ID: 1002300537

View in Genome Browser
Species Human (GRCh38)
Location 5:178255158-178255180
Sequence CCCTCCCCAGGGTGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002300529_1002300537 -6 Left 1002300529 5:178255141-178255163 CCAGGCTGCACGCATGCCCCTCC 0: 1
1: 1
2: 1
3: 19
4: 231
Right 1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG 0: 1
1: 1
2: 4
3: 36
4: 367
1002300525_1002300537 26 Left 1002300525 5:178255109-178255131 CCAGAGAGAAAGCAATGGAAGAG 0: 1
1: 0
2: 3
3: 40
4: 510
Right 1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG 0: 1
1: 1
2: 4
3: 36
4: 367
1002300528_1002300537 -5 Left 1002300528 5:178255140-178255162 CCCAGGCTGCACGCATGCCCCTC 0: 1
1: 0
2: 1
3: 12
4: 186
Right 1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG 0: 1
1: 1
2: 4
3: 36
4: 367
1002300527_1002300537 3 Left 1002300527 5:178255132-178255154 CCTCGTCACCCAGGCTGCACGCA 0: 1
1: 1
2: 4
3: 31
4: 373
Right 1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG 0: 1
1: 1
2: 4
3: 36
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002300537 Original CRISPR CCCTCCCCAGGGTGGATGGA GGG Intronic
900324601 1:2102219-2102241 TCCTGCCCAGGATGGATGGGTGG + Intronic
900346791 1:2214055-2214077 CCCTGCCCTGGGTGGAGGAAGGG - Intergenic
900707383 1:4089167-4089189 CCCTCCCCAGGGTGGTTGGAAGG - Intergenic
901756366 1:11443899-11443921 CCCTGCCCAGGCTGGTTGGCTGG - Intergenic
902038953 1:13478747-13478769 ACCCCCCCAGGGTGGTTGCAGGG - Intronic
902192112 1:14771059-14771081 CCATCCCCAGTGTGGGAGGAGGG + Intronic
902940688 1:19798733-19798755 CCCTCCCCAGGCTGAAGGGCAGG + Intronic
903160976 1:21488981-21489003 TCCTCCCCAGGATGGCTGCAAGG - Intergenic
903674696 1:25056398-25056420 GCCTTCCCAGTGTGGCTGGAGGG - Intergenic
904453543 1:30632417-30632439 CCCTCCACAGGGTTGAGGCAGGG + Intergenic
904567190 1:31434966-31434988 CCCTCCCTCGGATGGTTGGATGG - Intergenic
904849296 1:33445268-33445290 TCCTCCGCAGGCTGGATGCACGG + Intergenic
904944500 1:34189481-34189503 CCCTGCCCAGTGTGGAAGCAAGG - Intronic
904992481 1:34604352-34604374 CCCTACCCAGGGTGGAGGAGAGG + Intergenic
905416799 1:37809105-37809127 CCCTCCCCAGGGCCGGTGGCTGG + Exonic
905627007 1:39495746-39495768 CCCTCCTGAGGGAGGAAGGATGG + Intronic
905669929 1:39785025-39785047 CCCTCCTGAGGGAGGAAGGATGG - Intronic
905919954 1:41712777-41712799 TTCTCCCCAGGGAGGATGGAGGG - Intronic
906516583 1:46442711-46442733 CTCTCCCCAGGGTGGAGGGAAGG - Intergenic
907194972 1:52679192-52679214 CCCTCCCCAGGCTTGAGGAATGG - Intergenic
907242703 1:53089694-53089716 CCTTCCCCAGGGTAGAAGGCTGG - Intronic
907243532 1:53093407-53093429 GCCAGCCCTGGGTGGATGGAGGG - Intronic
907285637 1:53377757-53377779 CCCTCCCCAGCTTTAATGGAAGG - Intergenic
907323308 1:53619212-53619234 CCCAGCTCAGGGTGGGTGGATGG - Intronic
910788412 1:91025236-91025258 CCCACCTGAGGGTGGATGGTGGG - Intergenic
911063798 1:93769988-93770010 CCCTCCCCAGGGAAGACAGAGGG - Intronic
912418959 1:109530688-109530710 CCCTCCCAAGGGCCGCTGGAGGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
916379110 1:164188816-164188838 CAATCGCCAGGCTGGATGGAAGG + Intergenic
917269643 1:173258768-173258790 CCCTTCCCAGTGAGGAGGGACGG - Intergenic
917943589 1:179947443-179947465 CCCTGCCCAGGGTGGAAGGCAGG + Intergenic
918180189 1:182080711-182080733 ACTTCCCCTGGGTGGAAGGATGG + Intergenic
918595320 1:186286430-186286452 TCCTCCCCAGGGTGGCAGGTTGG - Intergenic
919120929 1:193339356-193339378 GCCTCCCCAGGAGGGATGGAAGG - Intergenic
919905467 1:202075520-202075542 CCTACCCCAGGGTGTAGGGAGGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922078011 1:222267011-222267033 GCCTCCGCAGGGTGGACGGGAGG + Intergenic
922668514 1:227492121-227492143 CCTGCCCCAGGTTGGAGGGATGG - Intergenic
922956079 1:229601692-229601714 CCCTCACCACACTGGATGGATGG - Intronic
923219975 1:231884001-231884023 CCTTGCCCAGGGTGGGTGGCAGG + Intronic
923629422 1:235640134-235640156 TCCTCCCCAGGCTGAATGCATGG - Intronic
924139897 1:241011497-241011519 CTCTCCACAGTGTGGATTGAGGG + Intronic
924412341 1:243819413-243819435 CCCTGCCCAGTGAGGAGGGATGG - Intronic
1063328462 10:5130086-5130108 CCATCCCAAGGGTGCAGGGATGG + Intronic
1063525549 10:6781324-6781346 CCCCTCCCAGGGATGATGGAAGG + Intergenic
1064423468 10:15210100-15210122 CTCTCCCCACGGAGGGTGGAAGG - Intergenic
1067551865 10:47242035-47242057 CCCTCCCCAGGGTACGTGAAGGG - Intergenic
1067766553 10:49091590-49091612 CCCTCCCCAGGGAAGTTGGCAGG - Intronic
1068640785 10:59404426-59404448 ACCTCCTCAGGGTAGGTGGATGG + Intergenic
1069910393 10:71755324-71755346 CCCTGCCTGGGGTGGGTGGACGG - Intronic
1071393743 10:85200951-85200973 CCCTTTCCAGGGAGTATGGATGG - Intergenic
1074780963 10:116802024-116802046 CCCTCCCCAGGGTGGCTAGCAGG - Intergenic
1075780478 10:125014169-125014191 CACTCCCCAAGCTGGATGCAGGG + Intronic
1075948170 10:126455365-126455387 TCCTCCCCAGGGTGGGAGCAAGG + Intronic
1076000012 10:126906237-126906259 CGCTTCCGAGGGGGGATGGAAGG + Intronic
1076469749 10:130710181-130710203 CCCTCCCCAGGTGGGGTTGAGGG + Intergenic
1076708862 10:132320163-132320185 CCCTCCCCAGCCTGGATTGTGGG - Intronic
1079007693 11:16803695-16803717 CCCTGCCCAGGGTGGTGAGATGG + Intronic
1079307194 11:19333854-19333876 CTCTCACCAGGAGGGATGGAGGG + Intergenic
1081905132 11:46664396-46664418 CCATACCCAGGGGTGATGGAGGG + Intronic
1081929561 11:46859310-46859332 CCCTCCCTAGGGTGGAGAGTGGG + Exonic
1082993185 11:59226538-59226560 CCCTCAGCAGGGTGGATGGTAGG + Intergenic
1083630711 11:64093789-64093811 GCCTGGCCAGGGTGGAAGGAGGG + Intronic
1084944783 11:72632724-72632746 CCCTCCCCTGAGAGGAGGGAGGG + Intronic
1085320302 11:75570027-75570049 CACTACCCAGGGTGGTTGCAAGG - Intronic
1085509649 11:77081812-77081834 CCTTCCCCAGGGTGAAGGGGTGG + Intronic
1087317002 11:96614840-96614862 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
1088742542 11:112778784-112778806 CCCTGCCCAGAGTGGCTGGATGG + Intergenic
1090717995 11:129447224-129447246 CCCTACCCAGGCTGCTTGGAGGG + Intronic
1091044379 11:132312706-132312728 TCCTCCCCATGGTGGACGAATGG + Intronic
1091797643 12:3306361-3306383 CGCTCCCCAGGGAAGAAGGAAGG + Intergenic
1092856750 12:12681215-12681237 CCCTTCCTAGGGTGTATGTAGGG - Intronic
1093340458 12:17967315-17967337 CCCTGCCCAATGAGGATGGATGG + Intergenic
1094452841 12:30600801-30600823 TCCTCCCCAGGTTGGCTGCAAGG - Intergenic
1095929832 12:47614299-47614321 CCCACCCCAGGATGTTTGGAAGG - Intergenic
1096580106 12:52579632-52579654 CCTTTCCCAGGGTGCATGGCTGG + Intergenic
1096610837 12:52800446-52800468 TCCTCCCCAGGCAGGATTGATGG - Intergenic
1096714663 12:53483821-53483843 CCAGCCCCAGGGCGGGTGGAAGG - Intronic
1097156632 12:57016606-57016628 CCAATCCCAGGGTGGCTGGAGGG + Intronic
1097170691 12:57111028-57111050 TCCTCCCCTGGCTGGGTGGATGG - Intronic
1097334935 12:58371617-58371639 CCCACCCCAAGGTGCAGGGAAGG + Intergenic
1100701843 12:97157194-97157216 TCCTCCACAGAGTGTATGGATGG + Intergenic
1100789246 12:98112318-98112340 CTCTCCCCAGGATGCAGGGATGG - Intergenic
1101187219 12:102292046-102292068 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
1101397585 12:104362221-104362243 CCCTCCCCATGCTGCATGGGGGG - Intergenic
1102556645 12:113731145-113731167 CCCACCCCAGGGTGGGAGGCAGG + Intergenic
1103163186 12:118747994-118748016 CACTCACTAGGATGGATGGATGG - Intergenic
1103261475 12:119593079-119593101 CCCTCCCCAGTGTGGAAACAAGG - Intergenic
1104492787 12:129209186-129209208 CCCTGCCTGGGGTGGGTGGAGGG + Intronic
1104953259 12:132451778-132451800 CCGTCCCCAGCGTGGACGGCGGG - Intergenic
1104960950 12:132488594-132488616 GCCTCCCCAGGGTGGGGGCAGGG - Intergenic
1109307914 13:60661472-60661494 CCCTACCCAGTGAGGAGGGATGG + Intergenic
1110986270 13:81973802-81973824 ACCTCCCTTGGGTGGAGGGAGGG - Intergenic
1113018437 13:105855414-105855436 TCCACCCCAAGGTGGGTGGATGG + Intergenic
1113433097 13:110267192-110267214 CCCTCGCCTGTGTGGATGGTGGG - Intronic
1113952326 13:114078967-114078989 CCCTCCCCAGGATGCCTGCAGGG - Intronic
1115447718 14:33510443-33510465 CAGTTCCCAGGGTGGGTGGAGGG + Intronic
1116428650 14:44820652-44820674 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1116560914 14:46377327-46377349 CCCTGCCCATGGAGGAAGGATGG + Intergenic
1118620461 14:67609962-67609984 CCCTCCCAAGGTTGAAAGGAAGG - Intergenic
1119117354 14:72037269-72037291 GCTTCCACAGTGTGGATGGAAGG - Intronic
1119436230 14:74599660-74599682 CCCCCGCCAAGGTGGAAGGAGGG + Intronic
1119702413 14:76764119-76764141 GCCTGCCCAGGTTGGAAGGAAGG + Intronic
1119866649 14:77980319-77980341 TCCTCCCCAGGTTGGACTGATGG - Intergenic
1120671249 14:87365304-87365326 CCCACCCCAGTGTGTCTGGAAGG - Intergenic
1122817095 14:104319214-104319236 CCCTCCCCATGGTGACAGGAGGG + Intergenic
1122967149 14:105136680-105136702 CCCTGCCCACTGTGGATGGTGGG - Intergenic
1123033364 14:105461528-105461550 ACCTCCCCAGGGCTGATGGTTGG - Intronic
1123034380 14:105466006-105466028 CCCTGGCCAGGCTGGCTGGATGG + Intronic
1123040041 14:105486719-105486741 CCCTCCCCAGGACGGAGGGTCGG - Intergenic
1123216432 14:106813139-106813161 CCCTGCCCAGGCTGCAAGGAGGG + Intergenic
1124046524 15:26155730-26155752 CCCTTCCCAGTGAGGAGGGATGG + Intergenic
1124350163 15:28949372-28949394 CACTTTCCAGGGTGCATGGATGG + Intronic
1125970445 15:43907086-43907108 CTCTCCACAGGGAGGATGGTGGG + Intronic
1126167035 15:45662536-45662558 CGCCCCCCAGGGTGGCTGGATGG - Intronic
1126495478 15:49285360-49285382 CCCTGCCCAGGGTGGGTCGGTGG - Intronic
1126803930 15:52326533-52326555 CGCTCCCCAGGGCTGAGGGAGGG + Intronic
1127054245 15:55115614-55115636 CGCTCCCCAGGGTGGAGGGAAGG - Intergenic
1127847771 15:62886522-62886544 CAGTCCACAGGGTGGAGGGAGGG - Intergenic
1127871819 15:63080303-63080325 CCCTCTCCAGTGTGGGAGGAGGG + Intergenic
1128323149 15:66706399-66706421 CTGTCCCCAGGGTGGCTGAATGG - Intronic
1129239374 15:74242539-74242561 ACCTCCTCAGGGTGGAGGCAGGG - Intronic
1131600750 15:93846392-93846414 CCCTACCCAGTGAGGAGGGACGG - Intergenic
1131873900 15:96784782-96784804 CTGTCCCCAGAGTGGCTGGATGG + Intronic
1132116939 15:99144285-99144307 CCCTTCCCAGTGTGGACAGAGGG + Intronic
1132571326 16:645666-645688 CCGACCCCAGGGCAGATGGAGGG + Intronic
1132677811 16:1127847-1127869 CCTTCTCCAGGCTGGAGGGAGGG - Intergenic
1133018611 16:2956069-2956091 CCCTCCCCAGGGTGCAGGAAGGG + Intergenic
1134680525 16:16121910-16121932 CCCTGCCCTGGGAGGATGGCAGG + Intronic
1135134261 16:19876096-19876118 CCAGCCCCAGGGTGGCTGGGAGG + Intronic
1136092983 16:27933935-27933957 CCCTCCACGGGGAGGATGAAGGG + Intronic
1136579559 16:31143244-31143266 CCCTCCCCAGGGGGTGTGGGGGG - Intronic
1136712708 16:32253298-32253320 CGTTCCCCACGGTGGATGGTGGG - Exonic
1136755208 16:32676131-32676153 CGTTCCCCACGGTGGATGGTGGG + Exonic
1136812905 16:33194238-33194260 CGTTCCCCACGGTGGATGGTGGG - Exonic
1136819381 16:33304318-33304340 CGTTCCCCACGGTGGATGGTGGG - Intronic
1136825944 16:33360853-33360875 CGTTCCCCACGGTGGATGGTGGG - Exonic
1136831010 16:33459624-33459646 CGTTCCCCACGGTGGATGGTGGG - Intergenic
1137252007 16:46747680-46747702 CCCTGCCCTGGCTGGATGGGAGG - Intronic
1138111680 16:54329199-54329221 CACTCCCCATGGTGGACTGATGG - Intergenic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1139471201 16:67179060-67179082 GGCCCTCCAGGGTGGATGGAAGG - Intronic
1140283074 16:73573284-73573306 CCCTCCCCAATGTGAAGGGATGG + Intergenic
1140481980 16:75266831-75266853 CCCACCCCAGGGAGGAAAGACGG + Intronic
1141169917 16:81684786-81684808 CCCTTCCCAGCTTGGACGGAGGG - Intronic
1202991482 16_KI270728v1_random:17208-17230 CGTTCCCCACGGTGGATGGTGGG - Intergenic
1203057350 16_KI270728v1_random:936470-936492 CGTTCCCCACGGTGGATGGTGGG + Intergenic
1142478874 17:205949-205971 CCCTCGCCAGGGGAGATGGACGG - Intergenic
1142694659 17:1627266-1627288 CCCTCCCTGGGGTGGAGGCAAGG + Intronic
1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG + Intergenic
1143116970 17:4586668-4586690 CCCTCTTCGGGGTGGATGGAAGG + Intronic
1143203322 17:5127014-5127036 CCCGCACCAGGGTGGGGGGAGGG + Intronic
1143777145 17:9206807-9206829 CCCTCTCCAGGGAGGTTTGAAGG - Intronic
1143782208 17:9234803-9234825 CCCTCCCCAGGCAGGGTTGAGGG + Intronic
1144494202 17:15736548-15736570 CACTGCGCAGGGTGGATGGAGGG + Intronic
1144834647 17:18150550-18150572 GCCTCCCCAGGGTGGTTCCAGGG + Intronic
1144874489 17:18390339-18390361 CCCGCACCAGGGTGGGGGGAGGG + Intergenic
1144906059 17:18640128-18640150 CACTGCGCAGGGTGGATGGAGGG - Intronic
1145987596 17:29057632-29057654 ACCACCCCAGGGTGGGTGGAGGG + Intergenic
1145989446 17:29070084-29070106 CCCTCACTAGGGGGGATGAAGGG + Intergenic
1146009119 17:29180048-29180070 CGCCCCCCAGGTTGGCTGGAAGG + Intronic
1146061996 17:29612588-29612610 CTCTCCCCGGGGTGGGTGGGAGG + Intronic
1146123063 17:30211654-30211676 CCACCCCCAGGGTTAATGGAGGG - Intronic
1146516490 17:33493754-33493776 CCCAGCACAGGGTGGAGGGAGGG - Intronic
1147210800 17:38871353-38871375 CCCTCCCCAGTCTGGAGGGGAGG + Intronic
1147583475 17:41639331-41639353 GCCTCCCCAGGGCGCAGGGAGGG - Intergenic
1148105144 17:45114923-45114945 CACATGCCAGGGTGGATGGAGGG - Intronic
1148343723 17:46889637-46889659 CCCTCCCAACCCTGGATGGAGGG + Intergenic
1148358937 17:46996016-46996038 CCCTTGCCAGGATGGATGGCAGG + Intronic
1148465960 17:47865484-47865506 CCTTCCCCAGGGTGGCTTGGAGG - Intergenic
1148773566 17:50080402-50080424 TCCCCCTCAGGGTGGATGGTAGG - Intronic
1149685090 17:58530733-58530755 CTCCCCACATGGTGGATGGATGG - Intronic
1150787687 17:68176121-68176143 CCCTTGCCAGGGTGGAGGGCAGG - Intergenic
1152456914 17:80421996-80422018 CCCTCCCCCAGGGGGAAGGAGGG - Intronic
1152728537 17:81959243-81959265 CCCTCCCCAGGGTCAAAGCAGGG - Intronic
1152900745 17:82939708-82939730 CGCTCCCCTGGTGGGATGGATGG - Intronic
1154028049 18:10725808-10725830 GGCCCTCCAGGGTGGATGGAAGG + Intronic
1155159352 18:23183096-23183118 CCCTCATCAGTGTGGATGGTTGG + Intronic
1156457856 18:37304808-37304830 GCCACCCCAGGGCTGATGGAAGG - Intronic
1157584845 18:48794443-48794465 GCCTCCCCAGGGTGGGCGAAGGG + Intronic
1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG + Intergenic
1158954071 18:62523302-62523324 CCCTCCCCCGGCGGCATGGAGGG + Exonic
1159982681 18:74804858-74804880 TCCTCGGCAGGGTGGTTGGAAGG - Intronic
1160011981 18:75112943-75112965 CCATGCCCAGGGTGGATGGAGGG + Intergenic
1160445607 18:78924987-78925009 CCCTCCCCAGGGTGGAAAGGAGG - Intergenic
1160514485 18:79470896-79470918 CCCGCCCCAGGGAGGGTGAAGGG - Intronic
1160681206 19:412425-412447 CCCCCACCTGGGGGGATGGAGGG - Intergenic
1160743988 19:701983-702005 CCCTCTCCAGTCTGGCTGGAAGG - Intergenic
1160796940 19:950020-950042 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160796947 19:950049-950071 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160796954 19:950078-950100 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160796961 19:950107-950129 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160796968 19:950136-950158 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160796975 19:950165-950187 CCGTCCCCAGAGTGAACGGATGG + Intronic
1160797038 19:950368-950390 CCGTCCCCAGAGGGAATGGATGG + Intronic
1160808317 19:1001962-1001984 CGCTTCCCAGGGTGGAAGCAGGG - Intronic
1160868032 19:1264661-1264683 CCCGCCCCAGCGTGCCTGGAGGG - Intronic
1161056852 19:2195050-2195072 CCATCCCCAGGGTCCATGGGAGG - Intronic
1161287530 19:3476731-3476753 CCCAGCCCTGGATGGATGGATGG + Intronic
1161350124 19:3786528-3786550 CGCTTCCCAGGGTGGGTGGGGGG - Intronic
1161804691 19:6435981-6436003 CCCTCCCCAGGCTGGAATGCAGG - Intergenic
1162149313 19:8633635-8633657 CCATCCTCAGGGCGGCTGGAGGG - Intergenic
1162519341 19:11170236-11170258 CCCTCCCCAGGCAGGACAGACGG - Exonic
1163694925 19:18759361-18759383 ACCGCCCCAGGGTGGAGGGGCGG - Intronic
1163872168 19:19831101-19831123 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1163886122 19:19966313-19966335 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
1163888345 19:19989165-19989187 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1164458515 19:28428240-28428262 CCCTCCCCAGGGTTCCTGGAGGG + Intergenic
1165363315 19:35350071-35350093 CTCCCCCCAGGGTGCATGGCTGG - Intergenic
1165462424 19:35952003-35952025 CCCTCCCCATGGTAGCTAGATGG - Intergenic
1165725917 19:38112805-38112827 CCCTCCACAGGGTAGAGGCAGGG - Intronic
1165730608 19:38142501-38142523 CCCTGCCCTGGGAGGATGGACGG - Intronic
1165957120 19:39507894-39507916 ACCTCCCGAGCGTAGATGGAAGG - Exonic
1166054876 19:40282465-40282487 CCCTCCTCAGAGTGGAGGCAAGG - Intronic
1166996059 19:46720203-46720225 CCATCCCCAGGCTGGATGCTTGG + Exonic
1167574835 19:50313001-50313023 CCCACCCGAGGGTGGATGGGGGG - Intronic
1167917892 19:52756958-52756980 GGCTCCCCAGGGAGGCTGGAAGG + Intergenic
1167925004 19:52814144-52814166 GGCTCCCCAGGGAGGCTGGAAGG + Intronic
1168516900 19:57016592-57016614 CCCTCCCCCGGGGTGATGGGGGG - Intergenic
925146339 2:1585655-1585677 TGCTCCCCAGGGTGGAGGGCTGG - Intergenic
925883796 2:8376791-8376813 CCCTCCTCAGAATGGAGGGAGGG + Intergenic
926059247 2:9794902-9794924 CCTTCTCGAGGGTGGAGGGAGGG - Intergenic
926251734 2:11158868-11158890 ACCTCCCCAGGCTGCAGGGATGG + Intronic
927871546 2:26627454-26627476 CCCTCCCCTGGGTGGGTGCAGGG - Intronic
932667760 2:73710716-73710738 CCTTCCCCAGGGTGGAGAGTGGG + Intergenic
939879417 2:147613180-147613202 ACCAACCCAGGGCGGATGGACGG + Intergenic
940236371 2:151515185-151515207 CCCTTCACAGAGTGGAAGGATGG + Intronic
944385127 2:199155228-199155250 CCCTGCCCAGTGAGGAAGGATGG - Intergenic
946026487 2:216674779-216674801 TCCACCCCAGGGAGGATGCAGGG + Exonic
947517790 2:230822486-230822508 CCGTCCCCACTGTGGCTGGAAGG + Intergenic
947523849 2:230866719-230866741 CCCTCCCCAGGCTGAGTGGAGGG - Intronic
948139058 2:235659653-235659675 CCATCCCCAGAGTTGATGCAGGG - Intronic
948241993 2:236445903-236445925 CCCTCCCGTGGGTGGCTAGAAGG + Intronic
948376807 2:237526052-237526074 CCCACCCCAGGCTGGAAGCAGGG - Intronic
948511140 2:238466131-238466153 CCCTTCCCAGGGATGCTGGATGG - Intergenic
1168933518 20:1644293-1644315 CCCTGCCCAGTGAGGAGGGATGG + Intronic
1169468111 20:5859259-5859281 CCCTCCCCTGGGTCAAAGGATGG - Intronic
1171021048 20:21584422-21584444 GGCTCCCCAGGGAAGATGGAAGG - Intergenic
1171262221 20:23744847-23744869 TCATCTGCAGGGTGGATGGATGG + Intergenic
1171271332 20:23820571-23820593 TCATCTGCAGGGTGGATGGATGG + Intergenic
1171282854 20:23915879-23915901 TCATCTGCAGGGTGGATGGATGG + Intergenic
1171816780 20:29792732-29792754 CCCTGTCCAGTGAGGATGGATGG - Intergenic
1171943454 20:31353513-31353535 CCCTTCCCAGGGTAGGTGAAGGG - Intergenic
1171975805 20:31593938-31593960 CCCTGCCCAGGGTGGAGGCGTGG - Intergenic
1172032877 20:31994098-31994120 CTCACCCCAGGGTGCAAGGAAGG - Intronic
1174430049 20:50460967-50460989 CCCAGCCCAGGGTGGTGGGAGGG + Intergenic
1174992142 20:55522755-55522777 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
1175831274 20:61966448-61966470 CCCCTCCCAGGGTAGATTGAGGG - Intronic
1175914028 20:62417378-62417400 GCCCCCCCAGGCTGGATGGTGGG - Intronic
1177211487 21:18077089-18077111 CCCACCTCAGTGTGCATGGAGGG + Intronic
1178514632 21:33236322-33236344 CCTGCCCCAGGCTGGATCGAGGG - Intronic
1179820491 21:43934295-43934317 ACCTCCCAAGGGCGGAAGGAGGG + Intronic
1179912163 21:44456130-44456152 CCCTCCTCAGGGTGGACGCCAGG - Intronic
1180001703 21:44998131-44998153 CCCGTCCCAGGGAGGCTGGAAGG - Intergenic
1180949577 22:19715013-19715035 CCCTCCCCAGGATGGGGGGATGG + Intronic
1182619893 22:31613267-31613289 CCCTGCCTTGGGTGGAGGGAGGG + Intronic
1182686165 22:32122795-32122817 CACTGCCCATGGTGGGTGGAGGG + Intergenic
1183359762 22:37377330-37377352 CCCTGCCCAGGGCAGAGGGAGGG - Intronic
1183382736 22:37498535-37498557 CCCTCCCCAGGCTGGCAGCAGGG - Intronic
950127219 3:10517305-10517327 CCCTCCCCAGGCTGGGGGAAGGG - Intronic
950523590 3:13510327-13510349 CCTTCCCTAGGGTGGCTTGAGGG + Intergenic
950631217 3:14283437-14283459 CCATCCCCAGGGTGCAGAGATGG - Intergenic
952486603 3:33818139-33818161 TGTTGCCCAGGGTGGATGGAGGG + Intronic
952503775 3:33989184-33989206 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
952526008 3:34211314-34211336 CCCTCCACAAGGAGGAAGGAGGG - Intergenic
953270404 3:41437247-41437269 CCCTTGGCAGGGAGGATGGAAGG + Intronic
953507159 3:43497545-43497567 CCCTCAGCAGGGTGGATCTAAGG + Intronic
956701764 3:71965163-71965185 CCCTCCCCATGGAGGATGGAAGG - Intergenic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
956754091 3:72368381-72368403 CCCTCCCCAGGGGGAAGAGAGGG - Intergenic
957434970 3:80163088-80163110 CCCTTCCCTGGAGGGATGGAGGG + Intergenic
959304994 3:104651356-104651378 CTCTTCCCAGGGTGGCAGGAGGG - Intergenic
959418356 3:106104276-106104298 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
959442323 3:106392490-106392512 CCCTCCCCATGGTGGGGGGGTGG - Intergenic
960140412 3:114146846-114146868 ACATCTCCTGGGTGGATGGATGG - Intronic
961669384 3:128517912-128517934 CCCTCCTAAGGGTGGATGTGTGG - Intergenic
964163162 3:153670444-153670466 CAGTCCCTAGGGTTGATGGACGG - Intergenic
964295153 3:155225395-155225417 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
965439175 3:168691788-168691810 CTCTCCCCACAATGGATGGACGG + Intergenic
968815495 4:2819599-2819621 CCCTACCCAGGATGGAGTGAGGG + Intronic
968834687 4:2954931-2954953 CCCTGCCCAGGGAGGTGGGAGGG - Intronic
968869202 4:3232957-3232979 CCCTCCTCAGTGAGGATGGTGGG + Intronic
968878487 4:3286616-3286638 CCCTCCCGCAGGTGGATGCAGGG + Intergenic
970543986 4:17108020-17108042 CCCACCTCAGGGTGGAAGGTAGG - Intergenic
974525713 4:63047696-63047718 CCCTCCCCAGTGTGTTTGGAAGG - Intergenic
977667686 4:99659606-99659628 CCCTCCCCATTGTGGAGGGCAGG + Intergenic
979576111 4:122294030-122294052 CCCTGCCCAGTGAGGAGGGATGG - Intronic
981429858 4:144646043-144646065 CCCCGCCCAGGGTGGAGGGAAGG - Exonic
985199852 4:187473973-187473995 CCCACCACACTGTGGATGGAGGG - Intergenic
985534461 5:456108-456130 CCCTCCCCATTGAGTATGGAGGG - Intronic
985671084 5:1207003-1207025 CCTGCCCCAGGCTGGACGGAAGG - Intronic
985767614 5:1788098-1788120 ACCACCCCAGGGCGGGTGGAGGG - Intergenic
985891158 5:2716043-2716065 TCCTCCCAAGGGAGGAGGGAGGG - Intergenic
988077751 5:26374029-26374051 CCCACCCCAGTGTGTCTGGAAGG + Intergenic
991636350 5:68709885-68709907 CCCTCCCATGGGGGGATGCATGG - Intergenic
993537206 5:89101625-89101647 CCTTCTCAAGGGTGAATGGAAGG - Intergenic
993587320 5:89746943-89746965 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
994873076 5:105378875-105378897 CCCTAACCAGGGTGTCTGGAGGG + Intergenic
997975713 5:138440287-138440309 CCCATCCCAGGGGGAATGGAGGG + Intronic
998542754 5:142998432-142998454 CCCTCCCCAGAGTGGAGGATGGG - Intronic
999431825 5:151531404-151531426 CTGGCCCCAGGGTGGAAGGAGGG + Intronic
999579547 5:153020879-153020901 ACCTCCTGAGGGTGGATAGAAGG - Intergenic
1000442240 5:161277734-161277756 CCCTTCCCATGGTGGGTGGCAGG + Intergenic
1000534089 5:162458426-162458448 TCCTCCCCAAGCTGGATGGTGGG - Intergenic
1001031907 5:168269351-168269373 GCCTCCTCAGGGTGGAAGGCGGG - Intergenic
1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG + Intronic
1002301882 5:178262025-178262047 ATTTCCCCAGGGTGGCTGGAGGG + Intronic
1002721179 5:181262071-181262093 CCCTCCCCAGGGAGGAGTGAAGG - Intergenic
1003040473 6:2683150-2683172 CCCTCTGCAGTGTGGATGGTGGG - Exonic
1003687088 6:8315064-8315086 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
1005926755 6:30451405-30451427 CCCGCCCCAGGCTGGAGGGTGGG - Intergenic
1005928487 6:30464124-30464146 CCCGCCCCAGGCTGGAGGGTGGG - Intergenic
1006278233 6:33023007-33023029 ACCTCCCCAGTGTGCCTGGAGGG + Intergenic
1006804861 6:36781586-36781608 CCCGTCCCATGCTGGATGGAAGG + Intronic
1007832295 6:44647670-44647692 CCCTCCCCAGGGGGGCCAGAAGG + Intergenic
1008159672 6:48061853-48061875 TCCTCCCCAGGGTGGAATCATGG - Intronic
1008647210 6:53527128-53527150 TCCTTCCCAGGGTGTAAGGAGGG - Intronic
1008834392 6:55808205-55808227 CCCTGCCCAGTGAGGAGGGATGG + Intronic
1009316701 6:62229231-62229253 CCCTGCCCAGTGAGGAGGGATGG + Intronic
1014158342 6:118137766-118137788 CCCTCCCCAAAGTGGAATGAGGG + Intronic
1016206358 6:141472658-141472680 CACTCCTCAGGGTTGCTGGAAGG - Intergenic
1016704392 6:147089888-147089910 TCCTCACCATGCTGGATGGAGGG - Intergenic
1017073847 6:150600160-150600182 CCCTCCGCAGTGGGGACGGAGGG + Intronic
1017689808 6:156952651-156952673 CACTCCCAAAGGTGGATGAATGG - Intronic
1018625094 6:165770620-165770642 CGCTCCCCAGGCAGAATGGAGGG - Intronic
1018752663 6:166821311-166821333 CCCTCCCCAGAGGGAATTGAAGG - Intronic
1020007825 7:4791791-4791813 CTCTCCCCAGGGTGCAGGGCAGG - Intronic
1020868017 7:13590860-13590882 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
1021249728 7:18309516-18309538 CTCTCCTCAGGGAGAATGGAAGG - Intronic
1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG + Intronic
1023513106 7:40974092-40974114 CCCACACCAGGGATGATGGAAGG + Intergenic
1024663530 7:51522117-51522139 CCCACCCCAGGGAGGTTGGCAGG - Intergenic
1025248526 7:57336127-57336149 ACCTCCCCAAGGTGGATGCCAGG + Intergenic
1025762119 7:64404878-64404900 CCCTCCCGAGGGTGCTTGGTAGG + Intergenic
1026191073 7:68128254-68128276 CCCTCCCAAGGATGGAGAGAAGG + Intergenic
1026830136 7:73605654-73605676 CCCTCCCCAGGTCGGGTGGACGG - Intronic
1026952044 7:74354044-74354066 CTCTCCCCAGGGTGGGCGCAGGG + Intronic
1029409185 7:100397924-100397946 GCCTCCCCAGGGTGGGTTGGGGG + Intronic
1033081879 7:138306341-138306363 CCCTCCCCAGAGTAGGGGGATGG + Intergenic
1034374294 7:150629073-150629095 GCTTCCCCAAGGTGGCTGGAAGG + Intronic
1034468623 7:151244200-151244222 CCAAGCCCAGGGTGGCTGGAAGG - Intronic
1034707472 7:153158472-153158494 CCATCCCCAGGAAGGAAGGATGG + Intergenic
1035618794 8:1022471-1022493 CCAATCCCAGGGAGGATGGATGG - Intergenic
1035657206 8:1319183-1319205 CCCTGACCAGGGAGGAGGGAGGG - Intergenic
1037421651 8:18709266-18709288 CCCTGCCCAGTGAGGAGGGATGG - Intronic
1037567695 8:20131268-20131290 CCTTCCCCAGGGTTGCTGCAAGG - Intergenic
1039265164 8:35816112-35816134 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1040106945 8:43546759-43546781 CCCACCCCAGGGTGCGTGGGGGG - Intergenic
1040107662 8:43549616-43549638 CCCACCCCAGTGTGGGTGGGGGG - Intergenic
1040107844 8:43550277-43550299 CCCACCCCAGGGTGCGTGGAAGG - Intergenic
1040109840 8:43562438-43562460 CCTACCCCAGGGTGGGTGGGGGG - Intergenic
1040110282 8:43564174-43564196 CCCACCCCAGGGTGCGTGGGGGG - Intergenic
1040110813 8:43566535-43566557 CCCACCCCAGGGTGAGTGGGGGG - Intergenic
1041722690 8:60990460-60990482 TCTTCCCCAGGGTGGATGGGTGG + Intergenic
1042759676 8:72257247-72257269 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1043927854 8:86058165-86058187 TCCTCCCCAGTGTGCAAGGAAGG - Intronic
1044508574 8:93049261-93049283 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
1045010924 8:97957743-97957765 CCTTCCCCAGGGAGGATTGTGGG + Intronic
1047151915 8:122273791-122273813 CCCTGCCCAGTGAGGAGGGATGG - Intergenic
1047489467 8:125362720-125362742 CCCTCCCAAGGGGAGCTGGATGG - Intronic
1048179548 8:132182491-132182513 ATCTCCCCAGGGAGGGTGGAGGG + Intronic
1049290729 8:141800306-141800328 CACTCCCCAAGGAGGAAGGAAGG + Intergenic
1049359481 8:142205529-142205551 CAAGCCCCAGGGTGGATGCAGGG + Intergenic
1049415315 8:142492338-142492360 CTCTCCCCAGTGAGGAGGGATGG + Intronic
1050703273 9:8365505-8365527 CCCTCCCCAGGCTCGATGAGAGG - Intronic
1051917980 9:22230363-22230385 CCCTGCCCAGTGGGGAGGGATGG - Intergenic
1052039328 9:23720202-23720224 CCCTAGCCTGGGTGGATAGAGGG - Intronic
1052369248 9:27645585-27645607 CCCTGCCCAGTGGGGAAGGATGG - Intergenic
1052387141 9:27835593-27835615 CCCTGCCCAGTGAGGAAGGATGG + Intergenic
1052903673 9:33816775-33816797 CCCTCCCCACTGTGGATCCAGGG - Intergenic
1055343331 9:75308695-75308717 CCCTGCCCAGTGGGGAGGGATGG + Intergenic
1055985826 9:82056100-82056122 CACTGCCCAGGGTGGGTGGCTGG - Intergenic
1056585514 9:87925018-87925040 CACTGCCCAGGGTGGGTGGCTGG + Intergenic
1056611367 9:88127925-88127947 CACTGCCCAGGGTGGGTGGCTGG - Intergenic
1057280824 9:93710334-93710356 GCATCCCCAGGTTGGAGGGATGG - Intergenic
1057389963 9:94634652-94634674 CTCTCCCAAGAGTGGATGGAGGG + Intronic
1057490094 9:95513823-95513845 CCCTCCCCAGGCTGGAGGAAAGG + Intronic
1057490245 9:95515348-95515370 TCCTCCCCAGGGAGGAAGAAAGG + Intronic
1057794338 9:98144861-98144883 CCCTGCCCAGGGTGCAAGGCTGG + Intronic
1059596307 9:115724251-115724273 CCCTGCCCAGTGAGGATGGACGG - Intergenic
1059718789 9:116938470-116938492 ACCTCCCCAGGGCGGATCAACGG + Intronic
1060532308 9:124355063-124355085 CCCTTCCCAGGGTGGATGCTAGG - Intronic
1060936971 9:127521647-127521669 CAGTCCGCAGGGTGGAAGGAAGG + Intronic
1060974290 9:127755327-127755349 CCCTCCCCTGGCCGGCTGGAGGG - Intronic
1060985260 9:127815883-127815905 GGCTCCCCCGGGTGGATGGAGGG + Intronic
1061375628 9:130222829-130222851 TCCTGCCCAGGGTGGAAGCAGGG + Intronic
1061892489 9:133630104-133630126 CCCACCCCAGGGTGGGAGGGGGG - Intergenic
1061964114 9:134003606-134003628 CCTTGCACAGGGTGGATGGATGG - Intergenic
1062064874 9:134521381-134521403 CCCTACCCAAGGAGGATGGGGGG + Intergenic
1062385892 9:136311393-136311415 CCCTACCCAGGGGAGCTGGATGG + Intergenic
1062463214 9:136670445-136670467 CCCTCTCCAGGGAGGGAGGATGG + Intronic
1062519016 9:136949986-136950008 CCCACCCCAGGCGGTATGGAAGG + Intronic
1062711629 9:137978120-137978142 CCCTCCCCAGGAAGGAGTGAAGG + Intronic
1186517073 X:10174137-10174159 CCCTACCAAGGGTGTATGGCGGG - Intronic
1186730717 X:12406521-12406543 ACCTACCCAGAGTGGTTGGAGGG - Intronic
1187785174 X:22876726-22876748 CCGTCCTCAGAGAGGATGGAAGG - Intergenic
1187930205 X:24286720-24286742 CCCTCCTCAGGGTGGTCAGATGG - Intergenic
1188128438 X:26399850-26399872 CCCACCCCAGTGTGTATAGAAGG + Intergenic
1188669779 X:32868670-32868692 CCCTGCCCAGTGAGGAGGGATGG - Intronic
1188803373 X:34558693-34558715 CCCTCCCTGGGGTGATTGGAAGG + Intergenic
1190383371 X:49861181-49861203 CCCACTTCAGGGTGGGTGGATGG + Intergenic
1191815600 X:65241275-65241297 CCCTGCCCAGTGAGGAGGGATGG + Intergenic
1192478550 X:71464977-71464999 CCCTCCCCAGGGGAAATGGTAGG + Exonic
1193062384 X:77220345-77220367 CCCCACCCAGTGAGGATGGATGG - Intergenic
1195652947 X:107304657-107304679 CCTTCCCCAGGAGGGAGGGAGGG + Intergenic
1197049545 X:122042409-122042431 CACTCCCCAGTGAGGAGGGATGG + Intergenic
1198312800 X:135437349-135437371 CCCTGCGCAGTGTGGATGGACGG + Intergenic
1199099752 X:143785186-143785208 CACCCACCAGGGTGGGTGGAGGG + Intergenic
1199386489 X:147229326-147229348 CCCTCCCTAATGTGGATGGATGG + Intergenic