ID: 1002294669

View in Genome Browser
Species Human (GRCh38)
Location 5:178223763-178223785
Sequence GACAACAGAGGGAAGACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002294669 Original CRISPR GACAACAGAGGGAAGACTGT TGG (reversed) Intronic
901256045 1:7827516-7827538 GACAACAGAGGACAGACAGGGGG - Exonic
901902665 1:12379136-12379158 TACAACAGAAAAAAGACTGTTGG + Intronic
904740191 1:32668778-32668800 GACATCAGAAGGAAGGCTATGGG + Exonic
907416833 1:54320252-54320274 GACCACAGAGGGAAGACATCTGG + Intronic
908201857 1:61805783-61805805 GACAATAGACAGAAAACTGTTGG + Intronic
908338831 1:63155341-63155363 GAGAACAGAGGGTAGAATGGAGG + Intergenic
908515757 1:64891411-64891433 GTCTACAGAAGGAAGAGTGTTGG - Intronic
909893117 1:81032799-81032821 GACCAGAGAGGGAAGACAGTTGG + Intergenic
912218216 1:107641312-107641334 GAAATCAGAGAAAAGACTGTTGG - Intronic
912233545 1:107823011-107823033 GATATAATAGGGAAGACTGTGGG + Intronic
912250630 1:108008772-108008794 GTCAACAGAAGGTAGACAGTTGG - Intergenic
912310073 1:108611393-108611415 AACAACAGAGGAAAGACTATAGG + Intronic
912958643 1:114175069-114175091 GACAATAGAGGGATGGCTGGAGG + Intergenic
913056548 1:115166943-115166965 GAAAACAAAGGGAAGAATGTTGG + Intergenic
913558632 1:119996035-119996057 AACAAAAGAAGGAAAACTGTAGG - Intronic
913639209 1:120794436-120794458 AACAAAAGAAGGAAAACTGTAGG + Intergenic
914279242 1:146155522-146155544 AACAAAAGAAGGAAAACTGTAGG - Intronic
914540285 1:148606452-148606474 AACAAAAGAAGGAAAACTGTAGG - Intronic
914626359 1:149464762-149464784 AACAAAAGAAGGAAAACTGTAGG + Intergenic
914684588 1:149967252-149967274 GAGAGTAGAGGGAAGAGTGTGGG + Intronic
916856627 1:168756814-168756836 GACAGGAGAGGGAAGAGTTTAGG - Intergenic
922181191 1:223234165-223234187 GCCAACACAGGGAAGACTTCAGG - Intronic
924326603 1:242901138-242901160 GAGAACAGAGGAAAGAGTTTGGG + Intergenic
924326755 1:242902519-242902541 GAGAACAGAGGAAAGAGTTTGGG + Intergenic
924951797 1:248891313-248891335 GACAACAGAGGGAACTCGGTGGG + Intergenic
1062879660 10:967694-967716 GGCAACAGAGGGAGGAATGCCGG + Intergenic
1063405816 10:5793837-5793859 GGCAACAGAGGAAATAATGTTGG + Intronic
1063486558 10:6425895-6425917 GACAAATAAGTGAAGACTGTTGG - Intergenic
1064223904 10:13465771-13465793 GATAACAAAGGGAGCACTGTGGG - Intronic
1066252150 10:33644636-33644658 GTCTGCAAAGGGAAGACTGTGGG + Intergenic
1067350502 10:45471670-45471692 GAACACAGAGGGAAGACTTTGGG - Intronic
1068071999 10:52207194-52207216 AAAAACAGTGGGAAGGCTGTAGG + Intronic
1068304198 10:55182736-55182758 GAAAACAGGAGGAAAACTGTGGG + Intronic
1068599629 10:58942698-58942720 AACAACTGAGGGAAGAGTATGGG + Intergenic
1068672946 10:59742551-59742573 GACAAGAGATGAAACACTGTTGG - Intergenic
1068707350 10:60091580-60091602 GACACTAGAGGGTAGACTGGAGG + Intronic
1068732862 10:60378756-60378778 GAAAACACAGGAAATACTGTAGG + Intronic
1068785658 10:60969910-60969932 GACACCTGAGAGAAGACTATAGG + Intronic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1075593409 10:123709099-123709121 GACAGCGGAGTGAAGACAGTGGG + Intronic
1076010752 10:126986187-126986209 GACATCAGAGGGAAGGGTGCAGG - Intronic
1076644659 10:131944662-131944684 GACAGCAGAGGGAGGACGGCAGG - Intronic
1078546315 11:12249537-12249559 GACATCAGAGGACAGCCTGTTGG - Intronic
1080760559 11:35244996-35245018 GAAAACAGAGGGAATATAGTAGG + Intergenic
1081655830 11:44856845-44856867 GAAGACAGAGGGAAGTGTGTAGG - Intronic
1083110125 11:60397925-60397947 GACAACAAGGGGAAGTCTTTGGG - Exonic
1084572667 11:69968943-69968965 GACAAAGGAGTGAAGACTGGAGG - Intergenic
1085056840 11:73409569-73409591 GATAGCAGAGGGAATGCTGTTGG + Exonic
1085685619 11:78619645-78619667 GACAAAAGTGGAAAGACTGATGG - Intergenic
1088072022 11:105798814-105798836 GAGAACAGAGGAAAGAATATTGG + Intronic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088550621 11:111009242-111009264 GATACCAGTGAGAAGACTGTCGG + Intergenic
1088574076 11:111252708-111252730 GAGGACAGAGGGAAGACTAATGG - Intergenic
1089445160 11:118546143-118546165 CATAACAGAGGGAAGACCATGGG + Intronic
1091457252 12:617295-617317 GACAACAGAGGAAAGACACTGGG + Intronic
1091783092 12:3226086-3226108 GACATTAGAGGGGAGACTGGGGG + Intronic
1092652760 12:10652501-10652523 GACAGGAGAGGGAAGGATGTGGG - Intronic
1094472615 12:30817547-30817569 GTCAGCAGAGAGAGGACTGTGGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1097346741 12:58501702-58501724 GACCACAGATTGAAGGCTGTTGG + Intergenic
1097395350 12:59066573-59066595 GACAAATGAGGGTAGACTGGAGG + Intergenic
1100997791 12:100321475-100321497 GAAAACAGAGGGATGACTGGGGG - Intronic
1103958697 12:124593935-124593957 GACACCAGAGGGAAGGGTCTTGG + Intergenic
1104239774 12:126976880-126976902 GACAACACAGTGCAGACTGAGGG + Intergenic
1105343642 13:19552595-19552617 GACAAAAGAGGGGAAACTGTGGG - Intergenic
1105536402 13:21269039-21269061 GACAAAAGAGGGGAAACTGTGGG + Intergenic
1105981454 13:25520200-25520222 GAAGACAGAGGGCAGACTGGTGG - Intronic
1107477189 13:40749162-40749184 GACAAAAGAGGGGAAACTATGGG - Exonic
1108712776 13:53050117-53050139 GAATACAGATGGGAGACTGTTGG + Exonic
1109229403 13:59738311-59738333 GACCACAGAGGCAAGAGGGTGGG + Intronic
1109464767 13:62715909-62715931 AACATCAGAGGGAAGTCTTTTGG + Intergenic
1109665790 13:65534839-65534861 GAAAACAGAGAGAAAACTATAGG - Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1114323226 14:21564339-21564361 GACATCAGAAGGAAGGCTATGGG + Intergenic
1117002805 14:51388786-51388808 GAAAGCAGAGGGTAGAATGTTGG - Intergenic
1118703917 14:68462276-68462298 GACAATACAGGGAAGCCTTTGGG - Intronic
1121134675 14:91486126-91486148 GACAATAGAGGGAAGAGAGAAGG - Intronic
1121915923 14:97836874-97836896 GGAAACAGAGTGAAGATTGTCGG + Intergenic
1122036906 14:98955674-98955696 GACAACAGAGGGAGGAATCATGG + Intergenic
1123972448 15:25520781-25520803 GACCACAAAGGAAAGACTGGAGG + Intergenic
1124008892 15:25818985-25819007 GAAACCCGAGGGAAGACTGCTGG + Intronic
1127201744 15:56661409-56661431 GAAAAAAGGGGGAAAACTGTAGG + Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1130062342 15:80578987-80579009 GACCAGAGAGGGAGGACTGTGGG - Intronic
1131177221 15:90217642-90217664 GACCACAGAGGGAAGATGGACGG + Intronic
1131297005 15:91158036-91158058 GACAAGAGAGGGAAGCCCATAGG - Intronic
1131328483 15:91471705-91471727 CCAAGCAGAGGGAAGACTGTAGG - Intergenic
1131858961 15:96631117-96631139 CACAAGACAGGAAAGACTGTGGG - Intergenic
1132218005 15:100082085-100082107 GGCAACAGAAGCAAGACTCTTGG - Intronic
1132363848 15:101241387-101241409 GAAAACACAAGGAAGACTATTGG - Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1133812687 16:9173304-9173326 GAAAAAAGATGGAAGACTATTGG + Intergenic
1136515007 16:30762711-30762733 GAGAACAGAGGGAGGGCTCTGGG - Intronic
1137640108 16:50021639-50021661 GACAACAGAGGGAACAGTAAGGG - Intergenic
1137956916 16:52840843-52840865 GAAAAGAGAGGGAAGAAAGTGGG + Intergenic
1138681072 16:58684086-58684108 GTCAGCAGAGGGAAGAGTTTGGG + Exonic
1139157378 16:64460008-64460030 GACAACTGAGGGCTGTCTGTTGG + Intergenic
1142908044 17:3061651-3061673 GACTACAGTGGGAAGAATGGTGG - Intergenic
1142926521 17:3242615-3242637 GACTACAGTGGGAAGAATGGTGG + Intergenic
1145056271 17:19705995-19706017 GACCACACAGGGAAGCCTGCAGG - Intronic
1146918917 17:36696764-36696786 GAGAACAGAGAGAGCACTGTAGG + Intergenic
1147879302 17:43643630-43643652 GAGAACAGAGGGAAGCCGGAGGG - Exonic
1149674556 17:58447551-58447573 GGAAAGAGAGGGAAGAGTGTAGG + Intronic
1151011011 17:70496011-70496033 GAAAACAGAGGGTAGAATGGGGG + Intergenic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1154057683 18:11026880-11026902 GAAAAAAGAGGCAAGAGTGTGGG + Intronic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1157814185 18:50719216-50719238 TCCACCAGAGGGAAAACTGTAGG - Intronic
1158680595 18:59562988-59563010 CAAAACAGAGACAAGACTGTTGG + Intronic
1160700647 19:505406-505428 GACAGCAGAGGGTTGACTGTGGG + Intergenic
1163035871 19:14568491-14568513 GACAAAAGAGGGAGGAGTCTAGG - Intronic
1164416668 19:28051286-28051308 AACACCTGTGGGAAGACTGTGGG + Intergenic
1164727513 19:30476180-30476202 GGCCACAGAGGGAAGAAGGTGGG - Intronic
1166271061 19:41714413-41714435 GACACCAGAGGCAAGCCTGGAGG - Intronic
1166496369 19:43305806-43305828 GACAGCAGGGGGCAGATTGTGGG + Intergenic
1167885049 19:52493339-52493361 GACTGCAGAGGGAAGACTACGGG - Intronic
925460386 2:4057919-4057941 GACAAAAGTGGGAAGGCTGATGG - Intergenic
925461842 2:4069953-4069975 GAGAACAGATTGAAGGCTGTGGG - Intergenic
926041360 2:9675861-9675883 TACAACAGAGAGGAGTCTGTCGG + Intergenic
930694505 2:54397474-54397496 AACCACAGAGAGCAGACTGTTGG + Intergenic
930973759 2:57429283-57429305 GACAACTGAAGGAAGACAGTCGG - Intergenic
932598332 2:73107889-73107911 GCCAACAGAGAGAAGGCTGTGGG + Intronic
932666337 2:73701702-73701724 GGAAACAGAGGGAAGAGTGGTGG - Intergenic
935356864 2:102209478-102209500 GAGAACAGAGGGAACAGTATAGG + Intronic
937299563 2:120830755-120830777 GAAAACAGAGGGAACATGGTGGG - Intronic
937754980 2:125526230-125526252 GATAAGAGAGAGAAGAATGTGGG + Intergenic
937769585 2:125704405-125704427 GACAACAGAGGGAAGGACATGGG + Intergenic
939887845 2:147700719-147700741 GACAAAAGAGGGAAGAAGGCCGG + Intergenic
939889856 2:147723547-147723569 TGCATCAGAGGAAAGACTGTTGG - Intergenic
941764629 2:169283635-169283657 GACATCAGAGGAAAGACAGCTGG - Intronic
941918626 2:170828402-170828424 GACAGCAGAGGGAGGAGGGTGGG - Intronic
941918668 2:170828593-170828615 GACAACAGAGGGAAGAGGAGGGG - Intronic
942706241 2:178776056-178776078 TTCAACAGAGGGAAGATTTTAGG - Exonic
942929491 2:181472790-181472812 GAAAACAGAGGGAAGATGGTAGG - Intronic
944400253 2:199317790-199317812 GAAAAAAGAGGGGAGACTGGAGG + Intronic
945552018 2:211232074-211232096 GAAAACAGTGGTAACACTGTTGG - Intergenic
946310482 2:218880341-218880363 GGCAACAGAGGGAAAGGTGTTGG - Exonic
946542157 2:220696524-220696546 GAAGACAGAGGGAAGAATGATGG + Intergenic
947028892 2:225770305-225770327 GACCACTGAGAGAACACTGTAGG - Intergenic
947115241 2:226763121-226763143 GGCAAGAAAGGGAAGACTGTTGG + Intronic
948674920 2:239591628-239591650 GACGGCAGTGGGAAGCCTGTCGG + Intergenic
948850461 2:240702971-240702993 GACAAGAGGGGCAAGACTGGAGG - Intergenic
949057618 2:241936993-241937015 GACAACAGGCGGCAGACAGTAGG + Intergenic
1168935368 20:1660838-1660860 GACTAAAGATGTAAGACTGTGGG + Intergenic
1171239338 20:23552240-23552262 GACAACAAAGTGCAGACTCTGGG + Intergenic
1171810228 20:29741240-29741262 GAAAACAGAGGGAAGAGAGCCGG - Intergenic
1173658018 20:44714514-44714536 GAAAACAGAGGGAAAACAGGTGG - Intergenic
1175654510 20:60757598-60757620 GACAACATAGGTGAAACTGTAGG - Intergenic
1176013611 20:62915105-62915127 GACCACAGAGGGAAGGCAGTTGG - Intronic
1177490837 21:21824037-21824059 GAAAAAAGAGGGAAGATAGTAGG - Intergenic
1177671851 21:24242026-24242048 GACAACAAACAGAAGATTGTAGG + Intergenic
1177763146 21:25425603-25425625 GACAACAGAGGAAATACAATGGG + Intergenic
1179243697 21:39612569-39612591 CACAGGAGAGGGAAGGCTGTGGG - Intronic
1179385872 21:40941478-40941500 TAGACCTGAGGGAAGACTGTGGG + Intergenic
1179528402 21:41999980-42000002 GACAACAGAGGGTAGGTTATGGG + Intronic
1180577018 22:16786463-16786485 GACAACAGATGAGAAACTGTGGG + Intronic
1180877107 22:19179647-19179669 GACAACAGAGACTGGACTGTGGG - Exonic
1183439596 22:37815732-37815754 GACAGCAGGTGGCAGACTGTTGG - Exonic
1184187375 22:42873706-42873728 GGCAAGAGAGGGAAGAATCTGGG + Intronic
1184415622 22:44350330-44350352 GACCAGAGAGGGAGGATTGTGGG + Intergenic
1184574806 22:45354872-45354894 GACAACAGAGGGGAGATTGTTGG + Intronic
1185078527 22:48696330-48696352 GAGAAAAGAGGGAAGAGTGGAGG - Intronic
949592279 3:5507189-5507211 CAAAACAGAGGGAAGAGTGAAGG + Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951149952 3:19277159-19277181 GAAGATAGAGGGTAGACTGTTGG + Intronic
953492092 3:43361228-43361250 CACAACAGAAGGAAGAATGCAGG - Intronic
953901186 3:46845172-46845194 GATTAGAGAGGGAACACTGTGGG - Intergenic
953970997 3:47346685-47346707 GACCACAGAGGTGTGACTGTGGG + Exonic
955235031 3:57131614-57131636 GCCAAGAGAGGGATGACGGTAGG - Intronic
955765788 3:62342871-62342893 GCCAAGAGGGAGAAGACTGTGGG - Intergenic
958621382 3:96566863-96566885 GACATCAGAAGGCAGGCTGTGGG + Intergenic
959758078 3:109923737-109923759 AACAACAGAGGTAAGGCTGTAGG + Intergenic
963986407 3:151599470-151599492 GATAACAGAGGCAAGAAGGTGGG + Intergenic
965049278 3:163623616-163623638 TACACCAGAAGGAAGACTGCTGG - Intergenic
966338304 3:178896207-178896229 GACAGGAGAGGCAAGACTGTAGG + Intergenic
966917815 3:184594528-184594550 GACAACAGAGAGAATCCTGAGGG - Intronic
967303215 3:188037225-188037247 GAAAGCGAAGGGAAGACTGTTGG + Intergenic
967420537 3:189267537-189267559 GACAACAGAATGAAGAATTTTGG + Intronic
968761700 4:2445517-2445539 GACCACAGTGGGTAGAGTGTGGG - Intronic
970903022 4:21182115-21182137 GTCAAGGGAAGGAAGACTGTTGG + Intronic
971005737 4:22372721-22372743 GCTTACAGAGGGCAGACTGTAGG - Intronic
972040259 4:34585727-34585749 GTCAAAGGAGAGAAGACTGTTGG - Intergenic
974724882 4:65785735-65785757 GACAGCAGAGGTAAAAATGTAGG - Intergenic
975612480 4:76215735-76215757 GAGAACATGGGAAAGACTGTGGG + Intronic
975673107 4:76801711-76801733 GACAACAGGAGGAGGGCTGTTGG + Intergenic
976155905 4:82144616-82144638 GACCACAGAGTGATGACAGTGGG + Intergenic
977179574 4:93857351-93857373 GACACCAGAGGCATGTCTGTGGG - Intergenic
978290323 4:107130272-107130294 GACATCAGAGGGAAGGAAGTCGG + Intronic
979641228 4:123014101-123014123 AAAAACAGAGGGAAGACAGAGGG - Intronic
982779038 4:159471192-159471214 GACAGCAGAGGGAACATTCTAGG + Intergenic
984088342 4:175339826-175339848 GACAAAATAGGGAAGACTGCAGG - Intergenic
984542768 4:181060865-181060887 TACAACAGAGGCAAGCCTGGTGG - Intergenic
987060602 5:14239686-14239708 GACAATAGTGGAAAGAATGTGGG - Intronic
987124373 5:14797855-14797877 GACATCAGAAGGAAGGCTATGGG - Intronic
988189276 5:27907321-27907343 GAAAACTGAAGTAAGACTGTTGG - Intergenic
989382302 5:40821418-40821440 GACCAAAGAGGGAAGAAAGTAGG - Intergenic
990249503 5:53898665-53898687 GGCAACAGAGTGAGGTCTGTCGG - Intronic
991296368 5:65085434-65085456 GACTACAGAGGGCTGACGGTAGG - Intergenic
991556510 5:67900980-67901002 GAGCACAGAGGAAAGATTGTGGG - Intergenic
992416790 5:76559553-76559575 GAAAACCCAGGGAAGACAGTGGG - Intronic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
997597120 5:135114487-135114509 GACAACAGAGGGAAGGCTCCAGG + Intronic
998445087 5:142192216-142192238 GGCAACAAAGGGAGGAGTGTAGG + Intergenic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
999435488 5:151560052-151560074 AACAACAGTTGGAAAACTGTTGG - Intronic
1000927448 5:167210969-167210991 GACAAAACAGAGTAGACTGTGGG + Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003344329 6:5252588-5252610 GACAGCAGAGAGAAAACGGTGGG - Intronic
1003737396 6:8892226-8892248 GGCAGCAGATGGAACACTGTAGG - Intergenic
1004255537 6:14060095-14060117 GACACCAGTTGGGAGACTGTGGG + Intergenic
1005737080 6:28757817-28757839 GACAACCGAACGAAGACTGTCGG - Intergenic
1006565557 6:34953522-34953544 GCAAACAGTGGGAAGAGTGTGGG - Intronic
1006628264 6:35412930-35412952 GAAAGCAAAGGGAAGACAGTGGG + Intronic
1007656094 6:43451860-43451882 GAGAAAAGAGGCAGGACTGTTGG - Intronic
1009036267 6:58120484-58120506 GACATCAGAAGGAAGGCTATGGG - Intergenic
1009212083 6:60874098-60874120 GACATCAGAAGGAAGGCTATGGG - Intergenic
1009616770 6:66019029-66019051 GAGGACAGAGGGAAAATTGTAGG + Intergenic
1010070161 6:71734691-71734713 GACAACAGAGTGAAGATTTAGGG - Intergenic
1010403282 6:75473027-75473049 TACTCTAGAGGGAAGACTGTGGG + Intronic
1010598699 6:77797551-77797573 GACTACAGACTGAAGGCTGTTGG - Intronic
1013447374 6:110244220-110244242 GACAGCATAGGCAAGTCTGTGGG + Intronic
1013608825 6:111775084-111775106 GCCATCAGAGGAAAGGCTGTGGG + Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016270241 6:142280143-142280165 GAGCACACAGGGAAGACTTTAGG - Intergenic
1017917118 6:158840013-158840035 CACAACAGAAGAAAGACTTTAGG - Intergenic
1018247062 6:161833600-161833622 GACATCCGAGGGGAGTCTGTGGG - Intronic
1019595709 7:1857428-1857450 GACAGCAGAGGCCTGACTGTGGG - Intronic
1020024271 7:4887688-4887710 AAACACAGAGGGAAGGCTGTGGG - Intergenic
1022739177 7:33105159-33105181 GACAACAGATTGAAGAGTCTAGG + Intronic
1023014781 7:35956051-35956073 GACAGCACAGGGCAGCCTGTGGG + Intergenic
1023433838 7:40121758-40121780 GACAACAAATTCAAGACTGTAGG - Intergenic
1023670215 7:42568426-42568448 GATCACAGAGGGAAGAATCTGGG + Intergenic
1024066223 7:45738969-45738991 GACAGCACAGGGCAGCCTGTGGG - Intergenic
1024564798 7:50672520-50672542 GACACCAGAGAGAAGACATTGGG + Intronic
1024795901 7:53019337-53019359 GACAACATAGGGGAAAGTGTAGG + Intergenic
1028201109 7:87962980-87963002 TAAAACAGAGGGAAAACTCTTGG + Intronic
1028262268 7:88680773-88680795 CACAACTGAGGGGAGAGTGTGGG + Intergenic
1029101270 7:98132143-98132165 CACAACGGATGGAAGCCTGTGGG + Intronic
1031860212 7:126970817-126970839 GATAACATAGGGACCACTGTAGG + Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1033677623 7:143558571-143558593 GAAAAGAGAGAGAAGACTATGGG + Intergenic
1033694211 7:143770869-143770891 GAAAAGAGAGAGAAGACTATGGG - Intergenic
1034153654 7:148936703-148936725 GGAAACAGAGGGCTGACTGTAGG + Intergenic
1034316059 7:150134350-150134372 GACAGCAGAGGGAAGACGAGGGG + Intergenic
1034741168 7:153474833-153474855 GGCAAGAAATGGAAGACTGTGGG - Intergenic
1034790829 7:153966431-153966453 GACAGCAGAGGGAAGACGAGGGG - Intronic
1036102752 8:5805344-5805366 GTCAAAAGAGGAAAGCCTGTGGG - Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1037596368 8:20357702-20357724 CACACCAGAGGGAAGACTATGGG + Intergenic
1040518847 8:48158121-48158143 GACATCAGAGGAAAGGCTCTTGG - Intergenic
1041971832 8:63752290-63752312 GACAAGAAGGGGAAGACTGGAGG + Intergenic
1044174959 8:89108445-89108467 GACAACATAGGGAATAATATAGG - Intergenic
1048451817 8:134540232-134540254 GACAAGAGAGGACAGACAGTAGG + Intronic
1048749368 8:137653989-137654011 CAGCACAGAGGGCAGACTGTGGG - Intergenic
1050799027 9:9585682-9585704 GACAACAGAGGTAGAATTGTTGG - Intronic
1051437914 9:17052797-17052819 GGCAACAGGGGAATGACTGTTGG - Intergenic
1052300343 9:26946776-26946798 GAGAGCAGAGGGAAGGCTGGGGG + Intronic
1052848994 9:33364553-33364575 GAAAACAGAAGGATGACTGACGG - Intronic
1056655310 9:88503961-88503983 GACCTCACAGGGAAGTCTGTTGG - Intergenic
1059073267 9:111162677-111162699 ATCAAAAGAGGTAAGACTGTAGG + Intergenic
1060266826 9:122116494-122116516 GTTACCAGAGGGCAGACTGTGGG - Intergenic
1060276063 9:122183658-122183680 GACAACAAAGGGGATAATGTTGG - Intronic
1060393995 9:123303014-123303036 GAGAGCAGAGGGGAGACAGTGGG + Intergenic
1061100134 9:128485841-128485863 GACAACAGAGAGAAGACACTCGG - Intronic
1186327415 X:8494807-8494829 GACAAGAGGGGGACTACTGTAGG + Intergenic
1188004856 X:25010229-25010251 CACAACAGAGGGAAGAGGGAGGG - Intronic
1191630430 X:63315773-63315795 GACAACAGTGGAAAGGCTGATGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194945205 X:100058694-100058716 GAGAGCAGAGTGGAGACTGTTGG + Intergenic
1197486540 X:127057754-127057776 GCTTGCAGAGGGAAGACTGTGGG + Intergenic
1197761696 X:130032606-130032628 GAGGCCAGAGGGCAGACTGTGGG - Intronic
1198420196 X:136464224-136464246 AACAACAGAGAGAAAACTGGAGG - Intergenic
1199525612 X:148788515-148788537 GAGAACAGAGGCAGGACAGTGGG - Intronic
1199596531 X:149510362-149510384 AAGAAGAGAGGGAAGACGGTGGG - Intronic
1201224033 Y:11799705-11799727 GAGAACAGAGGAAAGAGTTTGGG + Intergenic
1201224185 Y:11801079-11801101 GAGAACAGAGGAAAGAGTTTGGG + Intergenic