ID: 1002295544

View in Genome Browser
Species Human (GRCh38)
Location 5:178228997-178229019
Sequence TTTCGGTTCCTCAAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002295534_1002295544 29 Left 1002295534 5:178228945-178228967 CCCTGCTTGCCTCCCAACAGCTC 0: 1
1: 0
2: 0
3: 54
4: 474
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295540_1002295544 2 Left 1002295540 5:178228972-178228994 CCTCTGCTTTCCCTTCGTGGACT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295542_1002295544 -8 Left 1002295542 5:178228982-178229004 CCCTTCGTGGACTTCTTTCGGTT 0: 1
1: 0
2: 0
3: 4
4: 130
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295537_1002295544 17 Left 1002295537 5:178228957-178228979 CCCAACAGCTCACAGCCTCTGCT 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295538_1002295544 16 Left 1002295538 5:178228958-178228980 CCAACAGCTCACAGCCTCTGCTT 0: 1
1: 0
2: 3
3: 47
4: 372
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295543_1002295544 -9 Left 1002295543 5:178228983-178229005 CCTTCGTGGACTTCTTTCGGTTC 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295535_1002295544 28 Left 1002295535 5:178228946-178228968 CCTGCTTGCCTCCCAACAGCTCA 0: 1
1: 0
2: 0
3: 21
4: 272
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1002295536_1002295544 20 Left 1002295536 5:178228954-178228976 CCTCCCAACAGCTCACAGCCTCT 0: 1
1: 0
2: 9
3: 49
4: 391
Right 1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002295544 Original CRISPR TTTCGGTTCCTCAAGTGTGC TGG Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906055382 1:42912144-42912166 TTCCTGTTTCTCCAGTGTGCAGG - Intergenic
906642234 1:47448406-47448428 TTTCGGATCTTCCAGTGTGGTGG + Intergenic
916694010 1:167219238-167219260 TTTCATTTCCTTAAGTGTGCTGG + Intergenic
922678809 1:227572687-227572709 TTCCGGAGCCCCAAGTGTGCTGG + Intronic
1065134870 10:22657763-22657785 TTTCAGTTTTTCAAGTGGGCAGG - Intronic
1068564611 10:58559582-58559604 TTTCTGTTCCTTAATTGTTCTGG + Intronic
1068807177 10:61210436-61210458 TTTAGGACCCTCAAGTGTGGGGG - Intergenic
1070064472 10:73019789-73019811 TTTTGCTTAATCAAGTGTGCTGG - Intronic
1070100639 10:73382705-73382727 TTTTGATTCCCCAGGTGTGCTGG - Intronic
1070940204 10:80337773-80337795 CTGAGGTTCCTCAACTGTGCTGG + Intronic
1073193907 10:101672605-101672627 TTGCGTTTCCTCAAGTTTGTGGG - Intronic
1077312587 11:1897119-1897141 TTTCCGCTCATCAAGGGTGCCGG - Intergenic
1080395276 11:31884321-31884343 TTTCAGTTCCTCAATTGCACTGG - Intronic
1081720363 11:45284697-45284719 TGGCTGTTCCTCAAGTGTGTTGG + Intronic
1090232895 11:125121730-125121752 TTTCAGTTTTTCAAGTGTCCAGG + Intergenic
1095158735 12:38890617-38890639 TTTTGCTTCCTCAAGTGGCCAGG + Intronic
1099096767 12:78383825-78383847 TTTCAGGCCCTCCAGTGTGCAGG + Intergenic
1100669978 12:96801670-96801692 ATTCTGTTCCTCAAATGGGCTGG - Intronic
1107393884 13:39995755-39995777 TTTCCATTTCTCAGGTGTGCCGG - Intergenic
1112589703 13:100751755-100751777 TTGGGGTTCCTTAAGTGTCCAGG - Intergenic
1122004006 14:98687400-98687422 TTTCGCCTCATGAAGTGTGCAGG - Intergenic
1141951470 16:87342697-87342719 ATGCTGTTCCTCGAGTGTGCCGG + Intronic
1166241807 19:41499688-41499710 TCTCGTTTCCTCAATTCTGCGGG - Intergenic
929770166 2:44885058-44885080 TTTCAGATCCTAAAGGGTGCTGG - Intergenic
932165156 2:69498859-69498881 TTACCATTCCTCAGGTGTGCAGG + Intronic
939810390 2:146824758-146824780 CTTCAGTTCCTCAAGTGCTCTGG + Intergenic
940656514 2:156493563-156493585 TTTCCCTTCATCAAGTTTGCTGG - Intronic
948758023 2:240170288-240170310 TTTCACTTTCTCAAGTGTGGGGG + Intergenic
948904535 2:240972333-240972355 GTTCTGTTCCTGAAGTGGGCGGG + Intronic
1179367389 21:40771164-40771186 TTTCTGTCCCTCATGTGGGCTGG - Intronic
1181871637 22:25903767-25903789 TTTCTGTTGCTCAAGGGCGCTGG - Exonic
949239930 3:1858913-1858935 TCTCTGTTCCTCAGGTGTGGTGG + Intergenic
952299919 3:32096004-32096026 TTTCTGTTCCTCAAACATGCAGG + Intergenic
952867471 3:37863425-37863447 TTTCTGTGCCTCTAGTGTGTTGG + Intronic
954912753 3:54122559-54122581 TTTCTGCTCCCCAAGTGAGCCGG + Intronic
959484222 3:106908761-106908783 TCTTGGTGCCTCAAGTCTGCAGG - Intergenic
959484485 3:106910935-106910957 TTTGGGTTCCTCAAGAAAGCAGG - Intergenic
967928843 3:194675297-194675319 TTGCTGTTCCTGAAGTGTGTGGG - Intergenic
973666947 4:53169902-53169924 TTTCGGTTCCTTAAATATTCTGG + Intronic
975395195 4:73867512-73867534 TTTCGGTTACTCAGGGGTACTGG - Intergenic
977325805 4:95573098-95573120 TTTCCTTTCCCCAAGTGTACAGG + Intergenic
977577306 4:98689129-98689151 TTTCTGTTCCATTAGTGTGCAGG + Intergenic
979375011 4:119936224-119936246 TTTGGGTTCATCAAGTCTTCTGG + Intergenic
986366701 5:7040067-7040089 TTTCTATTCCTAAAGTGGGCTGG + Intergenic
986683245 5:10252260-10252282 TTTTGGTTCTTCAAGTTAGCTGG - Intronic
994528651 5:100937385-100937407 TTTCAGTACCTGGAGTGTGCTGG + Intergenic
1001649489 5:173305299-173305321 TTTTGGTTCCTGGACTGTGCTGG + Intergenic
1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG + Intronic
1004465502 6:15881409-15881431 TTCCAGTTCCTCATGTTTGCTGG - Intergenic
1009956641 6:70463112-70463134 TTTCAGTTTCTCAAGTTTGATGG + Intronic
1019518329 7:1449274-1449296 GTCCAGTTCCTCAAGTGTGCCGG - Intronic
1021194582 7:17661116-17661138 TTACTGTTCCTCACATGTGCCGG + Intergenic
1022014211 7:26335148-26335170 CTTCGGTTGCTGAAGTGTGCAGG - Intronic
1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG + Intronic
1027535946 7:79401799-79401821 TTTCTGTTCATCACGTGTGGAGG - Intronic
1030765016 7:113398079-113398101 TCTCGGTTCATCAAGATTGCTGG + Intergenic
1035766200 8:2107568-2107590 TCTCGGCTTCTCGAGTGTGCAGG + Intronic
1045816303 8:106280972-106280994 CTTTGGTTCCACAGGTGTGCAGG + Intronic
1049855237 8:144857525-144857547 GTTCCGTGCCTCATGTGTGCTGG - Intergenic
1051015020 9:12463488-12463510 TTCCAGTTCCTCAAGTGGGTGGG + Intergenic
1056097160 9:83266965-83266987 ATCCTGTTCCTGAAGTGTGCGGG - Intronic
1058679466 9:107428523-107428545 TGTCGGTATCTCCAGTGTGCTGG + Intergenic
1185814523 X:3142749-3142771 TTTCTGTTCCTCTCTTGTGCAGG - Intergenic
1185814650 X:3143754-3143776 TTTCTGTTCCTCCCCTGTGCAGG - Intergenic
1195657302 X:107344438-107344460 TTTCTGTTCCTCATGACTGCTGG - Intergenic
1201266620 Y:12213040-12213062 TTTCTGTTCCTCCCCTGTGCAGG + Intergenic
1201266632 Y:12213184-12213206 TTTCTGTTCCTCCCCTGTGCTGG + Intergenic
1201266758 Y:12214251-12214273 TTTCTGTTCCTCCCCTGTGCAGG + Intergenic
1201267027 Y:12217118-12217140 TTTCTGTTCCTCCCCTGTGCAGG + Intergenic
1201514754 Y:14807948-14807970 TATTTGTTCCTCATGTGTGCAGG + Intronic
1201716019 Y:17044628-17044650 TTTCTGTTTCTCCACTGTGCAGG - Intergenic
1201716181 Y:17046255-17046277 TTTCTGTTTCTCCACTGTGCAGG - Intergenic
1201718285 Y:17070956-17070978 TTTCTGTTCCTCTTCTGTGCAGG - Intergenic
1201718949 Y:17076496-17076518 TTTCTGTTCCTCCCCTGTGCAGG + Intergenic
1201718961 Y:17076610-17076632 GTTCTGTTCCTCCACTGTGCAGG + Intergenic
1201719149 Y:17078105-17078127 TTTCCGTTCCTCTCCTGTGCAGG + Intergenic
1201719301 Y:17079247-17079269 TTTCTGTTCCTCCACTGTGCAGG - Intergenic
1201719413 Y:17080374-17080396 TTTCTGTTCCTCCTCTGTGCAGG - Intergenic
1201719565 Y:17081762-17081784 TTTCTGTTCCTCCTCTGTGCAGG + Intergenic
1201719721 Y:17083289-17083311 TTTCCGTTCCTTCACTGTGCAGG + Intergenic
1201719780 Y:17083853-17083875 TTTCTGTTCCTCCACTGTGCAGG + Intergenic
1201719809 Y:17084166-17084188 TTTCTGGTCCTCATCTGTGCAGG + Intergenic