ATAAAAATACAAAATTAGCTGGG - Intronic
1024644380 7:51358842-51358864 ATGAAAATACAAAATTAGCCAGG + Intergenic
1024887783 7:54164015-54164037 ATAAAAATAAAAATTAAGCCAGG - Intergenic
1025352601 7:58692754-58692776 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1025380157 7:59181050-59181072 ATGAAAAGAAAGGTTAAACTCGG - Intergenic
1025732828 7:64121582-64121604 CTGAAAATACAAAATTAGCTGGG + Intronic
1026170937 7:67953339-67953361 CTGAAAATACAAAATTAGCTGGG + Intergenic
1026210639 7:68300893-68300915 ATGAAAATAGAAAATAGGCTGGG - Intergenic
1026216113 7:68350593-68350615 CTGAAAATACAAAATCAGCTGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026347604 7:69488113-69488135 CTAAAAATACAAAATAAGCTGGG - Intergenic
1026451652 7:70534585-70534607 CTAAAAATACAGAATTAGCTGGG - Intronic
1026637176 7:72094413-72094435 CTAAAAATACAGAATTAGCTGGG - Intronic
1026954237 7:74366713-74366735 CTGAAAATACAAAATTAGCTGGG + Intronic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1029086586 7:98016589-98016611 ATGAAAATATAGACTCAGCCTGG + Intergenic
1029164024 7:98573385-98573407 CTGAAAATACAAAATTAGCTAGG + Intergenic
1029217490 7:98961756-98961778 CTAAAAATACAAATTTAGCTGGG + Intronic
1029324331 7:99793064-99793086 ATGATAATAAGGGTTAAGCTGGG - Intergenic
1029463760 7:100712057-100712079 CTGAAAATACAAAATTAGCTGGG + Intergenic
1029584958 7:101464570-101464592 ATGAAAATACAAAATTAGCCAGG - Intronic
1029626212 7:101721843-101721865 CTGAAAATACAAAATTAGCTGGG + Intergenic
1029787551 7:102807761-102807783 AAAAAAATACAGAGTAGGCTGGG + Intronic
1029853729 7:103491666-103491688 CTAAAAATACAAAATAAGCTGGG + Intronic
1029969106 7:104771979-104772001 CTAAAAATACAAATTTAGCTGGG - Intronic
1030046678 7:105503291-105503313 ATGAAAATGCAGGCAAAGCTAGG + Intronic
1030097161 7:105910636-105910658 ATAAAAATACAAAATTAGCTAGG - Intronic
1030137045 7:106263630-106263652 ATGAAAACACAGATTTACTTAGG + Intronic
1030164636 7:106541469-106541491 ATGAAATTATAGATTAATTTGGG + Intergenic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1030481383 7:110108799-110108821 ATGAACATACACATTAGCCTAGG - Intergenic
1030501006 7:110358572-110358594 ATAAACATACATATTAGGCTAGG + Intergenic
1030816579 7:114047003-114047025 CTAAAAATACAAATTTAGCTGGG + Intronic
1030848150 7:114447950-114447972 ATGAAAAAAAAGTTTAAGATAGG + Intronic
1030910983 7:115248570-115248592 AGGAAAATACAAAATGAGCTTGG - Intergenic
1030942232 7:115667492-115667514 CTGAAAATACAAAATTAGCTGGG + Intergenic
1031288806 7:119907091-119907113 ATGAAAGTACAGAGTAAGCCGGG - Intergenic
1031290178 7:119924467-119924489 CTGAAAATACAAAATTAGCTGGG - Intergenic
1031502532 7:122537425-122537447 ATGAAATTAAAGATAAAACTAGG + Intronic
1031757757 7:125667344-125667366 ATTAAAATTCACATTCAGCTGGG + Intergenic
1031925869 7:127637793-127637815 ATAAAAATACAAAATTAGCTGGG + Intergenic
1032104082 7:129010472-129010494 ATGAAATTATTGATTAAGGTAGG + Intronic
1032184218 7:129709889-129709911 CTGAAAATACAAAATTAGCTGGG - Intronic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032442312 7:131951329-131951351 CTAAAAATACAGAATTAGCTGGG + Intergenic
1032684807 7:134222767-134222789 CTGAAAATACAAAATTAGCTAGG - Intronic
1032801346 7:135319533-135319555 AGGAGAAGACAGATTAGGCTTGG + Intergenic
1033058003 7:138077901-138077923 CTGAAAATGCAGATTAAGACAGG + Intronic
1033058459 7:138081741-138081763 CTAAAAATACAGAATTAGCTGGG - Intronic
1033081439 7:138302116-138302138 ATAAAAATACAAAATTAGCTGGG + Intergenic
1033090013 7:138377021-138377043 ATAAAAATACAAAATTAGCTGGG + Intergenic
1033117835 7:138641373-138641395 ATGAAAAGACAGCCTCAGCTGGG + Intronic
1033126040 7:138708209-138708231 CTGAAAATACAAAATTAGCTGGG - Intronic
1033167199 7:139050526-139050548 ATAAAAATACAAAGTTAGCTGGG - Intronic
1033167422 7:139052442-139052464 CTGAAAATACAAAATTAGCTGGG + Intronic
1033195917 7:139327192-139327214 CTGAAAATACAAAATTAGCTGGG - Intergenic
1033198430 7:139347424-139347446 CTAAAAATACAGAATTAGCTGGG + Intronic
1033920862 7:146389860-146389882 CTAAAAATACAAATTTAGCTGGG - Intronic
1034183781 7:149158671-149158693 CTGAAAATACAAAATTAGCTGGG + Intronic
1034353767 7:150434590-150434612 CTGAAAATACAAAATTAGCTGGG + Intergenic
1034703984 7:153123875-153123897 ACTAAAATACAAAATAAGCTGGG - Intergenic
1034962332 7:155370792-155370814 CTAAAAATACAAATTTAGCTGGG + Intergenic
1037004184 8:13756938-13756960 CTAAAAATACAAAATAAGCTGGG - Intergenic
1037031566 8:14112610-14112632 ACTAAAATCTAGATTAAGCTGGG + Intronic
1037071238 8:14652178-14652200 CTGAAAATACAAAATTAGCTGGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037097748 8:15005490-15005512 CTGAAAATACAAAATTAGCTGGG - Intronic
1037418949 8:18681534-18681556 ATGAAAATTCTGATTAAAATTGG + Intronic
1037450445 8:19011720-19011742 AAGAAAACACACATTAAGATTGG + Intronic
1037466274 8:19163538-19163560 CTGAAAATACAAAATTAGCTGGG + Intergenic
1037597083 8:20363324-20363346 CTGAAAATACAAAATTAGCTGGG - Intergenic
1038608062 8:29030378-29030400 ATAAAAATACAAAATTAGCTGGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038792749 8:30683119-30683141 AAAAAAATAAAGATTCAGCTGGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039027812 8:33277075-33277097 CTGAAAATACAAAATTAGCTGGG + Intergenic
1039034587 8:33345984-33346006 ATAAAAATACAGAATTAGCTGGG - Intergenic
1039509194 8:38077331-38077353 ATAAAAATACAAAATTAGCTGGG - Intergenic
1039599826 8:38826625-38826647 ATGGAAATACAGATTTAGAGAGG + Intronic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1039942341 8:42101993-42102015 CTAAAAATACAGAATTAGCTGGG + Intergenic
1040503318 8:48024432-48024454 CTGAAAATACAAAATTAGCTGGG + Intronic
1040505725 8:48046105-48046127 ATAAAAATACAAAATTAGCTGGG - Intronic
1041070030 8:54119309-54119331 ATAAAAATACAAAATTAGCTGGG - Intergenic
1041071788 8:54132429-54132451 ATAAAAATACAAAATTAGCTGGG - Intergenic
1041191536 8:55360457-55360479 ATGAAAATACATGTCAAACTAGG - Intronic
1041426585 8:57727644-57727666 ATGATAATACAGCTTAATTTAGG + Intergenic
1042562700 8:70085069-70085091 CTAAAAATACAAAATAAGCTGGG - Intergenic
1043239787 8:77918439-77918461 CTGAAAATACAAAATTAGCTGGG - Intergenic
1043806977 8:84683845-84683867 CTTAATATACAGAATAAGCTGGG - Intronic
1043809954 8:84727020-84727042 ATGAAACAGCAGATGAAGCTTGG + Intronic
1044017540 8:87062574-87062596 CTGAAAATACAAAATCAGCTGGG + Intronic
1044129279 8:88500360-88500382 ATAAAAATATTGATTAAACTGGG - Intergenic
1044174364 8:89099978-89100000 TGGAAAATACAGAGTAAGATTGG + Intergenic
1044212100 8:89562047-89562069 ATGAAAATACACATGATGTTGGG - Intergenic
1044256291 8:90066629-90066651 ATTAAAATAGAGATTAATGTGGG + Intronic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1044773702 8:95665054-95665076 ATGAAAATAAAGCTTCAGATTGG - Intergenic
1044976397 8:97669753-97669775 CTGAAAATACAAAATTAGCTGGG + Intronic
1045303698 8:100937967-100937989 CTAAAAATACAGAATTAGCTGGG + Intronic
1045837480 8:106539509-106539531 ATGAAAATCAAAATTAAGCTCGG + Intronic
1045864057 8:106844765-106844787 AAAAAAATACAAAATAAGCTGGG + Intergenic
1046326213 8:112650365-112650387 AAGAAAATAAAGAGTAAGCTTGG + Intronic
1046364618 8:113210714-113210736 CTGAAAATACAAAATTAGCTGGG + Intronic
1046421664 8:113992651-113992673 ACAAAAATAAAGATTAAACTTGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046992130 8:120469848-120469870 ATAAAAATAAATATTAAGGTTGG - Intronic
1047069165 8:121323204-121323226 CTGAAAATACAAAATTAGCTGGG + Intergenic
1047127775 8:121981579-121981601 CTGAAAATACAAAATTAGCTAGG + Intergenic
1047194810 8:122712031-122712053 CTGAAAATACAAAGTTAGCTGGG - Intergenic
1047784849 8:128144147-128144169 CTGAAAATACAAAATTAGCTTGG + Intergenic
1048079551 8:131110590-131110612 CTAAAAATACAGAATTAGCTGGG - Intergenic
1048186549 8:132247270-132247292 ATGAAGCTAGAGATTAAGCTGGG + Intronic
1049122158 8:140748330-140748352 CTAAAAATACAGAATTAGCTGGG + Intronic
1049631223 8:143658901-143658923 CTAAAAATACAAAATAAGCTGGG - Intergenic
1049649444 8:143758301-143758323 CTGAAAATACAAAATTAGCTGGG + Intergenic
1050083958 9:1944875-1944897 ATGAAAATAGAGAATTAGCAAGG + Intergenic
1050238229 9:3605716-3605738 CTAAAAATACAGAATTAGCTGGG - Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051259237 9:15246090-15246112 ATAAAAATACAAAATTAGCTGGG + Intronic
1051423658 9:16913649-16913671 ATAAAAATACAAAATTAGCTTGG - Intergenic
1051423684 9:16913788-16913810 AATAAAATAAAGATTAAGCCAGG - Intergenic
1051567924 9:18521599-18521621 ATGAAGATACAGTATAAGCATGG + Intronic
1051568781 9:18531243-18531265 ATGAAAATCCAGATCACTCTTGG + Intronic
1052090265 9:24319121-24319143 CTAAAAATACAAATTTAGCTGGG + Intergenic
1052734373 9:32325195-32325217 CTGAAAATACAAAATTAGCTGGG - Intergenic
1052907015 9:33844363-33844385 CTGAAAATACAAAATCAGCTGGG - Intronic
1052922090 9:33979412-33979434 CTGAAAATACAAAATTAGCTGGG + Intronic
1052927713 9:34031330-34031352 CTGAAAATACAAATTTAGCCAGG + Intronic
1053249911 9:36565814-36565836 ATGAAAATAAAAAGTAAGCAAGG - Intergenic
1053310144 9:37012952-37012974 AAAAATATATAGATTAAGCTAGG + Intronic
1055659857 9:78491933-78491955 ATGAGAATGCTGATTGAGCTGGG + Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1055955934 9:81773521-81773543 CTGAAAATACAAAATTAGCTGGG - Intergenic
1056075654 9:83036199-83036221 CTGATAAAACAAATTAAGCTTGG + Intronic
1056234335 9:84577010-84577032 CTAAAAATACAGAATTAGCTGGG + Intergenic
1056375947 9:86011079-86011101 CTGAAAATACAAAATTAGCTGGG + Intronic
1056377659 9:86030048-86030070 CTGAAAATACAAAATTAGCTGGG + Intronic
1056644438 9:88398734-88398756 CTGAAAATACAAAATTAGCTGGG - Intronic
1056801163 9:89692886-89692908 CTGAAAATACAAAATTAGCTAGG + Intergenic
1056902724 9:90614851-90614873 ATAAAAATAAATATTAAACTAGG - Intronic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057108737 9:92446766-92446788 ATGAAAGAACAGACCAAGCTGGG + Intronic
1057113438 9:92497461-92497483 CTGAAAATACAAAATTAGCTGGG + Intronic
1057247242 9:93467074-93467096 ATGAAAAAACAAATCAACCTGGG - Intronic
1057431414 9:94997852-94997874 ATGAAAATAAAAAATTAGCTGGG - Intronic
1058417500 9:104803766-104803788 CTAAAAATACAAAATAAGCTGGG - Intronic
1058567472 9:106301973-106301995 ATGGAAATACTGATTAAAGTGGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058821059 9:108729743-108729765 TTGAAAATACACAGTTAGCTGGG + Intergenic
1058914143 9:109549309-109549331 ATGAAAAAACAGATTAGGAGAGG - Intergenic
1059583568 9:115579476-115579498 CTAAAAATACAAAATAAGCTGGG + Intergenic
1059810931 9:117854778-117854800 ATGAAGATTCAGAATATGCTTGG + Intergenic
1059852019 9:118352775-118352797 CTGAAAATACAAAATTAGCTGGG + Intergenic
1059875747 9:118632650-118632672 TTAAAAAGACAGATTAATCTGGG - Intergenic
1059929683 9:119248711-119248733 CTGAAAATACGGCTTAACCTTGG - Intronic
1060010946 9:120042327-120042349 CTAAAAATACAAAATAAGCTGGG + Intergenic
1060564694 9:124579847-124579869 CTGAAAATACATAATTAGCTGGG + Intronic
1061114176 9:128598107-128598129 CTGAAAATACAAAATTAGCTGGG - Intronic
1061277521 9:129578026-129578048 CTAAAAATACAAATTTAGCTGGG - Intergenic
1061321294 9:129831583-129831605 CTGAAAATACAAAATTAGCTGGG - Intronic
1061439980 9:130595063-130595085 CTGAAAATACAAAATTAGCTGGG + Intronic
1061576162 9:131507935-131507957 ATGAAAAGTTAGATTAGGCTGGG + Intronic
1061986581 9:134133602-134133624 CTGAAAATACAAAATTAGCTGGG + Intergenic
1062336474 9:136072382-136072404 ATGAAAATACAAAATTAGCCGGG + Intronic
1062387670 9:136319541-136319563 CTGAAAATACAAAATAAGCCGGG - Intergenic
1062488791 9:136794284-136794306 CTAAAAATACAGAATTAGCTGGG - Intronic
1062512000 9:136911423-136911445 CTGAAAATACAAAATTAGCTGGG - Intronic
1185659409 X:1714887-1714909 CTGAAAATACAAAATTAGCTGGG + Intergenic
1186165580 X:6822965-6822987 AAGAAAAGACAGATTAACTTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187190945 X:17034455-17034477 ATAAAAATACAAAATTAGCTGGG - Intronic
1187805554 X:23115748-23115770 AGGAAAATACAGATTTAAGTTGG + Intergenic
1188066398 X:25665867-25665889 ATTTAATTACAGATTCAGCTGGG + Intergenic
1188195867 X:27232552-27232574 ATGGAACTACAGATCAATCTGGG - Intergenic
1188213257 X:27447913-27447935 TTAAAAATACAAATTAAGCCGGG - Intergenic
1188348884 X:29102503-29102525 CTAAAAATACAGAATTAGCTGGG + Intronic
1189296148 X:39919342-39919364 ATGAAAATACAAAATTAGCTGGG + Intergenic
1189932311 X:46026462-46026484 CTGAAAATACAAAATTAGCTGGG - Intergenic
1190178465 X:48170887-48170909 CTAAAAATACAAATTTAGCTGGG + Intergenic
1190197430 X:48331461-48331483 CTAAAAATACAAATTTAGCTGGG + Intergenic
1190664170 X:52681872-52681894 CTAAAAGTACAGATTTAGCTGGG + Intronic
1190675252 X:52776550-52776572 CTAAAAGTACAGATTTAGCTGGG - Intronic
1190719842 X:53138499-53138521 CTAAAAATACAGAATTAGCTGGG + Intergenic
1190728515 X:53208664-53208686 ATAAAAATACAGAATTAGCCGGG - Intronic
1191148878 X:57198854-57198876 GTGAAAATCCAGATTAAGAAAGG - Intergenic
1191607312 X:63076867-63076889 TTAAAAATACAGAATTAGCTTGG - Intergenic
1191890390 X:65933764-65933786 ATGAAAACACACATTAGCCTAGG + Intergenic
1192107869 X:68333472-68333494 CTAAAAATACAGAATTAGCTGGG + Intronic
1192481420 X:71489513-71489535 CTGAAAATACAAAATTAGCTGGG + Intronic
1193090296 X:77486740-77486762 CTAAAAATACAAAATAAGCTGGG + Intergenic
1193232437 X:79064232-79064254 CTAAAAATACAGAATTAGCTGGG - Intergenic
1193368691 X:80666019-80666041 ATGAAAATAGAGAGTAGTCTTGG + Intergenic
1194391999 X:93330408-93330430 CTAAAAATACAGAATTAGCTGGG - Intergenic
1194475217 X:94349752-94349774 AAGAAAATAAAGCTTATGCTAGG - Intergenic
1194640349 X:96396563-96396585 CTGAAAATACAAAATTAGCTGGG - Intergenic
1194787822 X:98108131-98108153 ATTAATATACAGATAAACCTTGG + Intergenic
1195242570 X:102967225-102967247 CTAAAAATACAAAATAAGCTGGG - Intergenic
1195689099 X:107609434-107609456 CTGAAAATACAAAATTAGCTGGG - Intergenic
1196280889 X:113822472-113822494 ATGAAAAAACTGATGAATCTAGG - Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197693793 X:129529476-129529498 ATAAAAATACAAAATTAGCTGGG + Intergenic
1197940208 X:131781303-131781325 ATAAAAATACAAATTTAGCCGGG - Intergenic
1198017042 X:132621618-132621640 ATGAAAAGGCTGATTAAGATTGG + Intergenic
1198181378 X:134212903-134212925 ATAAAAAGACAGATAAAGATAGG + Intergenic
1198576185 X:138012571-138012593 ATGGAAAAAGAAATTAAGCTGGG + Intergenic
1198737208 X:139799811-139799833 TTAAAAATACAAATTTAGCTGGG - Intronic
1199090558 X:143687057-143687079 CTGAAAATACAAAATTAGCTGGG + Intergenic
1199113008 X:143956978-143957000 ATAAAAATACAAAATTAGCTGGG + Intergenic
1199253168 X:145688382-145688404 ATAAAAATACAAAATTAGCTGGG + Intergenic
1200794832 Y:7331468-7331490 CTAAAAATACAAAATAAGCTGGG - Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic
1201272472 Y:12268335-12268357 ATAAAAATACAAAATTAGCTAGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201695204 Y:16816985-16817007 ATAAAAATAAAAATTTAGCTGGG + Intergenic
1202587739 Y:26449649-26449671 ATGAAAATAGATTTTCAGCTGGG + Intergenic