ID: 1002302911

View in Genome Browser
Species Human (GRCh38)
Location 5:178267634-178267656
Sequence TCCCACTGTGTCCTCTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002302899_1002302911 22 Left 1002302899 5:178267589-178267611 CCCAGCCATTCGAGGCCCCAGAC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302905_1002302911 5 Left 1002302905 5:178267606-178267628 CCAGACATTGTGGAGCAGAGACA 0: 3
1: 21
2: 51
3: 120
4: 371
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302898_1002302911 23 Left 1002302898 5:178267588-178267610 CCCCAGCCATTCGAGGCCCCAGA 0: 1
1: 0
2: 1
3: 19
4: 162
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302903_1002302911 7 Left 1002302903 5:178267604-178267626 CCCCAGACATTGTGGAGCAGAGA 0: 7
1: 22
2: 78
3: 114
4: 350
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302900_1002302911 21 Left 1002302900 5:178267590-178267612 CCAGCCATTCGAGGCCCCAGACA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302901_1002302911 17 Left 1002302901 5:178267594-178267616 CCATTCGAGGCCCCAGACATTGT 0: 1
1: 0
2: 2
3: 13
4: 120
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data
1002302904_1002302911 6 Left 1002302904 5:178267605-178267627 CCCAGACATTGTGGAGCAGAGAC 0: 2
1: 23
2: 57
3: 128
4: 373
Right 1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002302911 Original CRISPR TCCCACTGTGTCCTCTGGAA GGG Intronic
No off target data available for this crispr