ID: 1002294963

View in Genome Browser
Species Human (GRCh38)
Location 5:178225222-178225244
Sequence CTACTGAAGACAAGTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002294963_1002294976 27 Left 1002294963 5:178225222-178225244 CCTGCCACACTTGTCTTCAGTAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1002294976 5:178225272-178225294 GGCACCCAGAGTCAGTCTCACGG 0: 1
1: 0
2: 0
3: 19
4: 196
1002294963_1002294969 6 Left 1002294963 5:178225222-178225244 CCTGCCACACTTGTCTTCAGTAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1002294969 5:178225251-178225273 CCCCTTATCCTCCCTGCCTAAGG 0: 1
1: 0
2: 0
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002294963 Original CRISPR CTACTGAAGACAAGTGTGGC AGG (reversed) Intronic
901673517 1:10869399-10869421 CTGCTGATGACAAGTGTAGCTGG - Intergenic
906714237 1:47955111-47955133 CTACAGAAGACATGTGTGGATGG - Intronic
910685830 1:89914948-89914970 CTACTTAAGATAAGTATGGGTGG + Intronic
913444218 1:118932683-118932705 CTCATGAAGACAAGTGGGGCTGG + Intronic
916090406 1:161304645-161304667 CAACTGAAGCCAAGTATGGAAGG + Intergenic
920612844 1:207458527-207458549 AGACAGAAGGCAAGTGTGGCTGG - Intronic
922141007 1:222886554-222886576 CAACTGAGCACAAATGTGGCTGG + Intronic
923093750 1:230758735-230758757 CTACTGAAAACAAGTGAATCTGG + Intronic
924022938 1:239803700-239803722 CTACTAAAATCAAGTGTGGAAGG + Intronic
1068611859 10:59069177-59069199 CAAGTGAAGACAAGTGAGGGAGG - Intergenic
1069812430 10:71172260-71172282 CTATTGAAGAAAAGTGATGCAGG - Intergenic
1073421478 10:103427180-103427202 CCACTGAAGACAGATGTGTCAGG - Intronic
1074312971 10:112338355-112338377 CTACTGAACATTAGTGTGCCTGG - Intergenic
1101015420 12:100495618-100495640 CTACTCAAGAGAACTGAGGCAGG + Intronic
1101802704 12:108036083-108036105 CTACTCAAGTCCAGTGTGGCTGG - Intergenic
1103088046 12:118077174-118077196 CGAGAGAAGACCAGTGTGGCCGG - Intronic
1103241159 12:119414313-119414335 CTAATAAAGACAAGAGTGGCCGG - Intronic
1107407418 13:40127634-40127656 CTTCTGAAGACACAGGTGGCTGG - Intergenic
1107429432 13:40326882-40326904 CTAAAGAGGACATGTGTGGCTGG - Intergenic
1109181289 13:59216799-59216821 AAACTGGAGACAAGTGTTGCTGG - Intergenic
1109375031 13:61481424-61481446 CCACTGTAGTCAAGTGTGGTTGG + Intergenic
1111798560 13:92954957-92954979 CTATTGTAAACAAGTGTGCCAGG + Intergenic
1115122973 14:29959626-29959648 CTTCTGAAGATTAGTTTGGCTGG + Intronic
1116243307 14:42375808-42375830 CTACTGAAAACAAGGTTGGGAGG - Intergenic
1117739653 14:58803859-58803881 CTACTGAAGAAAAATGAGGATGG + Intergenic
1121226078 14:92323027-92323049 CTACTGAAGAGAAGAGTGCACGG + Intronic
1124954690 15:34352500-34352522 GTACGGAAAACAAGTGAGGCCGG + Intronic
1126041057 15:44591674-44591696 ACAGTGAAGACCAGTGTGGCCGG + Intronic
1127795707 15:62436589-62436611 CCAGTGAAGGCCAGTGTGGCTGG + Intronic
1128636345 15:69304927-69304949 GAGCTGAAGACTAGTGTGGCTGG + Intronic
1128831301 15:70771870-70771892 ATACTGAAGGCCAGTGTGGCTGG + Intergenic
1133384152 16:5355289-5355311 CAACTGAACGCAGGTGTGGCAGG + Intergenic
1133758544 16:8780292-8780314 CCACTGAGGACATGTGTGGCAGG + Intronic
1133854431 16:9536411-9536433 CAAAAGAAGACAAGTGCGGCTGG + Intergenic
1135856677 16:26018040-26018062 CTACTGGAGACATGTGCGACGGG - Intronic
1137267404 16:46880601-46880623 TTACTGAAGACCTGTGTGTCAGG + Intergenic
1140136263 16:72208262-72208284 CTAATGAAGAAATGTGTGGTAGG + Intergenic
1142765697 17:2063018-2063040 CCTCTGCAGATAAGTGTGGCTGG + Intronic
1143615213 17:8045523-8045545 CCACTGATGACAAGTGGGACTGG + Exonic
1146969537 17:37061542-37061564 CTAAAGATGACAAGTGGGGCCGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1149852361 17:60045883-60045905 ATACTGAAGACAAGTTTAGGGGG - Intronic
1155565754 18:27132456-27132478 CTAAGGAAGACAAGTGAAGCTGG - Intronic
1156674439 18:39510847-39510869 ATGCTGGAAACAAGTGTGGCTGG + Intergenic
1158310563 18:56153280-56153302 CTACTGAAGACAACTGGTCCAGG - Intergenic
1158314165 18:56192156-56192178 CTGCTGATGGCATGTGTGGCTGG - Intergenic
1165150962 19:33759853-33759875 CTACTGATGTCATGTGGGGCTGG - Intronic
1166034256 19:40155940-40155962 CTTCTGAAGTGAAGTGTTGCTGG + Intergenic
1167732068 19:51265637-51265659 CTACTGATGTCAAGTGAGGGTGG + Exonic
925772079 2:7292260-7292282 CTACAGAAGAAAACTGTGTCAGG - Intergenic
927172846 2:20385095-20385117 CTAAAGAAGACAGGTGGGGCAGG - Intergenic
930412974 2:51050502-51050524 CTAATAAAGACAATTGTGGCTGG + Intergenic
933654576 2:84877124-84877146 CTGCTGAAGACATGTCTGGTAGG - Intronic
937029847 2:118729795-118729817 CTTCTGAGGACAAGTCTGGAAGG - Intergenic
938641195 2:133282270-133282292 GCACTGAAGACCAGGGTGGCAGG - Intronic
938902706 2:135811552-135811574 GAAATGAAGACCAGTGTGGCTGG + Intronic
940494167 2:154404108-154404130 GAACTGAAGTCAAGTCTGGCTGG - Intronic
944544408 2:200784744-200784766 CAGAAGAAGACAAGTGTGGCTGG - Intergenic
946563154 2:220935817-220935839 CTCCTCAAGACAAGAGTGGGAGG - Intergenic
1169300743 20:4440107-4440129 CTTCTGAAGCCAAGGGTTGCTGG - Intergenic
1171981367 20:31631672-31631694 GAACTGAAGCCCAGTGTGGCTGG + Intergenic
1172185597 20:33029208-33029230 GTATGGAAGACAAGAGTGGCTGG - Intergenic
1178882743 21:36461777-36461799 CTAATGAAGCCAAGGGAGGCGGG + Intronic
1179382193 21:40910180-40910202 CCTCAGAACACAAGTGTGGCAGG + Intergenic
1181457511 22:23068122-23068144 CCAGAGAAGACCAGTGTGGCTGG - Intronic
1182564442 22:31186894-31186916 CTACAGAAGACAAGAGTTGTAGG - Intronic
1182994144 22:34797460-34797482 CTCCTAAAGGCCAGTGTGGCTGG + Intergenic
1183425925 22:37739391-37739413 CTCCTGAAGCCAGGGGTGGCAGG + Intronic
949856966 3:8470727-8470749 TAAATGAAGACAAGTCTGGCTGG - Intergenic
950711306 3:14814672-14814694 CTTCTGAAGAGAGGTCTGGCCGG - Intergenic
950783074 3:15409151-15409173 CTCCTGAAGAGAAGAGGGGCAGG - Intronic
953071190 3:39521611-39521633 CTACTCATCACAAGTGTTGCTGG + Intronic
959479605 3:106855082-106855104 CTTATGAAGACTAGTTTGGCTGG - Intergenic
962525184 3:136231876-136231898 AGACAGAAGACCAGTGTGGCTGG + Intergenic
962806970 3:138934713-138934735 CTGCTGGAGACCAGTGTAGCTGG - Intergenic
965222807 3:165950028-165950050 CACCAGAAGGCAAGTGTGGCTGG - Intergenic
968985562 4:3872630-3872652 AGACTGCAGACAAGTGTGCCGGG - Intergenic
970458291 4:16247318-16247340 CTACTGAATCCAACTGTGTCAGG + Intergenic
972292584 4:37703704-37703726 CTGTTGAAGACAAGGGAGGCAGG - Intergenic
973335099 4:48948059-48948081 TAACTTAAGAAAAGTGTGGCTGG + Intergenic
979336556 4:119470063-119470085 CTTCTGAATGCAAGTTTGGCTGG + Intergenic
979632124 4:122915200-122915222 CTACCGAAGGCAGATGTGGCTGG - Intronic
983239457 4:165215405-165215427 CTTCTGAATGCAAGTTTGGCTGG + Intronic
986300882 5:6477377-6477399 CTGCTGAGGACAGGTGTGCCCGG + Intronic
986401507 5:7386029-7386051 CTACTTGAGACATGTGTTGCTGG + Intergenic
987931392 5:24403308-24403330 CTACTGAAGACAATCTTGGTGGG + Intergenic
991289755 5:65022164-65022186 TTACTGAAGACAAGTGAAACAGG + Intergenic
993987389 5:94613492-94613514 ATACAGAAGACAAGATTGGCCGG - Intronic
994012172 5:94918163-94918185 CTACTAAAGAAAATAGTGGCTGG - Intronic
996119928 5:119660051-119660073 CTACTCCAGAGAAATGTGGCTGG + Intergenic
1001099821 5:168804907-168804929 CTCCAGAAGGCCAGTGTGGCTGG - Intronic
1002294963 5:178225222-178225244 CTACTGAAGACAAGTGTGGCAGG - Intronic
1002856889 6:1045888-1045910 CTACTAAAGAGAGGTGTTGCTGG + Intergenic
1003963923 6:11235298-11235320 CTACTGTTGATAAGTGTGGTAGG + Intronic
1005398313 6:25406337-25406359 CAACAGAAGGCCAGTGTGGCTGG + Intronic
1007143093 6:39596443-39596465 TTACTGATGACAAATGTGGATGG + Intronic
1010521903 6:76848731-76848753 CTAATGAAGCCTAGTTTGGCTGG + Intergenic
1012515367 6:100053153-100053175 ATCCTGAAGAAAAGTGAGGCTGG + Intergenic
1013534611 6:111052503-111052525 CTAGAAAAGACCAGTGTGGCTGG + Intergenic
1021377160 7:19922430-19922452 CTACTGAAAGCAATTGTGTCCGG + Intergenic
1021464619 7:20928149-20928171 TAACTGAAGATAAGTGAGGCAGG + Intergenic
1022503217 7:30895365-30895387 GTACTGAAGGCATGTGTGGGAGG + Intergenic
1024925919 7:54615827-54615849 CTACTGAATAGAAGTGGGCCAGG + Intergenic
1030174928 7:106642529-106642551 CAACTGAAGAGAAGTCTAGCTGG - Intergenic
1037650716 8:20835983-20836005 CTACTCAAGACCAGAGTTGCTGG - Intergenic
1040580529 8:48695235-48695257 CTCCTTATGACTAGTGTGGCAGG - Intergenic
1048460979 8:134621739-134621761 ATACTGAGGACAGGTGTGGGAGG - Intronic
1054729687 9:68688666-68688688 TCAGTGAATACAAGTGTGGCTGG - Intergenic
1057204639 9:93163999-93164021 GTACTGAGGACAAGGGTGTCGGG + Intergenic
1057763013 9:97891552-97891574 ATACTGAAGACAAGTCAGTCTGG + Intergenic
1062371537 9:136241700-136241722 CTCCTGAGGACAGGTGTGGGAGG + Intronic
1186105967 X:6206204-6206226 TTCTGGAAGACAAGTGTGGCTGG + Intronic
1191807472 X:65150202-65150224 CTACTGAACATAAAGGTGGCAGG + Intergenic
1194162925 X:90477564-90477586 ATAGCGAATACAAGTGTGGCTGG - Intergenic
1195392846 X:104381130-104381152 CGAAGGAAGACAAGTGAGGCAGG - Intergenic
1197588151 X:128374876-128374898 CTACTGGAGACAATTCTAGCAGG + Intergenic
1200039338 X:153354401-153354423 CTACTGGAGACTAGTGAGGGTGG - Intronic