ID: 1002296224

View in Genome Browser
Species Human (GRCh38)
Location 5:178232711-178232733
Sequence CATTTCTTCGCTTGCCCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002296213_1002296224 9 Left 1002296213 5:178232679-178232701 CCCCGCCCCGAAGCGCCCGCGTT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296218_1002296224 3 Left 1002296218 5:178232685-178232707 CCCGAAGCGCCCGCGTTGCGGTG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296222_1002296224 -7 Left 1002296222 5:178232695-178232717 CCGCGTTGCGGTGGTTCATTTCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296221_1002296224 -6 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296219_1002296224 2 Left 1002296219 5:178232686-178232708 CCGAAGCGCCCGCGTTGCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296215_1002296224 7 Left 1002296215 5:178232681-178232703 CCGCCCCGAAGCGCCCGCGTTGC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296217_1002296224 4 Left 1002296217 5:178232684-178232706 CCCCGAAGCGCCCGCGTTGCGGT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114
1002296214_1002296224 8 Left 1002296214 5:178232680-178232702 CCCGCCCCGAAGCGCCCGCGTTG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1002296224 5:178232711-178232733 CATTTCTTCGCTTGCCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002296224 Original CRISPR CATTTCTTCGCTTGCCCACT GGG Exonic