ID: 1002293115

View in Genome Browser
Species Human (GRCh38)
Location 5:178213018-178213040
Sequence GCCCCCAATGTGCTTCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002293115_1002293117 3 Left 1002293115 5:178213018-178213040 CCAGGCTGAAGCACATTGGGGGC 0: 1
1: 0
2: 1
3: 26
4: 508
Right 1002293117 5:178213044-178213066 AACTTCAGGATGTTCCTCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 162
1002293115_1002293118 4 Left 1002293115 5:178213018-178213040 CCAGGCTGAAGCACATTGGGGGC 0: 1
1: 0
2: 1
3: 26
4: 508
Right 1002293118 5:178213045-178213067 ACTTCAGGATGTTCCTCCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002293115 Original CRISPR GCCCCCAATGTGCTTCAGCC TGG (reversed) Exonic
900279239 1:1855276-1855298 GCCCCCACTGCACTCCAGCCTGG + Intronic
900341473 1:2191331-2191353 GCCCCCACTGTCCTGCAGCCGGG - Intronic
901284038 1:8062308-8062330 GGCGCCACTGTACTTCAGCCTGG - Intergenic
902074581 1:13773668-13773690 CCCCCCACTGTACTCCAGCCTGG + Intronic
902248011 1:15134491-15134513 CTCCTCAATGTTCTTCAGCCCGG - Intergenic
902522689 1:17029765-17029787 TCCACCACTGTACTTCAGCCTGG - Intronic
902973687 1:20073491-20073513 GCCCCAAGTGGGTTTCAGCCAGG - Intronic
903127757 1:21259309-21259331 GGCCCCACTGCACTTCAGCCTGG - Intronic
903350967 1:22716373-22716395 GGCACCACTGTGCTCCAGCCTGG - Intronic
903410460 1:23138952-23138974 GGCACCACTGTACTTCAGCCTGG + Intronic
903883458 1:26528186-26528208 GCCCCCACTGCACTCCAGCCTGG - Intergenic
904134789 1:28303532-28303554 GGCCCCACTGTACTCCAGCCTGG - Intergenic
904514102 1:31039861-31039883 GCTGCCACTGTGCTCCAGCCTGG + Intronic
905756234 1:40511920-40511942 CCCACCACTGTGCTCCAGCCTGG - Intronic
905820081 1:40982261-40982283 GCCCGTCATGTGCTTCAGACTGG + Intronic
906025566 1:42670837-42670859 GGCGCCACTGTGCTCCAGCCTGG - Intronic
906302515 1:44693492-44693514 GGCACCACTGTGCTCCAGCCTGG - Intronic
906640273 1:47437436-47437458 GCTCCCACTGCGCTTCGGCCCGG + Exonic
907202318 1:52738252-52738274 GCCACCACTGTACTCCAGCCTGG - Intronic
907215107 1:52856410-52856432 GCCCCCACTGCACTCCAGCCTGG + Intronic
907457211 1:54583312-54583334 GACCCCCATGTGGTACAGCCAGG - Intronic
907885406 1:58588278-58588300 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
912364122 1:109118939-109118961 CACACCATTGTGCTTCAGCCTGG - Intronic
912721808 1:112026624-112026646 TCCCCCAATTTGATTCAGTCAGG + Intergenic
913128995 1:115820882-115820904 GGCACCACTGTGCTCCAGCCTGG + Intergenic
914218815 1:145658819-145658841 CACCCCACTGTGCTCCAGCCTGG - Intronic
915501863 1:156324669-156324691 GGCCCCACTGTGCTCCAGCCTGG - Intronic
915587908 1:156854289-156854311 GCCCACAGTGTGCCCCAGCCTGG - Exonic
915974843 1:160378583-160378605 CACCCCACTGTACTTCAGCCTGG - Intergenic
917954147 1:180075524-180075546 AACCCCACTGTGCTCCAGCCTGG + Intronic
918498925 1:185171865-185171887 GCCACCACTGCACTTCAGCCTGG + Intronic
918640889 1:186840017-186840039 TGCACCACTGTGCTTCAGCCTGG - Intronic
919521431 1:198593896-198593918 TACACCATTGTGCTTCAGCCTGG - Intergenic
919634732 1:199992526-199992548 GGCACCAATGTACTCCAGCCAGG - Intergenic
919912542 1:202120656-202120678 GCGGCCAATGTACTCCAGCCTGG - Intergenic
920330796 1:205206624-205206646 TGCCCCACTGTGCTCCAGCCTGG - Intronic
920934768 1:210421487-210421509 CGCCCCACTGTACTTCAGCCTGG - Intronic
921223387 1:212991854-212991876 CCCGCCAATGTACTCCAGCCTGG + Intronic
922532457 1:226354864-226354886 GGCGCCACTGTGCTCCAGCCTGG - Intergenic
923921887 1:238575421-238575443 CACCCCATTGTGCTCCAGCCTGG - Intergenic
924479934 1:244420748-244420770 CCCACCACTGTACTTCAGCCTGG - Intronic
924699069 1:246431686-246431708 GCCACCAATGCACTCCAGCCTGG + Intronic
1063372897 10:5533277-5533299 TCCCACACTGTGCTTCAGCCTGG - Intergenic
1063772619 10:9221573-9221595 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1064153507 10:12885032-12885054 TGCCCCATTGTGCTTGAGCCTGG - Intergenic
1064701855 10:18030304-18030326 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1064989305 10:21242159-21242181 GCCACCACTGTGCTCCAGCCTGG + Intergenic
1065047890 10:21760237-21760259 CACGCCACTGTGCTTCAGCCCGG + Intronic
1065287061 10:24196295-24196317 GGCCCCAATGTGCTCCTTCCAGG - Intronic
1065639536 10:27767866-27767888 CCCCCCACTGTGGTACAGCCTGG - Intergenic
1065692871 10:28353542-28353564 GGCACCACTGTGCTCCAGCCTGG - Intergenic
1065912197 10:30317896-30317918 GCCGCCACTGCACTTCAGCCTGG - Intronic
1066096477 10:32077090-32077112 ACCCCCATTGCACTTCAGCCTGG + Intergenic
1066262608 10:33743925-33743947 GCCCGCACTGCACTTCAGCCTGG - Intergenic
1066614121 10:37279106-37279128 GTCCCCATTCTGCTTCAGTCAGG + Intronic
1067022300 10:42812025-42812047 GCCCCAAATGTACTTCATCTTGG + Intronic
1068332447 10:55589035-55589057 CCCACCAATGCACTTCAGCCTGG + Intronic
1068636310 10:59351950-59351972 GGCGCCACTGTGCTCCAGCCTGG + Intronic
1068698351 10:59993529-59993551 CGCCCCACTGTACTTCAGCCTGG - Intergenic
1069440659 10:68425442-68425464 GCCGCCACTGTACTCCAGCCTGG - Intronic
1070763799 10:79044917-79044939 CCTCCCAATGAGCCTCAGCCTGG + Intergenic
1070836578 10:79450870-79450892 TGCCCCACTGTGCTCCAGCCTGG + Intergenic
1072333174 10:94373330-94373352 GGCACCACTGTGCTTCAGCCTGG - Intergenic
1072413375 10:95226531-95226553 GGCACCACTGTGCTCCAGCCTGG + Intronic
1072649550 10:97283975-97283997 GACACCACTGTGCTCCAGCCTGG - Intronic
1073404338 10:103284149-103284171 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1073421613 10:103428259-103428281 CTCGCCATTGTGCTTCAGCCTGG + Intronic
1075853247 10:125605643-125605665 GGCACCACTGTGCTCCAGCCTGG - Intronic
1076135723 10:128044786-128044808 GGCACCAATGTGGTCCAGCCAGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077205362 11:1339820-1339842 GACACCATTGTGCTCCAGCCTGG + Intergenic
1077598991 11:3559726-3559748 GTCACCAATGTCCTTCACCCCGG + Intergenic
1077639888 11:3872094-3872116 CACACCACTGTGCTTCAGCCTGG - Intronic
1077646352 11:3928912-3928934 TGCTCCAATGTGCTCCAGCCTGG - Intronic
1078257441 11:9670795-9670817 GGCCCCACTGTGCTCCAGCCTGG - Intronic
1078272131 11:9805664-9805686 GCCCCCACTGCACTGCAGCCTGG - Intronic
1079092037 11:17487831-17487853 GGCACCACTGTGCTCCAGCCTGG - Intergenic
1080118787 11:28650437-28650459 GCCTCCACTGTACTCCAGCCTGG + Intergenic
1081529510 11:43948246-43948268 ACCCCAAATGTGCTTCAGGAGGG - Intergenic
1082628558 11:55514314-55514336 CCTGCCACTGTGCTTCAGCCTGG + Intergenic
1083064008 11:59904954-59904976 GGCCCCACTGTACTCCAGCCTGG - Intergenic
1083132691 11:60640652-60640674 CACGCCACTGTGCTTCAGCCTGG - Intergenic
1083339953 11:61952507-61952529 GCCCCCACTGCACTCCAGCCTGG - Intronic
1083604283 11:63968407-63968429 GCCCCCACTGCACTCCAGCCTGG + Intergenic
1083788860 11:64971382-64971404 GCCCCCACTGAACTCCAGCCTGG + Intronic
1083911873 11:65714583-65714605 GCACTCAATGTTCTTCATCCGGG - Exonic
1084062136 11:66683109-66683131 GCCGCCACTGCGCTCCAGCCTGG - Intergenic
1084255072 11:67935627-67935649 GTCACCAATGTCCTTCACCCCGG + Intergenic
1085076921 11:73599356-73599378 GCCCCCACTTTACTCCAGCCTGG - Intergenic
1086255885 11:84875778-84875800 GCCACCACTGTACTCCAGCCTGG - Intronic
1087682876 11:101235126-101235148 GTCCCCACTCTGCTTCAGTCAGG + Intergenic
1088479453 11:110281119-110281141 GGTCCCACTGTGCTCCAGCCTGG + Intronic
1089024894 11:115259347-115259369 GGCACCACTGTGCTCCAGCCTGG - Intronic
1089297183 11:117476835-117476857 GCCCCAAATGTGCCTTTGCCAGG - Intronic
1089371459 11:117962233-117962255 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
1090386438 11:126359992-126360014 GCAGCCAAGGTGCTTCTGCCTGG - Intronic
1090819958 11:130333023-130333045 CCCACCATTGTGCTCCAGCCTGG - Intergenic
1091180810 11:133602712-133602734 AACCCCAATGTCCTTCAGCCAGG - Intergenic
1091416526 12:291944-291966 GGCTCCATTGTGCTCCAGCCTGG - Intronic
1092352482 12:7766882-7766904 CGCCCCACTGTGCTCCAGCCTGG - Intronic
1092437013 12:8457064-8457086 TGCCTCATTGTGCTTCAGCCTGG + Intronic
1093767194 12:22978567-22978589 CCCACCAGTGTGCTCCAGCCTGG + Intergenic
1094196395 12:27754208-27754230 GGCCCCACTGTACTCCAGCCTGG + Intronic
1094333418 12:29321383-29321405 GGCCCCACTGCGCTCCAGCCTGG + Intronic
1094539227 12:31349182-31349204 CACGCCATTGTGCTTCAGCCTGG - Intergenic
1095378218 12:41557105-41557127 GCCACCACTGTACTCCAGCCTGG + Intronic
1095673616 12:44890772-44890794 GCCACCATTGTACTCCAGCCTGG - Intronic
1096597672 12:52707077-52707099 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
1096989853 12:55791649-55791671 GGCGCCACTGTGCTCCAGCCTGG + Intronic
1097897736 12:64842313-64842335 CACACCACTGTGCTTCAGCCTGG + Intronic
1098306689 12:69109534-69109556 GCCACCACTGCGCTCCAGCCTGG - Intergenic
1098359522 12:69641318-69641340 CACGCCACTGTGCTTCAGCCTGG - Intergenic
1099117313 12:78643453-78643475 CCCCCGACTGTGCTCCAGCCTGG + Intergenic
1099328880 12:81255750-81255772 TCCCCCACTGTACTCCAGCCTGG + Exonic
1100007754 12:89914044-89914066 GCCCCCACTGCACTTCAGCCTGG + Intergenic
1100836114 12:98568713-98568735 GGCGCCACTGTACTTCAGCCTGG + Intergenic
1101955421 12:109208258-109208280 TCCCCCACTGTACTCCAGCCTGG - Intronic
1102244296 12:111345400-111345422 GCCCCCACTGCACTCCAGCCTGG + Intronic
1102244395 12:111346062-111346084 GCCCCCACTGCACTCCAGCCTGG + Intronic
1102379710 12:112454171-112454193 GAGCCAACTGTGCTTCAGCCTGG - Intronic
1103395044 12:120600820-120600842 GTCCTCAATGTCATTCAGCCTGG + Intergenic
1103405870 12:120674845-120674867 CCCGCCACTGTGCTCCAGCCTGG + Intergenic
1103621150 12:122188148-122188170 GGCGCCAATGCGCTCCAGCCTGG - Intronic
1103652858 12:122446477-122446499 TGCGCCACTGTGCTTCAGCCTGG + Intergenic
1104416771 12:128602163-128602185 GGCACCAGTGTGCTGCAGCCCGG + Intronic
1107255122 13:38416966-38416988 GCCATCATTGTGCTCCAGCCTGG - Intergenic
1108039001 13:46322036-46322058 CGCACCACTGTGCTTCAGCCAGG - Intergenic
1108345167 13:49538670-49538692 CACACCACTGTGCTTCAGCCTGG + Intronic
1108795588 13:54025807-54025829 TGCCCCACTGTGCTCCAGCCTGG + Intergenic
1109898251 13:68723989-68724011 GCCGCCACTGCACTTCAGCCTGG - Intergenic
1110177517 13:72574510-72574532 CGCACCACTGTGCTTCAGCCTGG + Intergenic
1110307674 13:74008862-74008884 GCTCCCAACCTGCTTCAGGCAGG + Intronic
1110725875 13:78822928-78822950 GCGCCCACTGCACTTCAGCCTGG + Intergenic
1111543697 13:89701526-89701548 TCCCCCACTGTGATCCAGCCTGG + Intergenic
1113502139 13:110784274-110784296 ATCCCAAATGTGCTTCAGACAGG + Intergenic
1115050834 14:29060688-29060710 GCCTCCACTGTGCTCCAGCATGG + Intergenic
1115991988 14:39159864-39159886 GGCCCCACTGTACTGCAGCCTGG - Intronic
1116847005 14:49874314-49874336 GCCACTACTGTGCTCCAGCCTGG - Intergenic
1118018832 14:61689970-61689992 GGCACCACTGTGCTCCAGCCTGG - Intergenic
1118330392 14:64810634-64810656 CCCACCACTGTGCTCCAGCCTGG + Intronic
1119723539 14:76907851-76907873 GGCCCCATTGTACTCCAGCCTGG + Intergenic
1119726810 14:76926391-76926413 CCCGCCACTGTACTTCAGCCTGG + Intergenic
1121223289 14:92302474-92302496 GGCGCCACTGTGCTTCAGCCTGG + Intergenic
1121228807 14:92341373-92341395 GCCCCGAAAGGCCTTCAGCCTGG + Intronic
1121339684 14:93097964-93097986 GCCGCCAATGCACTCCAGCCTGG + Intronic
1121795524 14:96732337-96732359 ACCACCACTGTGCTTCAGCCTGG - Intergenic
1122293086 14:100689913-100689935 CGCCCCATTGTGCTCCAGCCTGG - Intergenic
1122483165 14:102060756-102060778 GGCGCCATTGTGCTCCAGCCTGG + Intergenic
1123423412 15:20148918-20148940 GCCCCAAATGTACTTCATCTTGG + Intergenic
1123532633 15:21155439-21155461 GCCCCAAATGTACTTCATCTTGG + Intergenic
1124034892 15:26045984-26046006 GACACCACTGCGCTTCAGCCTGG + Intergenic
1124364553 15:29062823-29062845 GGCCCCAAGCTGCTGCAGCCGGG - Intronic
1124719307 15:32098015-32098037 GCCCTGAATGTCCTTCTGCCGGG + Intronic
1125624966 15:41100870-41100892 CACCCCATTGTGCTCCAGCCTGG - Intronic
1125652497 15:41329020-41329042 CCCGCCACTGTGCTCCAGCCTGG + Intronic
1125879497 15:43181543-43181565 TGCACCACTGTGCTTCAGCCTGG - Intronic
1126822425 15:52517665-52517687 CGCACCAATGTGCTCCAGCCTGG + Intronic
1128370169 15:67034541-67034563 GCCCCCATTGTCCTGCAGCTGGG + Intergenic
1129278697 15:74466032-74466054 TGCACCAATGTACTTCAGCCTGG - Intergenic
1129338756 15:74871408-74871430 ACCTCCACTGTGCTACAGCCTGG + Intronic
1130083894 15:80761335-80761357 TGCACCACTGTGCTTCAGCCTGG - Intergenic
1130189896 15:81724100-81724122 GACCCCAATGTGCCCAAGCCAGG + Intergenic
1130390335 15:83448617-83448639 GCCCCCATTTTGCTAGAGCCAGG + Intronic
1130846329 15:87750516-87750538 GACACCACTGTGCTCCAGCCTGG - Intergenic
1131173364 15:90193893-90193915 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1131375760 15:91921771-91921793 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1131713426 15:95080655-95080677 GGCCCCACTGCACTTCAGCCTGG - Intergenic
1131813486 15:96198851-96198873 AGCACCAATGTGCTCCAGCCTGG - Intergenic
1132497991 16:272903-272925 GCCCCCGATGTGCTGGAGCAGGG - Exonic
1132783846 16:1643495-1643517 CCCTCCACTGTGCTCCAGCCTGG + Intronic
1133373104 16:5260953-5260975 GTCACCAATGTCCTTCACCCCGG - Intergenic
1133925286 16:10187311-10187333 GCACCCAATGTGCTTCCTCTTGG - Intergenic
1134190574 16:12118051-12118073 CCCACCACTGTACTTCAGCCTGG + Intronic
1134501345 16:14771302-14771324 GACACCACTGTGCTCCAGCCTGG - Intronic
1134579227 16:15357612-15357634 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134579239 16:15357738-15357760 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134723346 16:16399815-16399837 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134723358 16:16399941-16399963 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134944070 16:18311929-18311951 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134944082 16:18312055-18312077 GACACCACTGTGCTCCAGCCTGG + Intergenic
1135015051 16:18918217-18918239 GGCACCATTGTGCTCCAGCCTGG + Intronic
1136232712 16:28896454-28896476 GGCCCCACTGCACTTCAGCCTGG - Intronic
1136332148 16:29587189-29587211 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1136446844 16:30327255-30327277 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1136464361 16:30431800-30431822 CGCGCCACTGTGCTTCAGCCTGG + Intergenic
1136510148 16:30732874-30732896 CCCACCAATGCACTTCAGCCTGG - Intronic
1136861409 16:33706689-33706711 GCCCCAAATGTACTTCATCTTGG - Intergenic
1137227880 16:46532395-46532417 GCCCCTAATGAGCTTCAGGATGG - Intergenic
1138091953 16:54182050-54182072 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1139436160 16:66937824-66937846 GGCCCCAAGGAGCCTCAGCCTGG + Intronic
1139867690 16:70076219-70076241 TCCTCCATTGTGCTCCAGCCTGG - Intergenic
1139904338 16:70353164-70353186 GCCCCCACTGTACTCCAGCCTGG - Intronic
1140198106 16:72872499-72872521 CACCCCACTGTGCTCCAGCCTGG - Intronic
1140387642 16:74555643-74555665 TCCTCCATTGTGCTCCAGCCTGG + Intronic
1140435245 16:74941646-74941668 GTCCCCACTGTACTCCAGCCTGG + Intronic
1141405212 16:83786629-83786651 GACGCCACTGTACTTCAGCCTGG - Intronic
1141577916 16:84976594-84976616 GCCCACACTGTGCTTGAGCACGG - Intronic
1141735934 16:85853241-85853263 GGCACCACTGTACTTCAGCCTGG + Intergenic
1142143869 16:88484589-88484611 GCCCCCATCGTGCTTCACACAGG + Intronic
1142164012 16:88575755-88575777 TGCATCAATGTGCTTCAGCCTGG - Intronic
1203122908 16_KI270728v1_random:1554880-1554902 GCCCCAAATGTACTTCATCTTGG - Intergenic
1142758225 17:2028259-2028281 GCCCCCAATGTCCTGCACCACGG + Intergenic
1143093772 17:4465682-4465704 GCCACCAATGTGCTCCAGCCTGG + Intronic
1143579915 17:7819419-7819441 GCCCCCAACATGCCCCAGCCCGG + Intronic
1143634763 17:8158227-8158249 CACCCCACTGTGCTCCAGCCTGG - Intronic
1143723345 17:8828767-8828789 GCCCCCTTTGCGCTGCAGCCCGG + Exonic
1144123955 17:12183596-12183618 CCCGCCACTGTACTTCAGCCTGG - Intergenic
1144216353 17:13058820-13058842 GGCCCCACTGTACTCCAGCCTGG + Intergenic
1145037271 17:19550163-19550185 GATCCCACTGTACTTCAGCCTGG - Intronic
1146323379 17:31864664-31864686 GCCACCATTGTACTCCAGCCTGG - Intronic
1146848718 17:36203062-36203084 GCCCCCACTGCACTCCAGCCTGG - Intronic
1147750141 17:42726553-42726575 GGCACCATTGTACTTCAGCCTGG - Intronic
1147892841 17:43729452-43729474 GGCCCCACTGTACTCCAGCCTGG - Intergenic
1148730776 17:49834958-49834980 CCCACCAGTGTGCTCCAGCCTGG + Exonic
1148999702 17:51744567-51744589 GCTACCACTGTACTTCAGCCTGG + Intronic
1149213700 17:54330666-54330688 GTCCCCAATCTGTTTCAGTCAGG - Intergenic
1149396396 17:56249388-56249410 CGCCCCACTGTGCTCCAGCCTGG + Intronic
1149787041 17:59444572-59444594 CCCACCATTGTGCTCCAGCCTGG - Intergenic
1149888859 17:60367762-60367784 GGCCCCACTGTACTCCAGCCTGG + Intronic
1149908064 17:60544992-60545014 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1150096893 17:62384569-62384591 CGCACCACTGTGCTTCAGCCTGG + Intronic
1150615873 17:66771045-66771067 GCCCCCACTGCACTCCAGCCTGG - Intronic
1150755348 17:67907139-67907161 GAACCCACTGTGCTCCAGCCTGG + Intronic
1151663898 17:75534522-75534544 GGCACCACTGTGCTCCAGCCTGG - Intronic
1151764375 17:76124598-76124620 GCCCCAACTCTGCTCCAGCCAGG + Intergenic
1151948876 17:77337043-77337065 GGCACCACTGTGCTACAGCCTGG - Intronic
1152392805 17:80012805-80012827 GGCCCCAGTGTCCTGCAGCCTGG - Intronic
1152787476 17:82256467-82256489 GGCACCACTGTGCTCCAGCCTGG + Intronic
1155138434 18:23019803-23019825 CGCGCCACTGTGCTTCAGCCTGG - Intronic
1156269862 18:35520750-35520772 CCCCCCACTGTGCTCCAGCCTGG + Intergenic
1156314990 18:35961316-35961338 TGCACCACTGTGCTTCAGCCTGG - Intergenic
1156739631 18:40308886-40308908 GGCACCACTGTGCTCCAGCCTGG - Intergenic
1157767298 18:50309526-50309548 GGCACCACTGTACTTCAGCCTGG - Intergenic
1158496919 18:57964096-57964118 GCCACCACTGCACTTCAGCCTGG + Intergenic
1161425985 19:4203388-4203410 TGCCCCACTGTACTTCAGCCTGG - Intronic
1161952993 19:7477976-7477998 GGCACCACTGTGCTCCAGCCTGG + Intronic
1162162247 19:8726991-8727013 CACCCCATTGTACTTCAGCCTGG - Intergenic
1162848371 19:13411753-13411775 TGCACCATTGTGCTTCAGCCTGG - Intronic
1162872172 19:13594805-13594827 GCCCCCACTGGACTCCAGCCTGG + Intronic
1163699589 19:18780659-18780681 GCCCCCCATGGGCTTCTGGCAGG - Exonic
1165174310 19:33916226-33916248 CACACCAATGTGCTCCAGCCTGG - Intergenic
1165465286 19:35971004-35971026 GGCGCCACTGTGCTCCAGCCTGG - Intergenic
1166016971 19:39988815-39988837 GCCACCACTGTACTCCAGCCTGG + Intronic
1166292885 19:41874421-41874443 GCCGCCACTGCACTTCAGCCTGG + Intergenic
1167016612 19:46845053-46845075 GCCCCCATTGCACTCCAGCCTGG + Intronic
1167296408 19:48652894-48652916 GCCACCACTGTGCTCCAGCCTGG - Intergenic
1168058298 19:53875804-53875826 GGCACCACTGTGCTCCAGCCTGG + Exonic
1168417638 19:56179131-56179153 GGCACCACTGCGCTTCAGCCTGG + Intronic
1168529427 19:57116000-57116022 CCCACCAATGTACTCCAGCCTGG + Intergenic
925035035 2:678466-678488 CCCACCATTGTGCTCCAGCCTGG - Intergenic
925491470 2:4399823-4399845 GACACCACTGTGCTCCAGCCTGG + Intergenic
926134181 2:10325187-10325209 GGCACCAGTGTGCTCCAGCCTGG - Intronic
926678893 2:15649345-15649367 GGCACCATTGTGCTCCAGCCTGG + Intergenic
927142458 2:20139749-20139771 ACCCCCAATAAGCATCAGCCTGG + Intergenic
927351380 2:22120882-22120904 GCCACCAATGTGTTCCAGCCTGG - Intergenic
927762421 2:25771191-25771213 GCACCCACTGTACTCCAGCCTGG + Intronic
927901678 2:26823916-26823938 GACACCACTGTACTTCAGCCTGG + Intergenic
927947202 2:27142652-27142674 TGCGCCACTGTGCTTCAGCCTGG + Intergenic
928193525 2:29195689-29195711 GGCGCCACTGTGCTCCAGCCCGG + Intronic
928519459 2:32074547-32074569 GCCCCCACTGAACTCCAGCCTGG - Intronic
928633534 2:33218438-33218460 TGCCCCACTGTGCTCCAGCCTGG - Intronic
928749337 2:34453768-34453790 GGCACCACTGTACTTCAGCCTGG - Intergenic
929139781 2:38656696-38656718 GGCACCAATGCACTTCAGCCTGG + Intergenic
929676152 2:43932078-43932100 GCCACCACTGTACTACAGCCTGG + Intronic
930690511 2:54358443-54358465 TGCACCACTGTGCTTCAGCCTGG - Intronic
932620002 2:73259641-73259663 CCCTCCTTTGTGCTTCAGCCTGG - Intronic
932875731 2:75449402-75449424 GACACCATTGTGCTTCAGTCTGG + Intergenic
933653991 2:84872454-84872476 TGCACCACTGTGCTTCAGCCTGG + Intronic
934965670 2:98719687-98719709 GCCCCCACTGTACTCCAGTCTGG - Intronic
936460975 2:112713624-112713646 GCTCCCACTGAGGTTCAGCCAGG - Intergenic
937446454 2:121962724-121962746 GCCCCTCTTCTGCTTCAGCCAGG - Intergenic
938055945 2:128214814-128214836 GGCCCCACTGTGCTCCAGCCTGG - Intergenic
938387097 2:130874318-130874340 CCCACCAATGTGCTTCCACCAGG - Intronic
938931306 2:136088775-136088797 GGCGCCACTGTACTTCAGCCTGG - Intergenic
939253480 2:139713819-139713841 GGCACCACTGTGCTCCAGCCTGG + Intergenic
940291282 2:152079740-152079762 GGCGCCACTGTGCTCCAGCCTGG + Intronic
940297605 2:152144580-152144602 GGCACCACTGTGCTCCAGCCTGG - Intronic
941854758 2:170219598-170219620 GCCACCACTGCACTTCAGCCTGG + Intronic
941942198 2:171052213-171052235 TCCCCCACTGTGCTCTAGCCTGG + Intronic
943529325 2:189059635-189059657 GCCACCATTGTACTCCAGCCTGG - Intronic
943693134 2:190890225-190890247 GGCACCAATGTACTCCAGCCTGG - Intronic
944088001 2:195871340-195871362 GGCACCACTGCGCTTCAGCCTGG - Intronic
944408005 2:199407240-199407262 GGCACCACTGTGCTCCAGCCTGG + Intronic
944620904 2:201515276-201515298 TCCACCACTGTGCTCCAGCCTGG - Intronic
944774871 2:202953058-202953080 GCCACCAATGTACTCCAGCCTGG - Intronic
945747755 2:213739643-213739665 CCCACCATTGTGCTCCAGCCTGG - Intronic
945880685 2:215321945-215321967 GACGCCACTGTGCTCCAGCCTGG - Intronic
947012706 2:225583087-225583109 GCACACAATGGGCTTCACCCTGG - Intronic
947522112 2:230854920-230854942 CACACCATTGTGCTTCAGCCTGG - Intergenic
948959593 2:241322560-241322582 TCACCCACTGTACTTCAGCCCGG + Intronic
1169128087 20:3145481-3145503 GACACCACTGTGCTTTAGCCTGG - Intronic
1169250625 20:4058158-4058180 AGCCCCACTGTGCTCCAGCCTGG - Intergenic
1170692623 20:18629038-18629060 GGCGCCATTGTGCTCCAGCCTGG - Intronic
1172682406 20:36726958-36726980 CGCCCCACTGTGCTCCAGCCTGG - Intronic
1173472926 20:43337591-43337613 GGCCCCACTGTACTTCAGCCTGG - Intergenic
1173682953 20:44899434-44899456 CCCACCACTGTACTTCAGCCTGG + Intronic
1174262440 20:49306363-49306385 CGCGCCACTGTGCTTCAGCCTGG + Intergenic
1174604518 20:51751162-51751184 GCCCACAATGGGCTTCAGTGAGG - Intronic
1174802015 20:53572368-53572390 GCCCCCACTGCACTCCAGCCTGG + Intronic
1175972751 20:62695135-62695157 CCACCCAAGGTGCCTCAGCCTGG - Intergenic
1175981167 20:62739398-62739420 CCACCCTTTGTGCTTCAGCCAGG - Intronic
1176222080 20:63974538-63974560 GCCCTCACTGTCCTTCCGCCAGG + Exonic
1178484401 21:33008826-33008848 GCCCCAAATGCACCTCAGCCTGG - Intergenic
1181356415 22:22298649-22298671 GCCCCAAATGTACTTCATCTTGG + Intergenic
1182056101 22:27355909-27355931 GCCACCAATTTGCTTCATCCAGG - Intergenic
1182153257 22:28045924-28045946 GGCACCACTGTACTTCAGCCTGG + Intronic
1182605499 22:31499939-31499961 GCAACCACTGTGCTCCAGCCTGG + Intronic
1182638886 22:31751229-31751251 GCCCCCACTGCACTCCAGCCTGG + Intergenic
1182719698 22:32387155-32387177 TCCGCCACTGTACTTCAGCCTGG + Intergenic
1182847751 22:33445691-33445713 CCCGCCATTGTGCTCCAGCCTGG - Intronic
1183404743 22:37624922-37624944 GCCCCCACAGTCCTTCAGCCTGG + Intronic
1183672120 22:39279101-39279123 CACACCATTGTGCTTCAGCCTGG - Intergenic
1183799463 22:40149840-40149862 GGCACCACTGTACTTCAGCCTGG - Intronic
1183939067 22:41282361-41282383 GGCGCCACTGTGCTCCAGCCTGG - Exonic
1184248748 22:43248683-43248705 GCCCCCGCTTTCCTTCAGCCAGG + Intronic
1184563815 22:45279106-45279128 TGCCCCACTGTACTTCAGCCTGG + Intergenic
1184571389 22:45327194-45327216 GGCACCACTGTGCTCCAGCCTGG + Intronic
1184957879 22:47904041-47904063 CGCACCATTGTGCTTCAGCCTGG + Intergenic
949675656 3:6449979-6450001 TCCACCACTGTACTTCAGCCTGG + Intergenic
950409393 3:12825448-12825470 GCCCCTCATGTTCTTCTGCCAGG + Exonic
950751466 3:15132112-15132134 GTCACCAATGTCCTTCACCCCGG - Intergenic
951658952 3:25040707-25040729 CACACCACTGTGCTTCAGCCTGG + Intergenic
952262076 3:31749769-31749791 GGCACCACTGTGCTCCAGCCTGG + Intronic
952396499 3:32925448-32925470 GCCCCCATTGCACTCCAGCCTGG - Intergenic
953174597 3:40538466-40538488 TGCACCACTGTGCTTCAGCCTGG + Intronic
953564737 3:44021861-44021883 GCCCCCAACTTGCTGCAGCGGGG - Intergenic
953580049 3:44145622-44145644 GCCCCCTCCGTGCTTCTGCCAGG + Intergenic
954269453 3:49496214-49496236 TCCACCACTGTGCTCCAGCCTGG - Intronic
955280376 3:57589222-57589244 CGCACCACTGTGCTTCAGCCTGG + Intronic
956610096 3:71113667-71113689 CGCACCACTGTGCTTCAGCCTGG + Intronic
957462658 3:80541710-80541732 ACAGCCACTGTGCTTCAGCCTGG + Intergenic
960635195 3:119778014-119778036 GCCCCCACTGCACTCCAGCCTGG + Intergenic
962001193 3:131299250-131299272 GGCACCACTGTACTTCAGCCTGG - Intronic
962515223 3:136143745-136143767 GGCCCCACTGTACTCCAGCCTGG + Intronic
962571378 3:136716600-136716622 GGCACCAATGCACTTCAGCCGGG + Intronic
962739900 3:138355885-138355907 CGCGCCACTGTGCTTCAGCCTGG + Intronic
963198040 3:142555190-142555212 GGCGCCATTGTACTTCAGCCTGG + Intronic
964857021 3:161157616-161157638 TCCCTAAATGTGATTCAGCCTGG + Intronic
966611668 3:181873951-181873973 GCCCCCACTGCCCTTGAGCCTGG - Intergenic
967164315 3:186767013-186767035 GGCACCACTGTGCTCCAGCCTGG - Intergenic
967430477 3:189379168-189379190 GGCCCCACTGTACTCCAGCCTGG - Intergenic
968191664 3:196672718-196672740 CCGGCCACTGTGCTTCAGCCTGG - Intronic
969013476 4:4086707-4086729 GTCACCAATGTCCTTCACCCTGG + Intergenic
969083047 4:4634645-4634667 GGCGCCACTGTACTTCAGCCTGG + Intergenic
969089778 4:4685106-4685128 GCCGCCACTGTACTCCAGCCTGG - Intergenic
969459539 4:7321736-7321758 GCCCACAATGTTCTTCCCCCAGG - Intronic
969712125 4:8850400-8850422 GGCCACAATGAGCTTCAGCAGGG - Intronic
969740376 4:9021073-9021095 GTCACCAATGTCCTTCACCCCGG - Intergenic
969799717 4:9553891-9553913 GTCACCAATGTCCTTCACCCCGG - Intergenic
970863987 4:20738084-20738106 TGCACCACTGTGCTTCAGCCTGG + Intronic
971678408 4:29666084-29666106 GGCGCCACCGTGCTTCAGCCTGG + Intergenic
972540426 4:40034551-40034573 GGCACCACTGTACTTCAGCCTGG + Intergenic
973986744 4:56361926-56361948 GGCGCCACTGTGCTCCAGCCTGG + Intronic
974477060 4:62396231-62396253 GCCCCAAATGTGCATGAGCTGGG + Intergenic
975148810 4:70998877-70998899 GGCGCCACTGTGCTCCAGCCTGG + Intronic
975211122 4:71701264-71701286 GGCACCACTGTGCTCCAGCCTGG - Intergenic
976234701 4:82884029-82884051 CGCCCCACTGTGCTCCAGCCTGG - Intronic
977091884 4:92688091-92688113 GGCACCACTGTGCTCCAGCCTGG - Intronic
978499096 4:109389498-109389520 GCCCGCCATGTGTTTCAGCTTGG + Intergenic
980062641 4:128148671-128148693 CCCGCCACTGTGCTCCAGCCTGG - Intronic
981013911 4:139953573-139953595 GGCGCCAATGTACTCCAGCCTGG + Intronic
981035473 4:140164222-140164244 TGCCCCAGTGTACTTCAGCCTGG + Intergenic
981264502 4:142766423-142766445 GCCACCATTGCACTTCAGCCTGG - Intronic
981264822 4:142769868-142769890 CCCACCACTGTGCTCCAGCCTGG + Intronic
981700508 4:147602566-147602588 GCACCCACTGCACTTCAGCCTGG - Intergenic
981926831 4:150149457-150149479 GCATCCAGTGTCCTTCAGCCAGG + Intronic
983209792 4:164946721-164946743 GCTGCCATTGTGCTACAGCCTGG - Intergenic
983445322 4:167843185-167843207 GGCCCCATTGTACTTCAGACTGG + Intergenic
983891253 4:173032639-173032661 GGCGCCACTGTGCTTCAGCCTGG + Intronic
984401183 4:179267152-179267174 TGCCCCACTGTGCTCCAGCCTGG - Intergenic
984955552 4:185042212-185042234 GGCACCACTGTGCTCCAGCCTGG + Intergenic
984999972 4:185472746-185472768 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
985069036 4:186150308-186150330 ACACCCAAGGTGCTGCAGCCAGG - Intronic
985849036 5:2375015-2375037 CCTCCCAAAGTGCTTCGGCCTGG - Intergenic
987677158 5:21089476-21089498 GGCGCCACTGTGCTCCAGCCAGG - Intergenic
987789832 5:22550868-22550890 GCCCTCCCTATGCTTCAGCCAGG + Intronic
989500442 5:42160278-42160300 GGCACCACTGTGCTCCAGCCTGG + Intergenic
990007450 5:50960585-50960607 CCCGCCACTGTGCTCCAGCCTGG - Intergenic
990008969 5:50972730-50972752 CCCACCACTGTGCTCCAGCCTGG - Intergenic
992662833 5:78978285-78978307 GCCAACACTGTGCTCCAGCCTGG + Intronic
992688374 5:79219580-79219602 CCCGCCACTGTGCTCCAGCCGGG - Intronic
993238345 5:85345145-85345167 GATGCCACTGTGCTTCAGCCTGG + Intergenic
994035972 5:95201546-95201568 AGCACCAATGTGCTCCAGCCTGG - Intronic
994315830 5:98332086-98332108 CCCGCCACTGTGCTCCAGCCTGG - Intergenic
994922356 5:106063899-106063921 GCCCCCACTGCACTCCAGCCTGG + Intergenic
995018862 5:107344809-107344831 GGCACCACTGTGCTCCAGCCTGG - Intergenic
995231037 5:109763843-109763865 GGCGCCAGTGTGCTCCAGCCTGG - Intronic
995539129 5:113167347-113167369 TTCCCTGATGTGCTTCAGCCTGG + Intronic
995954901 5:117766035-117766057 GAGCCCACTGCGCTTCAGCCTGG - Intergenic
997898795 5:137744269-137744291 ACCACCACTGTGCTACAGCCTGG + Intergenic
997970496 5:138397462-138397484 GGCACCACTGTGCTCCAGCCTGG + Intronic
998533243 5:142904473-142904495 GCCACCACTGTACTCCAGCCTGG + Intronic
999519641 5:152338123-152338145 GCCACAAATGTGCTTCAGGTAGG + Intergenic
1000005959 5:157185280-157185302 GGCACCACTGTGCTCCAGCCTGG - Intronic
1000013750 5:157258580-157258602 CCCGCCACTGTGCTCCAGCCTGG + Intergenic
1001393061 5:171395999-171396021 GCCAACAATGCACTTCAGCCGGG - Intronic
1001608809 5:172983655-172983677 GCCTCCAAGGAGCTGCAGCCAGG + Intergenic
1002293115 5:178213018-178213040 GCCCCCAATGTGCTTCAGCCTGG - Exonic
1002610204 5:180412708-180412730 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1002684531 5:180998028-180998050 GGCACCACTGTGCTCCAGCCTGG + Intronic
1002803894 6:552959-552981 GGCTCCACTGTGCTCCAGCCTGG - Intronic
1004382214 6:15142300-15142322 GACACCACTGTGCTCCAGCCTGG - Intergenic
1005608416 6:27499295-27499317 GGCACCACTGTGCTCCAGCCAGG - Intergenic
1006396331 6:33789707-33789729 GCCCCCAAGGAGCGCCAGCCTGG + Intergenic
1006733173 6:36251899-36251921 GGCACCACTGTACTTCAGCCTGG + Intronic
1006889342 6:37412258-37412280 TGCCCCACTGTGCTCCAGCCTGG - Intergenic
1007001153 6:38314237-38314259 CACCCCACTGTGCTGCAGCCTGG - Intronic
1007331820 6:41116989-41117011 CACACCAATGTGCTCCAGCCTGG + Intergenic
1007377837 6:41468639-41468661 GCACCCCTTGTGCTTCTGCCAGG + Intergenic
1007568838 6:42874519-42874541 TGCGCCACTGTGCTTCAGCCTGG - Intergenic
1008570297 6:52810529-52810551 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1008717961 6:54312098-54312120 GGCGCCACTGTACTTCAGCCTGG - Intronic
1010445581 6:75945391-75945413 GCCCCCACTGCACTCCAGCCTGG - Intronic
1010687593 6:78870752-78870774 GCCTCCATTGTACTCCAGCCTGG - Intronic
1011479271 6:87778320-87778342 GGCGCCACTGTGCTCCAGCCTGG - Intergenic
1012894129 6:104929431-104929453 GGCACCATTGTACTTCAGCCTGG + Intergenic
1013691403 6:112648995-112649017 GCCCCCACTGTACTCCAGCCTGG + Intergenic
1014426215 6:121309989-121310011 TGCGCCACTGTGCTTCAGCCTGG + Intronic
1014673997 6:124342549-124342571 CATCCCACTGTGCTTCAGCCTGG - Intronic
1015256203 6:131182080-131182102 GGCACCAATGTACTCCAGCCTGG + Intronic
1015302647 6:131671424-131671446 TCCCCCCATGTGCTTCAGAAGGG - Intronic
1015490338 6:133817816-133817838 TCCCCCACTGTGCTCCAGCCTGG + Intergenic
1015540270 6:134306565-134306587 GCCACCACTGTACTCCAGCCTGG - Intronic
1017069524 6:150561997-150562019 GCCACCACTGCACTTCAGCCTGG + Intergenic
1017435878 6:154415272-154415294 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1017672605 6:156779894-156779916 GCCCACAATGTGCTTTAACGGGG + Intronic
1019115807 6:169761258-169761280 GGCTCCAATGCACTTCAGCCTGG - Intronic
1019398888 7:839591-839613 GCCACCACTGTACTCCAGCCTGG - Intronic
1019756085 7:2771245-2771267 GTCGCCACTGTACTTCAGCCTGG + Intronic
1019819911 7:3234663-3234685 TCCACCACTGTGCTCCAGCCTGG + Intergenic
1020059417 7:5141134-5141156 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
1020099583 7:5387736-5387758 GCCGCCACTGTCCTTCTGCCGGG + Exonic
1021551468 7:21875615-21875637 CACACCACTGTGCTTCAGCCTGG + Intronic
1022011730 7:26313845-26313867 GCCTCCACTGCACTTCAGCCTGG - Intronic
1023437882 7:40156969-40156991 GGCACCACTGTACTTCAGCCTGG + Intronic
1023517624 7:41017725-41017747 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1023827593 7:44019829-44019851 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1026060871 7:67024735-67024757 GACGCCACTGTGCTCCAGCCTGG + Intronic
1026590028 7:71686422-71686444 GGCACCACTGTGCTCCAGCCTGG - Intronic
1026997089 7:74624557-74624579 GGCCCCACTGTACTCCAGCCTGG + Intergenic
1028034202 7:85959273-85959295 GTCACCACTGTGCTCCAGCCTGG - Intergenic
1028084534 7:86619923-86619945 GCCTCCAATGTACTCCAGCCTGG - Intergenic
1029072123 7:97908325-97908347 GTCACCAATGTCCTTCACCCCGG + Intergenic
1029114758 7:98231435-98231457 ACCCCCACTGTGCTTCACCCTGG + Intronic
1029710784 7:102298468-102298490 GGCACCACTGTACTTCAGCCTGG - Intronic
1029720063 7:102357572-102357594 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1029738767 7:102479598-102479620 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1029752550 7:102551685-102551707 GGCACCATTGTGCTCCAGCCTGG - Intronic
1029755893 7:102573255-102573277 GGCGCCACTGTACTTCAGCCTGG - Intronic
1029770501 7:102650778-102650800 GGCACCATTGTGCTCCAGCCTGG - Intronic
1029773835 7:102672328-102672350 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1029811430 7:103053194-103053216 TGCGCCACTGTGCTTCAGCCTGG - Intronic
1030857595 7:114580535-114580557 ACCACCACTGTGCTCCAGCCTGG + Intronic
1032377097 7:131431176-131431198 GGCACCACTGTGCTCCAGCCTGG + Intronic
1032404295 7:131644554-131644576 CGCCCCACTGTGCTCCAGCCTGG + Intergenic
1033089904 7:138375932-138375954 TGCCCCACTGTACTTCAGCCCGG + Intergenic
1033199102 7:139353151-139353173 CCCGCCACTGTACTTCAGCCTGG + Intronic
1033358538 7:140621070-140621092 GCCACCACTGTACTCCAGCCTGG - Intronic
1034998893 7:155595779-155595801 GCACCCACTGTACTCCAGCCTGG - Intergenic
1035474668 7:159134699-159134721 GGCCCCACTGTACTCCAGCCTGG - Intronic
1035881079 8:3244622-3244644 GCCCCCAAAATGTTTCACCCTGG - Intronic
1036136416 8:6165690-6165712 GCCCTAAGTGTGCTCCAGCCTGG + Intergenic
1036245577 8:7113637-7113659 GTCACCAATGTCCTTCACCCCGG - Intergenic
1036888691 8:12580358-12580380 GTCACCAATGTCCTTCACCCCGG + Intergenic
1036896290 8:12638496-12638518 GTCACCAATGTCCTTCATCCCGG + Intergenic
1036904911 8:12699930-12699952 GCCCCCAATGTGCACCACGCAGG - Intergenic
1037580438 8:20242578-20242600 CACACCACTGTGCTTCAGCCTGG + Intergenic
1037784850 8:21896467-21896489 GCCCCTGATGTGATTCAGGCAGG - Intergenic
1037957854 8:23072642-23072664 GCCCTCCCTGTGCTACAGCCTGG + Intergenic
1038194575 8:25355188-25355210 GGTGCCACTGTGCTTCAGCCTGG + Intronic
1038364691 8:26919172-26919194 GCCACTACTGTACTTCAGCCTGG + Intergenic
1038773549 8:30506895-30506917 GCACCCAATGTGCTAGACCCTGG + Intronic
1039391350 8:37183318-37183340 GCCCCAAATGAGCTTGAGCTGGG + Intergenic
1039583812 8:38688482-38688504 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1039615649 8:38952993-38953015 TCCACCACTGTGCTCCAGCCTGG - Intronic
1039630712 8:39108240-39108262 GCCCCCACTGGACTCCAGCCTGG + Intronic
1041076787 8:54176292-54176314 GGCGCCACTGTGCTCCAGCCTGG - Intergenic
1042433227 8:68733018-68733040 CACCCCACTGTGCTCCAGCCTGG + Intronic
1042921314 8:73922890-73922912 GACACCACTGTGCTTTAGCCTGG - Intergenic
1043847038 8:85176022-85176044 GCCACCACTGCACTTCAGCCTGG - Intergenic
1044162878 8:88942929-88942951 TCCACCACTGTACTTCAGCCTGG - Intergenic
1044607550 8:94060388-94060410 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1044715895 8:95099194-95099216 TGCCCCACTGTGCTCCAGCCTGG + Intronic
1044985045 8:97749534-97749556 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1045278353 8:100727010-100727032 TGCACCACTGTGCTTCAGCCTGG + Intergenic
1046792323 8:118335229-118335251 GCTCCCAATGTGGCTCATCCAGG + Intronic
1049111060 8:140643734-140643756 GCCCCCATTGCACTCCAGCCTGG + Intergenic
1049678722 8:143905572-143905594 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1049906357 9:220762-220784 GGCCCCACTGTACTCCAGCCTGG - Intronic
1049953707 9:671570-671592 GGCGCCACTGTGCTCCAGCCTGG + Intronic
1051635840 9:19180304-19180326 CCCACCACTGTACTTCAGCCTGG - Intergenic
1053669313 9:40345358-40345380 TACTCCACTGTGCTTCAGCCTGG + Intergenic
1053684166 9:40506033-40506055 TGCACCATTGTGCTTCAGCCCGG + Intergenic
1053934136 9:43134315-43134337 TGCGCCATTGTGCTTCAGCCCGG + Intergenic
1054279557 9:63118920-63118942 TGCACCATTGTGCTTCAGCCCGG - Intergenic
1054297260 9:63341497-63341519 TGCACCATTGTGCTTCAGCCCGG + Intergenic
1054380445 9:64485380-64485402 TACTCCACTGTGCTTCAGCCTGG + Intergenic
1054395280 9:64646005-64646027 TGCACCATTGTGCTTCAGCCCGG + Intergenic
1054429927 9:65151205-65151227 TGCACCATTGTGCTTCAGCCCGG + Intergenic
1054500457 9:65870327-65870349 TGCACCATTGTGCTTCAGCCCGG - Intergenic
1054515303 9:66030932-66030954 TACTCCACTGTGCTTCAGCCTGG - Intergenic
1055544690 9:77357273-77357295 GGCCCCACTGCGCTCCAGCCTGG + Intronic
1055871001 9:80879690-80879712 GCCCCCATTGCACTCCAGCCTGG + Intergenic
1056477856 9:86970225-86970247 GGCCCCACTGTGCTCCAGCCTGG - Intergenic
1056692936 9:88823638-88823660 GCCCCCATAGTGCTTCAGCTTGG + Intergenic
1058689359 9:107506342-107506364 GTGCCCACTGTGCTCCAGCCTGG - Intergenic
1060198736 9:121639696-121639718 GCACCCCATGTGCTGCAGGCAGG - Intronic
1060498559 9:124135450-124135472 CGCCCCACTGTGCTCCAGCCTGG - Intergenic
1061142409 9:128775723-128775745 GGCGCCAATGCACTTCAGCCTGG + Intergenic
1062483314 9:136762433-136762455 GCCCCAAGTTTCCTTCAGCCAGG - Intronic
1203428927 Un_GL000195v1:70757-70779 CACACCACTGTGCTTCAGCCTGG + Intergenic
1185781114 X:2847659-2847681 GGCACCACTGTGCTCCAGCCTGG + Intronic
1186416212 X:9385042-9385064 GCCCCAAATTTGCATAAGCCAGG - Intergenic
1187347961 X:18484356-18484378 GCCACCACTGCACTTCAGCCTGG - Intronic
1187917955 X:24173627-24173649 GGCGCCACTGTGCTCCAGCCTGG - Intronic
1188220410 X:27534165-27534187 CACACCACTGTGCTTCAGCCTGG + Intergenic
1188391393 X:29624801-29624823 GCCCCCACTGCACTCCAGCCTGG + Intronic
1189159359 X:38795000-38795022 GCATCCAATTTGCTTCAACCTGG + Intergenic
1189478419 X:41374900-41374922 ACCCCAAATGCGCTTCAGGCTGG - Intergenic
1189633538 X:42980190-42980212 CCCCTATATGTGCTTCAGCCAGG - Intergenic
1190803645 X:53814577-53814599 GCCGCCACTGTACTCCAGCCTGG + Intergenic
1191056959 X:56252054-56252076 GCCACCACTGTACTCCAGCCTGG - Intronic
1191937064 X:66437566-66437588 GCTCCAAATGCTCTTCAGCCTGG - Intergenic
1192344955 X:70295018-70295040 GCACACACTGTGCTGCAGCCTGG + Intronic
1192431533 X:71115746-71115768 GACCCCACTGCACTTCAGCCTGG - Intergenic
1194375842 X:93132674-93132696 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
1195080338 X:101364363-101364385 GGCGCCATTGTGCTCCAGCCTGG + Intronic
1195571948 X:106406919-106406941 GGCGCCACTGTGCTCCAGCCTGG + Intergenic
1196850267 X:119931139-119931161 CACACCACTGTGCTTCAGCCTGG + Intronic
1197887851 X:131236784-131236806 CTCCCTAATGTGGTTCAGCCTGG - Intergenic
1198163967 X:134035050-134035072 GCCCCAAATGCTCTTCATCCAGG + Intergenic
1198802092 X:140458499-140458521 GCCATCACTGTGCTCCAGCCTGG - Intergenic
1199975495 X:152892774-152892796 CCCCCCAAAGTGCTTATGCCTGG - Intergenic
1201288961 Y:12403848-12403870 GGCACCACTGTGCTCCAGCCTGG + Intergenic
1201361345 Y:13153380-13153402 GTCCCCACTGTACTCCAGCCTGG - Intergenic
1202104362 Y:21347139-21347161 GGCCCCATTGTACTCCAGCCTGG - Intergenic