ID: 1002296232

View in Genome Browser
Species Human (GRCh38)
Location 5:178232745-178232767
Sequence TCCGGCCCGTGGTCGTGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002296226_1002296232 -3 Left 1002296226 5:178232725-178232747 CCCACTGGGCCTGGCAGCCTTCC 0: 1
1: 0
2: 7
3: 38
4: 401
Right 1002296232 5:178232745-178232767 TCCGGCCCGTGGTCGTGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1002296227_1002296232 -4 Left 1002296227 5:178232726-178232748 CCACTGGGCCTGGCAGCCTTCCG 0: 1
1: 0
2: 0
3: 42
4: 359
Right 1002296232 5:178232745-178232767 TCCGGCCCGTGGTCGTGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1002296221_1002296232 28 Left 1002296221 5:178232694-178232716 CCCGCGTTGCGGTGGTTCATTTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1002296232 5:178232745-178232767 TCCGGCCCGTGGTCGTGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1002296222_1002296232 27 Left 1002296222 5:178232695-178232717 CCGCGTTGCGGTGGTTCATTTCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1002296232 5:178232745-178232767 TCCGGCCCGTGGTCGTGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002296232 Original CRISPR TCCGGCCCGTGGTCGTGCCT TGG Exonic