ID: 1002298955

View in Genome Browser
Species Human (GRCh38)
Location 5:178246963-178246985
Sequence AGAGATTTGCTCACGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002298953_1002298955 -5 Left 1002298953 5:178246945-178246967 CCTCTGAGCTGGGGAAGCAGAGA 0: 1
1: 0
2: 5
3: 65
4: 493
Right 1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1002298946_1002298955 20 Left 1002298946 5:178246920-178246942 CCACGATTCTCAGTCCCACATCT 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1002298950_1002298955 5 Left 1002298950 5:178246935-178246957 CCACATCTGGCCTCTGAGCTGGG 0: 1
1: 0
2: 3
3: 45
4: 420
Right 1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1002298945_1002298955 29 Left 1002298945 5:178246911-178246933 CCTGGGCTTCCACGATTCTCAGT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1002298948_1002298955 6 Left 1002298948 5:178246934-178246956 CCCACATCTGGCCTCTGAGCTGG 0: 1
1: 0
2: 2
3: 30
4: 305
Right 1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002298955 Original CRISPR AGAGATTTGCTCACGCCAGG AGG Intronic
907020406 1:51060928-51060950 AGAGTTTTGCTCAAGCCTGCTGG - Intergenic
909540692 1:76788148-76788170 AGAGATTTCCTCCCGGCAGCAGG - Intergenic
915496998 1:156288990-156289012 AGAGAGTTGCTCAGGTCAGTCGG + Intronic
916875489 1:168964177-168964199 AGAGATTTGGTCAGGCAAGGAGG - Intergenic
917981886 1:180274606-180274628 AGATATTCTCTCAAGCCAGGGGG - Exonic
920270891 1:204762968-204762990 AGAAATTTCCACATGCCAGGTGG + Intergenic
920674496 1:208029691-208029713 AGAGATTTTCCCACCCCAAGAGG + Intronic
921460358 1:215418560-215418582 AGAGATTTCCTCATTCCATGAGG + Intergenic
922638494 1:227202071-227202093 GGAGAATTGCTCACACCCGGAGG - Intronic
1063201027 10:3785418-3785440 AGAGTCTCGGTCACGCCAGGCGG - Intergenic
1065809867 10:29431420-29431442 AGAGATGTGGTCATGCCATGTGG + Intergenic
1073456952 10:103643111-103643133 AGAGAGCTGCTAACGTCAGGCGG - Intronic
1075875330 10:125801210-125801232 AGAGATTTTCCCAATCCAGGAGG + Intronic
1084709565 11:70835631-70835653 AGAGAATGGCTCACTCCAAGAGG - Intronic
1085230650 11:74966851-74966873 GGAGAATTGCTCGAGCCAGGAGG - Intronic
1087226837 11:95610662-95610684 AGAGATTTGCTTGAGCCTGGAGG + Intergenic
1088358476 11:108967426-108967448 AACAATTTGCTCAGGCCAGGTGG + Intergenic
1088589988 11:111395128-111395150 AGAAATTGGCCCAGGCCAGGTGG + Intronic
1090592805 11:128290715-128290737 AGAGATTTGCTTAAGCCAGATGG + Intergenic
1090691005 11:129181699-129181721 AGAGGTTTGCTGAAGCCAGTTGG + Intronic
1091010956 11:132000006-132000028 AGAGATTTGATTAGGCTAGGTGG - Intronic
1097754807 12:63397804-63397826 AGACATTTGCTGTAGCCAGGCGG + Intergenic
1101836050 12:108296120-108296142 AGAAATGTGCTCAGGACAGGAGG - Intronic
1109633570 13:65084979-65085001 TGAGTTTTGCTCAGGCCAGCTGG + Intergenic
1110005114 13:70255969-70255991 TGAGTTTTGCTCACGACAGCTGG - Intergenic
1115748447 14:36462432-36462454 AGAGGTGTGTGCACGCCAGGAGG + Intergenic
1117236469 14:53782420-53782442 AGAGAATTGCTTGAGCCAGGAGG + Intergenic
1121740746 14:96250713-96250735 AGATAAATGCTCACGGCAGGTGG - Intronic
1122572084 14:102711459-102711481 AGCAATTTGGTCACACCAGGGGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127932243 15:63604602-63604624 AGTGTTTTGCTCATGCCTGGTGG - Intergenic
1133020364 16:2964361-2964383 AGAGATTTACCCACCCCAGACGG + Exonic
1135623221 16:23974060-23974082 ATATATTTGCTCAGGGCAGGGGG + Intronic
1135987749 16:27196535-27196557 AGAGAATTGCTGAACCCAGGAGG - Intergenic
1137234501 16:46603946-46603968 GGAGAGTTTCTCACTCCAGGTGG - Intronic
1139529188 16:67534209-67534231 TGAGAATTGCTCAACCCAGGAGG - Intronic
1141359371 16:83381235-83381257 AGAGATGTGCTCACTCCAGATGG - Intronic
1147606595 17:41777197-41777219 GGAACTTCGCTCACGCCAGGTGG + Intronic
1148248412 17:46052210-46052232 AGAGATTATCTCACTCCAGTAGG + Intronic
1149461259 17:56832035-56832057 AGAGAATTGCTTAACCCAGGAGG - Intronic
1161324387 19:3656331-3656353 AGACATCTGCTCCCGCCAGCCGG + Intronic
1164697799 19:30259840-30259862 AGAGAATTGCTGAACCCAGGAGG - Intronic
1165211957 19:34243076-34243098 AGAGATTTGCTCACTCTAGATGG - Intergenic
927377476 2:22435142-22435164 AGAAATCTGCTCAGCCCAGGGGG - Intergenic
930569192 2:53063287-53063309 AGAAATTTGCCCAAGCCAGGAGG + Intergenic
932993537 2:76818478-76818500 AAGCATTTGCTCACTCCAGGAGG - Intronic
937928735 2:127188292-127188314 AGAGCTGTGATCACGCCATGGGG - Intronic
938111176 2:128566223-128566245 AGAGAATTGCTCAAACCTGGGGG + Intergenic
941034300 2:160550889-160550911 AGCCATTTGCTCACCCAAGGAGG - Intergenic
945325267 2:208474549-208474571 AGAGATTAGCCCATGCCAAGTGG + Intronic
947068402 2:226257056-226257078 CGACATTTGCTCAGGGCAGGTGG - Intergenic
1169970538 20:11265299-11265321 AGAGAGTTCCTCACTCCAAGAGG - Intergenic
1177251866 21:18603068-18603090 AGAGACTAGCTCTCGCCATGTGG + Intergenic
1179780741 21:43699282-43699304 AGAGACATCCTCACACCAGGGGG - Intergenic
1180733532 22:17999988-18000010 AGAGATGTGCTCACGGGAGAAGG + Intronic
1182845579 22:33428403-33428425 AGAGAATTGCTTAACCCAGGAGG - Intronic
1184229533 22:43151356-43151378 AGAGACTTGCTCGCGGCCGGGGG + Intergenic
949604400 3:5637366-5637388 AGAGAGATGATCAGGCCAGGAGG - Intergenic
951075029 3:18380107-18380129 ATAGATTTGATCACCCCATGGGG + Intronic
952203311 3:31152737-31152759 AGAGAATTGCTGAATCCAGGAGG + Intergenic
957638179 3:82814755-82814777 AGAGTTTTGCTCAGGCCTGCTGG + Intergenic
964434933 3:156641423-156641445 AGAGATATCCTCAAGGCAGGTGG - Intergenic
965884255 3:173424333-173424355 AGAAATTTGCTCAAGTAAGGAGG - Intronic
968594927 4:1477329-1477351 AGAGATTTGCACAAGCATGGCGG + Intergenic
969412367 4:7037309-7037331 AGAGAGTTGTTCATGCCAGCAGG - Intergenic
985034121 4:185821104-185821126 TGTGATTTGCCCACGCCCGGGGG + Intronic
985706531 5:1404616-1404638 AGAGGTTAGCACACGCCAGAGGG + Intronic
987100724 5:14589250-14589272 AGGGATTTGCTCAAGCCTGGAGG + Intronic
991238489 5:64427457-64427479 AGAGAATTGTTGACCCCAGGAGG + Intergenic
994903520 5:105805763-105805785 AGAGGATTGCTCAAGCCAGGAGG - Intergenic
995680113 5:114706745-114706767 TGAGATTTGCTCACTCTAGATGG - Intergenic
998134754 5:139668717-139668739 AGAGATATGCTTATCCCAGGCGG + Intronic
1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG + Intronic
1004408529 6:15358821-15358843 ATAGATTTTTTCATGCCAGGAGG + Intronic
1017567830 6:155708203-155708225 AGACAATTGCTCTAGCCAGGGGG + Intergenic
1025824983 7:65003389-65003411 AGAGATTTGCTGGAACCAGGAGG + Intronic
1029170272 7:98625315-98625337 ATAGCTTTGCACACGCCGGGCGG + Intronic
1037260153 8:17000039-17000061 AGAACTTTGCTGACACCAGGTGG - Intronic
1037420872 8:18701054-18701076 AGAGGATTGCTTAAGCCAGGAGG - Intronic
1038659346 8:29483229-29483251 AGAGAATTGCTTAAACCAGGAGG + Intergenic
1039872239 8:41556302-41556324 AGAGAATTGCTTGAGCCAGGAGG - Intergenic
1044412439 8:91898983-91899005 GGAGAATTGCTCAACCCAGGAGG + Intergenic
1044420088 8:91984690-91984712 AGAGATTTGCTTAGGACAGAGGG - Intronic
1044558354 8:93588890-93588912 AGGGATTTGGCCAGGCCAGGAGG - Intergenic
1049075253 8:140390646-140390668 AGAGATATGAGCAAGCCAGGTGG - Intronic
1051335676 9:16063945-16063967 CAAGACTTGCTCACTCCAGGAGG - Intergenic
1051582558 9:18693742-18693764 AGAGATTTGGTCAAGTGAGGGGG + Intronic
1059349066 9:113651607-113651629 AGAGAATAGCCCACACCAGGGGG - Intergenic
1060667251 9:125439291-125439313 CGGGAGTGGCTCACGCCAGGAGG - Intronic
1185856757 X:3543315-3543337 GGGGATTGGCTCACCCCAGGGGG + Intergenic
1190514515 X:51209011-51209033 AGAAATTTGCTCTGGCCAGTGGG - Intergenic
1193108274 X:77703216-77703238 AGAGTTTTGCTCAGGCCTGCTGG + Intronic