ID: 1002297869

View in Genome Browser
Species Human (GRCh38)
Location 5:178241395-178241417
Sequence CCAGAGAGACTCTTCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002297869 Original CRISPR CCAGAGAGACTCTTCTGGGA AGG Intronic
901148618 1:7085593-7085615 CAAGGGAGACTCCCCTGGGAGGG + Intronic
901731767 1:11285215-11285237 CCAGAGTGGCTATTCTGTGAGGG + Intronic
903258070 1:22115861-22115883 CCAGTGAGAGTTGTCTGGGAGGG + Intergenic
903815439 1:26061045-26061067 CCAGAGAGACTATTCCTGAAAGG + Intronic
904578313 1:31520821-31520843 CCAGACAGAATCTTCTAGGAAGG + Intergenic
904825239 1:33269953-33269975 TCAGAGACACCCTTCTGGGACGG + Intronic
905335210 1:37240247-37240269 CAAGAGAGACCCCTCTGGGGAGG + Intergenic
905631187 1:39519442-39519464 CCAGAGAGAATCCACTGGGCAGG - Intronic
905666570 1:39766729-39766751 CCAGAGAGAATCCACTGGGCAGG + Intronic
906785439 1:48611327-48611349 GGAGAAAGACTCTTCGGGGAGGG + Intronic
907087059 1:51685226-51685248 CCAGGAAGCCTCTTCTAGGATGG - Intronic
912680787 1:111727524-111727546 CCACAGACACTCCTATGGGATGG + Exonic
915001499 1:152597950-152597972 CAAGAGAGTTTCTTCTGCGAAGG + Intronic
915785688 1:158608917-158608939 ACAGAGAGAGGCATCTGGGAAGG + Intergenic
919092810 1:192994589-192994611 CTGTAGAGATTCTTCTGGGAAGG + Intergenic
920458269 1:206117176-206117198 GCAGAGTGAGGCTTCTGGGAGGG + Exonic
921185538 1:212666556-212666578 CCAGGGAGCCCCTTCTGAGAGGG + Intergenic
921398512 1:214694415-214694437 CCAGAGAGAATCTTGCGGGGCGG - Intergenic
922597214 1:226823309-226823331 CCAGGCAGACCCTTCTGGAAAGG - Intergenic
924133652 1:240939684-240939706 CCATAAAGATTCCTCTGGGAGGG + Intronic
924782115 1:247159728-247159750 CTATAGAGATTCTTCTGGGAAGG + Exonic
1063209362 10:3864846-3864868 CCTGTGGGACTCTTCTGGGAGGG - Intergenic
1064741665 10:18440648-18440670 CCAGAGAAAAGCTTCTGTGAAGG + Intronic
1066449894 10:35519493-35519515 CCTGTGAGACTCTCCTGGGGAGG - Intronic
1067457219 10:46427625-46427647 CCAAAGAGCCTCTCCGGGGAAGG + Intergenic
1067629982 10:47957013-47957035 CCAAAGAGCCTCTCCGGGGAAGG - Intergenic
1071392500 10:85189920-85189942 CCAGAGGGACTTTACTGAGAGGG + Intergenic
1072736210 10:97881387-97881409 CCAGAGAGAGTGGTCAGGGAGGG - Intronic
1072788943 10:98303573-98303595 CCAAAGAGACTCTTTGGGGAGGG + Intergenic
1072996125 10:100245699-100245721 TAAGAGAGCCTCTTCTGGCAGGG - Intronic
1073578579 10:104643880-104643902 ACAGAAAAACTCTTCAGGGAGGG - Intronic
1073877984 10:107947852-107947874 CAAGAGAGAGTCTGGTGGGAAGG + Intergenic
1074564264 10:114562757-114562779 CCTCAGAGGCTCTCCTGGGATGG + Intronic
1075271880 10:121059496-121059518 CCAGGGAGACTCTGCAGGGATGG + Intergenic
1076301282 10:129428676-129428698 TCAGAGAGTCTCTTCTGGGTGGG - Intergenic
1077005096 11:351265-351287 CGAGAGGGACTTTTCTGAGAGGG + Intergenic
1080556362 11:33421067-33421089 CCAGAGAGACTTTTCCAGGTGGG - Intergenic
1082057757 11:47833868-47833890 CCTGTGAGACTCTACTGGGAGGG + Intronic
1083001683 11:59298009-59298031 CCAGAGGGACTTTACTGAGAGGG + Intergenic
1083347835 11:62005948-62005970 GAAGAGAAACTCTTCTGGGGAGG - Intergenic
1084014463 11:66370489-66370511 GCAGGGAGGCTCTTCAGGGAAGG - Intronic
1084455311 11:69264807-69264829 CCAGAGAGACCCTGCTGTGTGGG + Intergenic
1086498258 11:87425957-87425979 CCACAGTCACTCTTGTGGGAGGG + Intergenic
1087293047 11:96340499-96340521 CAAGGGATACTCCTCTGGGATGG + Intronic
1087926958 11:103929880-103929902 CTAGAGTGAGACTTCTGGGAGGG + Intronic
1088756275 11:112887828-112887850 GCAGAGAGCCTCTATTGGGAAGG + Intergenic
1089142868 11:116301478-116301500 CCAGAGTGACAATTCTGGCAAGG - Intergenic
1092231340 12:6777368-6777390 CCTGAGAAACTCCTCTGGGATGG - Exonic
1094375997 12:29787746-29787768 ACAGAGAGACACTTTAGGGATGG - Intergenic
1094556259 12:31503052-31503074 CCAGAAACACACTTCTGGGAGGG + Intronic
1094783940 12:33823934-33823956 CAAGAGAAAATCTTTTGGGATGG + Intergenic
1095486506 12:42690176-42690198 CCTGGGGGACTCTTTTGGGATGG - Intergenic
1097210748 12:57367215-57367237 CCAGAGAAAGACTTCTGGAAAGG - Intronic
1097689549 12:62721597-62721619 ACAGAGAGGTTCTCCTGGGAAGG + Intronic
1102778934 12:115546736-115546758 CCTGAGAGACTCTCCAGGAAGGG + Intergenic
1106200093 13:27528735-27528757 CCGGAGAGACTCTTCTTGCATGG - Intergenic
1106582381 13:31029253-31029275 CCCGAGGGCCTCGTCTGGGATGG + Intergenic
1112620209 13:101047135-101047157 CCTGAGGGACTCTACTGTGAGGG - Intergenic
1113885534 13:113656779-113656801 CCACAGAGAACCTTCTGGAATGG - Intronic
1113916097 13:113874975-113874997 GCAGAGAGAGTTTCCTGGGAAGG + Intergenic
1113916684 13:113878059-113878081 CCAGAGAGCCCCTTCTGAGGGGG + Intergenic
1114517826 14:23311237-23311259 CCCCAGAGACTCTTCTGTCAGGG + Exonic
1115646549 14:35372207-35372229 CCATGGAGTCACTTCTGGGAAGG - Intergenic
1115661064 14:35494666-35494688 ACAGAGAGACTCTTCTGTTTGGG + Intergenic
1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG + Intergenic
1116499562 14:45604337-45604359 CCAGAAAGACTTTTCTGTGAGGG + Intergenic
1117726528 14:58680108-58680130 CCTGTCAGACTCATCTGGGAGGG + Intergenic
1121462699 14:94094169-94094191 CAAGAGAGACTTTACTGAGAGGG - Intronic
1121676846 14:95760424-95760446 CCAGAGAGACTGTGGTGGGAGGG + Intergenic
1122195133 14:100079056-100079078 CCAGAGGGAGGCCTCTGGGAAGG - Intronic
1122318342 14:100838686-100838708 CTAGTGGGACTCTTCTGGGTGGG + Intergenic
1122425584 14:101603422-101603444 CCAGAAACACTCTCCTAGGAGGG + Intergenic
1122592141 14:102861330-102861352 CGAGAGGGACTCTACTGAGAGGG + Intronic
1123467272 15:20526520-20526542 CCAGAGACACCCGCCTGGGAGGG - Intergenic
1123741251 15:23283364-23283386 CCAGAGACACCCGCCTGGGAGGG + Intergenic
1123745746 15:23319194-23319216 CCAGAGACACCCGCCTGGGAGGG - Intergenic
1123984390 15:25632297-25632319 CCAGAGAGGCCATTGTGGGAGGG + Intergenic
1124204278 15:27703928-27703950 CCTCAGAGAATGTTCTGGGAAGG + Intergenic
1124278018 15:28342511-28342533 CCAGAGACACCCGCCTGGGAGGG - Intergenic
1126551056 15:49929971-49929993 CCTGAGAAACTAATCTGGGATGG + Intronic
1126705371 15:51400872-51400894 CCAAAAGTACTCTTCTGGGAGGG - Intronic
1126726425 15:51636882-51636904 CAAGAGGGACTCTACTGAGAGGG + Intergenic
1130512557 15:84601312-84601334 CCAGGGAGACGCGTCCGGGACGG - Intronic
1130619267 15:85444683-85444705 CCACAGAGGCTTTTGTGGGAAGG + Intronic
1132143614 15:99414079-99414101 CCCTGGAGACTCTTCTGGGCTGG - Intergenic
1138559941 16:57795362-57795384 CCAAAGATTCTCTTCTGGAAGGG + Intronic
1138599355 16:58045856-58045878 CCAGAGAGACTCACTTGGGAAGG - Exonic
1139212345 16:65091966-65091988 CCAGAGAGACTTCTCTGGGGAGG - Intronic
1139292713 16:65872937-65872959 CCAGAGACATTCTCCTTGGAAGG + Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1141445318 16:84054401-84054423 CCAGAGAGAGCCTTCACGGACGG - Exonic
1142037607 16:87871387-87871409 CCAGATAGACTTTTCTGAGGTGG + Intergenic
1143092928 17:4459970-4459992 CCAGAGAGACCTCTCTGAGAAGG + Intronic
1143734961 17:8905110-8905132 CCAGGGTGTCTCTACTGGGAGGG + Intronic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1145258964 17:21343444-21343466 ACAGAGAGTCCCTTCTGGGCAGG - Intergenic
1145317659 17:21744560-21744582 ACAGAGAGTCCCTTCTGGGCAGG + Intergenic
1147995814 17:44359829-44359851 CCAAGGAGACTATTTTGGGAAGG + Intronic
1148723454 17:49771733-49771755 CCAGAGACTTTCCTCTGGGAGGG - Intronic
1149292411 17:55230069-55230091 CCAGAGGGGCTCTTCTGATATGG + Intergenic
1150316909 17:64176528-64176550 CCAAAGTGACTCTTCTTGGCTGG + Intronic
1151284068 17:73097099-73097121 CCACAGTGACTCCTCTGGAAAGG - Intergenic
1151359383 17:73579453-73579475 TCGGGGAGACTCTTCAGGGAGGG - Intronic
1151363601 17:73603336-73603358 CTAGAGAGAGACTTCTGGGCCGG + Intronic
1157466406 18:47950138-47950160 CCAATGAGTCTCTTCTTGGAGGG + Intergenic
1158904759 18:62001230-62001252 CCAGAGAAACTCTACTAGGGTGG - Intergenic
1159922441 18:74237975-74237997 CCAGAGAGAACGTTCTGGAAGGG - Intergenic
1160090578 18:75823118-75823140 CCAGAGAGGCTCCTCAGGAAAGG - Intergenic
1160477853 18:79208887-79208909 CCAGGAGGACTCTTCTGGGGTGG + Intronic
1160985582 19:1837158-1837180 CCAGAGGGTCTGTTATGGGATGG - Intronic
1161826765 19:6572731-6572753 CACAAGAGAATCTTCTGGGAAGG - Intergenic
1162594220 19:11614590-11614612 CTGTAGAGATTCTTCTGGGAAGG - Exonic
1162602856 19:11682609-11682631 CTGTAGAGATTCTTCTGGGAAGG - Intergenic
1162607876 19:11725242-11725264 CTGTAGAGACTCTTCTGTGATGG + Exonic
1162613684 19:11777674-11777696 CTGTAGAGACTCTTCTGTGATGG - Exonic
1162640034 19:12001193-12001215 CTGTAGAGATTCTTCTGGGAAGG - Intergenic
1162641996 19:12018207-12018229 CTACAGAGATTTTTCTGGGAAGG + Exonic
1162649323 19:12074094-12074116 CTGTAGAGATTCTTCTGGGAAGG - Exonic
1162656568 19:12135810-12135832 CTGTAGAGATTCTTCTGGGAAGG + Exonic
1162658128 19:12147717-12147739 CTGTAGAGATTCTTCTGGGAAGG + Exonic
1162663097 19:12185848-12185870 CTGTAGAGATTCTTCTGGGAAGG - Exonic
1163557207 19:17999586-17999608 TCAGAGAGACCCTTCAGGGGTGG + Exonic
1163853131 19:19677927-19677949 CTGTAGAGATTCTTCTGGGAAGG - Exonic
1163882581 19:19939610-19939632 CCAGAGAATCTCATCTGAGAAGG - Intergenic
1163910206 19:20182861-20182883 CCAGAGAATCTCATCTGAGAAGG + Intronic
1163936493 19:20449418-20449440 TCAGAGAGTCTCATCTGAGAAGG + Intergenic
1164076293 19:21821948-21821970 CCAGAGAATCTCATCTGGAAAGG - Intronic
1165828540 19:38719260-38719282 CCAGGGAGACTGTGTTGGGAAGG - Intronic
1166819496 19:45568775-45568797 CCACAGAGACGGTGCTGGGATGG + Intronic
925897173 2:8481488-8481510 GCACAGAGACGCTTCTGGGCTGG + Intergenic
928170906 2:29002522-29002544 CCAGAGAGGCTGTACAGGGATGG - Exonic
928312128 2:30219923-30219945 CCATAGGGAGTTTTCTGGGATGG + Intergenic
928416999 2:31103208-31103230 CCAGTGTGATTCTTCTGGGAAGG + Intronic
934097116 2:88616968-88616990 CCAGAGACATGCTTCTGGGGAGG - Intronic
937069551 2:119052868-119052890 CCAGAGAGGATCTGATGGGATGG + Intergenic
938920189 2:135987720-135987742 CCTGAGAGGCTGTTATGGGATGG + Intergenic
940071388 2:149692177-149692199 TCAGAGAGACTGCTCTGTGAAGG + Intergenic
941754006 2:169165082-169165104 CCTGACAGTCTCCTCTGGGATGG + Intronic
941770963 2:169345437-169345459 ACAGAGACATTCATCTGGGAAGG + Intronic
941901681 2:170684801-170684823 CTAAAAAGTCTCTTCTGGGATGG + Intergenic
945771520 2:214048951-214048973 ACAGAGAGACCCTGTTGGGAAGG - Intronic
946676665 2:222167727-222167749 CCAGAGGAACTCTGCTGGCAAGG + Intergenic
948631010 2:239302831-239302853 CTTGAGAGACTCTTTTGGGGAGG - Intronic
949010792 2:241677268-241677290 CCAGTGAGAGGCATCTGGGAAGG - Intronic
1168858504 20:1027956-1027978 ACAGAGAGACTCCCCTGGGTTGG - Intergenic
1170261258 20:14411019-14411041 CCAGTGATACTTTTCTGGAAGGG - Intronic
1170601925 20:17848086-17848108 CCAGAGACACCCTTGTGAGATGG - Intergenic
1175494131 20:59402206-59402228 AGAGAGAGACTTTTCTGAGAGGG - Intergenic
1175522490 20:59611014-59611036 CCAAAGAGGCCCTTCTGGCAAGG - Intronic
1175606716 20:60317255-60317277 CCACAGAGCCTCTTCTAGCATGG - Intergenic
1175950004 20:62578355-62578377 CTAGAGAGACTTTTCAGGGCAGG - Intergenic
1175984700 20:62758872-62758894 CCTGTGAGGCTCCTCTGGGAGGG - Intronic
1176231609 20:64035950-64035972 CCAGAGATACTGTTCTGTCAAGG - Intronic
1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG + Intergenic
1177735959 21:25090492-25090514 CAAGAGAGACTTTTGTGGGAGGG + Intergenic
1181487785 22:23242388-23242410 CCATAAAGATTCCTCTGGGAGGG - Intronic
1181516865 22:23419337-23419359 CCAGAGACAGTCTTCAGGGGAGG - Intergenic
1183588643 22:38767549-38767571 CTAGAGGGACGCTCCTGGGAGGG + Intronic
1183976421 22:41515028-41515050 CCAGAGAAACTGTCCTGTGATGG - Intronic
1184143646 22:42595302-42595324 CCTGTGCGACTCTGCTGGGAGGG + Intronic
1184709697 22:46241710-46241732 CCAGAGAAACCCTTTTGTGAGGG + Exonic
1184979942 22:48089115-48089137 CCAGAGAGACAAGTCTGGCATGG + Intergenic
1185389277 22:50549988-50550010 CCAGGGAGACCCTCCTGGGATGG + Exonic
950362373 3:12458872-12458894 GCAGAGAGACGCTGCTGGGGAGG + Intergenic
951631417 3:24725408-24725430 GCAGATAGAATTTTCTGGGAAGG + Intergenic
952002570 3:28803351-28803373 CCAGAGAGGCCTTTCTGAGAAGG - Intergenic
953140558 3:40225772-40225794 CGCGAGAGACTCTTTGGGGAGGG - Intronic
955552948 3:60103664-60103686 CCATAAAGATTCTTTTGGGAGGG - Intronic
955780308 3:62477592-62477614 CCAGGCAGACTGTTCTGAGAAGG - Intronic
955985769 3:64572740-64572762 CCAGAAAGAGGCTTCTGGGTGGG + Intronic
958960504 3:100505186-100505208 CCAGAGAGCCTCTTGTGTGGAGG + Intronic
959237715 3:103746082-103746104 CCAGAGAGCCTATTCCAGGAAGG + Intergenic
960345645 3:116528531-116528553 CCATTGAGACTCTTCTATGATGG + Intronic
960850713 3:122050900-122050922 CCAGAGAGAGTATTCTTGGTTGG + Intergenic
966308248 3:178562386-178562408 CCAGAGACAGGATTCTGGGAAGG + Intronic
967774877 3:193376003-193376025 CCACAGGGAATCTTCGGGGAAGG + Intronic
967892445 3:194372765-194372787 CCAGAGAGAGTTCTCTGTGAAGG - Intergenic
967968358 3:194981361-194981383 CTAGAGAAACTCTTCTATGAGGG + Intergenic
968046491 3:195626668-195626690 CCAGACAGACTCTCCTTGGTGGG + Intergenic
968308162 3:197663373-197663395 CCAGACAGACTCTCCTTGGTGGG - Intergenic
968739669 4:2321055-2321077 CCAGAGAAGGTCCTCTGGGATGG - Intronic
970299681 4:14668112-14668134 ACAGAGAGACTGTTGTGAGAAGG - Intergenic
970691791 4:18629493-18629515 CCTGAGAGACTCGTCTGAGTTGG - Intergenic
970882285 4:20946255-20946277 CCAGAGTGACTACTCTGAGATGG + Intronic
970959118 4:21852192-21852214 CCAGAGAGTCTGTCCCGGGAAGG + Intronic
971154115 4:24064077-24064099 CTGGAAAGCCTCTTCTGGGAAGG - Intergenic
971243716 4:24911024-24911046 CTGGAGAAACTCTGCTGGGATGG + Intronic
971382395 4:26110855-26110877 CCAGAGAGACTGTCCTGAGAAGG - Intergenic
974259228 4:59503441-59503463 CCAGAGAGACTTCTCCGTGAAGG + Intergenic
975683596 4:76898271-76898293 CCGGCCTGACTCTTCTGGGATGG - Intergenic
978210240 4:106126719-106126741 TCAGACAAACTCTTCAGGGATGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980462553 4:133135299-133135321 TCAAAGAGTCTCTTTTGGGATGG - Intergenic
982081166 4:151791723-151791745 TCAGAGATACTCATCTGGAATGG + Intergenic
982129011 4:152210236-152210258 CCAAAGAGACTCTGCTGTGGTGG + Intergenic
983938618 4:173520130-173520152 TCAGGGAGACTCTTCTGTAAAGG - Intergenic
985920472 5:2967460-2967482 CCAGGGAGGCCCTTCTAGGAAGG + Intergenic
987092057 5:14516895-14516917 CCATAAAGATTCCTCTGGGAGGG - Intronic
988592685 5:32562673-32562695 CCATAAAGGCTCCTCTGGGAGGG - Intronic
990767638 5:59204570-59204592 ATAGAGAGACTTTTCTAGGACGG + Intronic
991590435 5:68246269-68246291 CAAAAGAGACTCTGCAGGGAAGG - Intronic
994128192 5:96193518-96193540 CCAGAGAGTATCTTCTGTAATGG - Intergenic
995687447 5:114785931-114785953 CAACAGAGACACTTCTAGGAAGG + Intergenic
999426461 5:151491536-151491558 ACAGAGAGAATGTTCTAGGAAGG - Exonic
999529315 5:152444876-152444898 CCAGAAAGACTCTGCTGGCTTGG + Intergenic
1000369299 5:160519560-160519582 CCAGAGAGAGTCCTTTGGCATGG - Intergenic
1001629041 5:173160899-173160921 CCAGAGTGTCTCCTCTGTGATGG + Intronic
1002176865 5:177405578-177405600 CCAGAGGGAGAGTTCTGGGAAGG - Intronic
1002297869 5:178241395-178241417 CCAGAGAGACTCTTCTGGGAAGG + Intronic
1003623077 6:7719413-7719435 ACAGAGGGAATCTTGTGGGAAGG + Intergenic
1003656934 6:8020528-8020550 CCAGAGAAACTCAGCTGGGGTGG - Intronic
1005448885 6:25954080-25954102 CAAGAGAGACTTTACTGAGAGGG + Intergenic
1005882418 6:30071467-30071489 CTGCAGAGACTCTTCTGGGGAGG - Exonic
1006441967 6:34058642-34058664 CCAGGCAGACTCTTCAGGAAAGG + Intronic
1007166968 6:39835643-39835665 CCAGTGAGATTCATCAGGGAAGG + Intronic
1007272553 6:40649540-40649562 CCATGGAGACCCTTCGGGGAGGG - Intergenic
1009450473 6:63794092-63794114 CCAGAGAGAAGCATTTGGGAAGG - Intronic
1009587170 6:65622139-65622161 CCAGAGAGAATCAGCTGAGAAGG - Intronic
1015561102 6:134516953-134516975 CCAGAGGGTGTCTTCTGGGCTGG + Intergenic
1017652221 6:156594132-156594154 TCAAAGAGACTGTTCTGGGTGGG - Intergenic
1017758868 6:157552740-157552762 CCTGAGAGGCTCTGCAGGGAAGG - Intronic
1021847029 7:24773111-24773133 CAAGACAGACTTTTCAGGGATGG - Intergenic
1023764782 7:43500393-43500415 CCTGAAAGACTGTTCTGGGGCGG - Intronic
1025774306 7:64546249-64546271 CCAGAGAATCTCATCTGAGAAGG - Intronic
1025804079 7:64812790-64812812 CCAGAGAATCTCATCTGAGAAGG + Intronic
1025816233 7:64914865-64914887 CCAGAGACTCTCATCTGAGAAGG + Intronic
1026288305 7:68983508-68983530 ACACAGAGTCACTTCTGGGAGGG - Intergenic
1027700826 7:81468431-81468453 ACAGACAGAATTTTCTGGGAGGG + Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1030302291 7:107986523-107986545 CCACAGAGACTCTTCTTGCAAGG + Intronic
1030819112 7:114075802-114075824 CTAGAGAGACTTTTATGGTAAGG - Intronic
1034584232 7:152075001-152075023 CCAGAGAGATCCCTCTGGCAGGG - Exonic
1035732776 8:1864581-1864603 CCAGGGACACTCGCCTGGGAGGG - Intronic
1038284006 8:26190665-26190687 CCAGTGAGACGCTTATGGGAAGG + Intergenic
1038941333 8:32309169-32309191 CCATAAAGATTCCTCTGGGAGGG + Intronic
1039299440 8:36193799-36193821 CCAGAGAGAGAATGCTGGGAGGG - Intergenic
1040470883 8:47734996-47735018 GCACACAGACTCTGCTGGGAAGG - Intronic
1040632451 8:49231013-49231035 CCATAAAGATTCCTCTGGGAGGG - Intergenic
1041168776 8:55119279-55119301 TCTGAGAGTCTCTTCTGGGAGGG - Intronic
1041168782 8:55119311-55119333 TCTAAGAGTCTCTTCTGGGAGGG - Intronic
1042035560 8:64529711-64529733 CCCAAGTGACTCTACTGGGAAGG + Intergenic
1046002265 8:108435153-108435175 GCACAGATGCTCTTCTGGGAAGG - Intronic
1046628790 8:116603173-116603195 CAAGAGGGAGCCTTCTGGGATGG - Intergenic
1049207251 8:141369331-141369353 CCAGGGAGACTCTTCTCAGCAGG + Intergenic
1050603045 9:7272079-7272101 CCAGAGAGAGTCTCCTGGGCAGG + Intergenic
1053433665 9:38060763-38060785 GCACAGAGACTGTTCTGGGCAGG - Intronic
1056932739 9:90892380-90892402 CCATAAAGATTCCTCTGGGAAGG - Intronic
1057580321 9:96281542-96281564 CGAGAGGGACTTTTCTGAGAGGG - Intronic
1060114284 9:120928595-120928617 GCAGAGAGACTCCTCGTGGATGG - Exonic
1060553462 9:124496547-124496569 CCAGAGGGGCCCTGCTGGGAGGG - Intronic
1060824411 9:126679784-126679806 GCAGAGAGCCCATTCTGGGAGGG - Intronic
1188679392 X:32983049-32983071 CCATAAAGATTCCTCTGGGAGGG + Intronic
1189675151 X:43453778-43453800 CCATAAAGATTCCTCTGGGAGGG + Intergenic
1190147960 X:47914944-47914966 CCAGAAATTCTCCTCTGGGAAGG - Exonic
1190710714 X:53067306-53067328 CCTGTGAGATTCTACTGGGAGGG + Intronic
1190823680 X:53997523-53997545 CCAGAGACCCTGGTCTGGGAAGG - Intronic
1195317965 X:103697132-103697154 CCAGAGGCTCACTTCTGGGATGG - Intergenic
1195397217 X:104424676-104424698 CCAGAGTAACTCTTTTGGCATGG + Intergenic
1199189547 X:144953638-144953660 CCAGTGAAACTCTGCTGGGTTGG - Intergenic
1199364000 X:146957050-146957072 CCAGAGAGAGTGAACTGGGAGGG + Intergenic
1199687818 X:150280186-150280208 CCAGGGACACCTTTCTGGGAAGG - Intergenic
1201147663 Y:11073674-11073696 CCAGAGTTCCTCTTCTGGTAAGG - Intergenic