ID: 1002296221

View in Genome Browser
Species Human (GRCh38)
Location 5:178232694-178232716
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002296221_1002296230 17 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296230 5:178232734-178232756 CCTGGCAGCCTTCCGGCCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1002296221_1002296232 28 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296232 5:178232745-178232767 TCCGGCCCGTGGTCGTGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1002296221_1002296228 10 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296228 5:178232727-178232749 CACTGGGCCTGGCAGCCTTCCGG 0: 1
1: 0
2: 4
3: 42
4: 339
1002296221_1002296223 -7 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296223 5:178232710-178232732 TCATTTCTTCGCTTGCCCACTGG 0: 1
1: 0
2: 1
3: 6
4: 184
1002296221_1002296224 -6 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296221_1002296225 -1 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296225 5:178232716-178232738 CTTCGCTTGCCCACTGGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002296221 Original CRISPR GAAATGAACCACCGCAACGC GGG (reversed) Exonic