ID: 1002304513

View in Genome Browser
Species Human (GRCh38)
Location 5:178275271-178275293
Sequence CACTGGATTAGGGTTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002304504_1002304513 12 Left 1002304504 5:178275236-178275258 CCAATGCAAGATGCGAAGCCCCA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304501_1002304513 27 Left 1002304501 5:178275221-178275243 CCTTTGTTTCCCAGACCAATGCA 0: 1
1: 0
2: 4
3: 15
4: 268
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304510_1002304513 -8 Left 1002304510 5:178275256-178275278 CCACGGGCAAGCAGACACTGGAT 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304507_1002304513 -6 Left 1002304507 5:178275254-178275276 CCCCACGGGCAAGCAGACACTGG 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304503_1002304513 17 Left 1002304503 5:178275231-178275253 CCAGACCAATGCAAGATGCGAAG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304509_1002304513 -7 Left 1002304509 5:178275255-178275277 CCCACGGGCAAGCAGACACTGGA 0: 1
1: 0
2: 1
3: 5
4: 154
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1002304502_1002304513 18 Left 1002304502 5:178275230-178275252 CCCAGACCAATGCAAGATGCGAA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002304513 Original CRISPR CACTGGATTAGGGTTTGCCC TGG Intronic
901827945 1:11874755-11874777 TACTGGATTAGGGTAGGTCCTGG + Intergenic
903372800 1:22847663-22847685 CACTGGAATAGGATCTCCCCTGG + Intronic
908397666 1:63740987-63741009 CACAGCATTAGGACTTGCCCAGG + Intergenic
916187265 1:162145475-162145497 CACTGGCTGAGTGTGTGCCCCGG + Intronic
921558633 1:216629572-216629594 CACTTGATTAGAGTCTGCTCTGG - Intronic
921850204 1:219926450-219926472 CACTGGACTAAGGTCAGCCCAGG - Intronic
921932887 1:220769533-220769555 CACTGGGCTAGGGTTTTCCAGGG + Intronic
922752322 1:228076107-228076129 TCCTGGATTAGGGTGGGCCCTGG - Exonic
922968241 1:229710678-229710700 CACTGGACTATGGACTGCCCAGG + Intergenic
924182256 1:241450741-241450763 GACTGGACTAGGGGATGCCCAGG - Intergenic
1063284206 10:4665097-4665119 AACTAGATTAGTGTTTGCCAGGG - Intergenic
1065673161 10:28144444-28144466 CTTTTGAGTAGGGTTTGCCCAGG - Intronic
1068661619 10:59628626-59628648 CACTGGATTACTCTGTGCCCTGG + Intergenic
1070719216 10:78744860-78744882 CACTGGATGTGGGCTTTCCCAGG + Intergenic
1073486762 10:103824109-103824131 CAGTGGATGAGGGGTTTCCCAGG - Intronic
1076609339 10:131711373-131711395 CTCTGGATTAGTGGTAGCCCTGG - Intergenic
1077130818 11:971556-971578 CACAGGACTGGGGTTTGCCCTGG + Intronic
1077293740 11:1814227-1814249 CACTGAATTAGGGCTTTCCCTGG + Intergenic
1077590626 11:3488235-3488257 CTCTGGTTTTGGGGTTGCCCTGG + Intergenic
1078128918 11:8595346-8595368 CACTGGACTGCGTTTTGCCCTGG + Intergenic
1084826335 11:71734484-71734506 CTCTGGTTTTGGGGTTGCCCTGG - Intergenic
1085818357 11:79765756-79765778 CACTGGAGTAGGGATTGGCTAGG + Intergenic
1089246103 11:117121286-117121308 AAGTAGATTAGGGTTTGCCTAGG + Intergenic
1090361305 11:126174867-126174889 CCCTGCATTAGGCTGTGCCCTGG - Intergenic
1093158733 12:15719633-15719655 CATTGGACTAGAGTTTGCCCAGG + Intronic
1095163242 12:38941282-38941304 CACAGGATCAGGACTTGCCCAGG - Intergenic
1095267220 12:40174530-40174552 TACTGGATTAGTGTGTACCCTGG - Intergenic
1095806610 12:46326702-46326724 AACTAGATTAGTGTTTGCCTAGG + Intergenic
1100464052 12:94829609-94829631 AAGTGGATTAGTGGTTGCCCAGG + Intergenic
1100646391 12:96536382-96536404 CACTGTATTAACTTTTGCCCAGG + Intronic
1100904263 12:99279484-99279506 AACTGGATTAGTGGTTGCCTAGG - Intronic
1105540788 13:21314697-21314719 TACTGGAGTAGGGTGGGCCCTGG + Intergenic
1113735465 13:112675463-112675485 GACTGCAGTAGGGTTTGCTCTGG + Intronic
1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG + Intergenic
1116937472 14:50756902-50756924 CACTGGAAGAGTGTGTGCCCAGG - Exonic
1128289899 15:66470343-66470365 AACTGAATTAGGGTTTGTCTTGG - Intronic
1132363933 15:101242292-101242314 CACTGAGTCAGGGTTTGCCCTGG - Intronic
1133355997 16:5137319-5137341 CTCTGGTTTTGGGGTTGCCCTGG + Intergenic
1135275841 16:21111873-21111895 CATTGGACTAGGGTTGGCCAGGG - Intronic
1136004973 16:27323171-27323193 TCCTGGCTTTGGGTTTGCCCAGG + Intronic
1136576112 16:31126398-31126420 CACTGTATTAGGACTTGGCCAGG + Intronic
1140419709 16:74808136-74808158 AACTGAATTGGGGTTTGCCTTGG + Intergenic
1141702719 16:85649930-85649952 CCCTGGATCAGGGCCTGCCCGGG - Intronic
1152558478 17:81066390-81066412 CACTGAATTAAGGTGTGGCCTGG + Intronic
1156021640 18:32606291-32606313 CACAGCATGAGGATTTGCCCAGG + Intergenic
1162071694 19:8156428-8156450 AAGTGGATTAGTGTTTGCCAGGG - Intronic
1162877836 19:13634080-13634102 TATTGGATTAGGGATTGCCAGGG + Intergenic
1167004142 19:46764724-46764746 CCCCGGATTAGGGTTGGTCCTGG - Intronic
1168398444 19:56068204-56068226 CACAAGATGAGAGTTTGCCCAGG + Intergenic
1168448994 19:56448423-56448445 CACAGCACTAGGATTTGCCCAGG - Intronic
930019175 2:46990812-46990834 CACTGGTTTAGGGGATGCCCTGG - Intronic
932092505 2:68818856-68818878 CACTGGATTAGTTTTTGATCAGG - Intronic
933075942 2:77926800-77926822 CTCTGGATTAGGCTTTGGCTTGG + Intergenic
934057565 2:88264668-88264690 CACTGACTAAGGGTTTGCACTGG + Intergenic
934231992 2:90192286-90192308 CACTTGAATAGGGTTTGATCTGG - Intergenic
935958030 2:108398182-108398204 AACTGAATTAGGGTTTGTCTTGG - Intergenic
936497536 2:113035371-113035393 CACTGGCTTTGGGTTTGCAGAGG - Intronic
947087756 2:226474982-226475004 CACTGGATGAGGGCCTCCCCAGG - Intergenic
948417438 2:237822127-237822149 CACTAAATTATTGTTTGCCCAGG - Intronic
948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG + Intergenic
949046523 2:241874862-241874884 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046579 2:241875020-241875042 CCCTGGATTGGGGTTTCCCCTGG - Intergenic
949046826 2:241876342-241876364 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046846 2:241876396-241876418 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046879 2:241876502-241876524 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046929 2:241876660-241876682 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
1168901706 20:1370462-1370484 AACTGGTTTAGGGTTTGACCTGG + Intronic
1169381718 20:5113153-5113175 CACTCGGTAAGGGTTAGCCCGGG - Intergenic
1173810194 20:45950698-45950720 CACAGGATTTTGGTTTTCCCAGG - Intronic
1173910759 20:46668425-46668447 CTCTGGATTAGGCTTTGGCTTGG - Intronic
1176545264 21:8194121-8194143 CACTGGTTTAGGGGTTGTCAAGG - Intergenic
1176564215 21:8377166-8377188 CACTGGTTTAGGGGTTGTCAAGG - Intergenic
1178680202 21:34668255-34668277 CCCTGGGTTAGGGTTCTCCCAGG - Intergenic
1178788673 21:35677717-35677739 CACTGGGTAAGGTTTGGCCCTGG - Intronic
1180991976 22:19942233-19942255 CCCTGGAGTAGGGCTTGACCTGG + Intronic
1185262258 22:49874141-49874163 CACTGGATGGGAGTCTGCCCAGG - Intronic
1203250134 22_KI270733v1_random:110359-110381 CACTGGTTTAGGGGTTGTCAAGG - Intergenic
951453756 3:22867881-22867903 CACTGGCTAATGGTTTTCCCAGG - Intergenic
952035809 3:29199277-29199299 TTCTGGATTAGGGTTACCCCTGG - Intergenic
952212442 3:31241759-31241781 CACTGGATGAGGGCTGCCCCAGG - Intergenic
952848140 3:37705870-37705892 CAGTGAATGAGGGTTTGCTCGGG - Intronic
957060652 3:75478755-75478777 CTCTGGTTTTGGGGTTGCCCTGG + Intergenic
958954283 3:100450659-100450681 AACTGAATTAGGGTTTGTCTTGG - Intronic
959085400 3:101847200-101847222 GACTGGATTAAGGCATGCCCAGG - Intronic
961292727 3:125860646-125860668 CTCTGGTTTTGGGGTTGCCCTGG - Intergenic
962994563 3:140612585-140612607 CACTGGAATAGAATTTTCCCTGG + Intergenic
964402192 3:156311101-156311123 CACTGGATTAGGGTAGGATCAGG + Intronic
968105156 3:195995573-195995595 CCGTGGATGAGGGTTTGGCCAGG - Intergenic
969004556 4:4008819-4008841 CTCTGGTTTTGGGGTTGCCCTGG + Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
974041695 4:56863335-56863357 CACTGGATGTGGGCTTTCCCTGG - Intergenic
975412420 4:74069565-74069587 CACTGGGTTAGGGTCTCTCCAGG - Intergenic
977116437 4:93034672-93034694 CAGGGGAATAGAGTTTGCCCAGG - Intronic
986365994 5:7032302-7032324 AACTGAATTAGGGTTTGTCTTGG - Intergenic
987200887 5:15576926-15576948 CACTGTGTTAGGGAATGCCCAGG - Intronic
988073686 5:26325602-26325624 CACTGGCTTGGGGATTTCCCAGG + Intergenic
989391390 5:40904399-40904421 CACTGGACAAGCTTTTGCCCTGG - Intergenic
990776836 5:59312997-59313019 CACTGGAAGAGGGACTGCCCTGG + Intronic
995158904 5:108951398-108951420 CACTAGATTAAGATTTGGCCGGG - Intronic
995169182 5:109086992-109087014 TACTAGATTAGGGCTTACCCTGG + Intronic
996030722 5:118701708-118701730 CACTGGATTTGGACTTGCCTGGG - Intergenic
996401050 5:123062959-123062981 CTATGGTTAAGGGTTTGCCCAGG - Intergenic
997418405 5:133747341-133747363 CACTGGATTTGGGTTCGCTGGGG - Intergenic
999907109 5:156153786-156153808 CACTGGTTTTGGGTGTGGCCTGG - Intronic
1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG + Intronic
1019608547 7:1923270-1923292 CACTGGTTGGGTGTTTGCCCTGG + Intronic
1019855198 7:3598635-3598657 GAAGGGATTAGGGTTTGCCAGGG - Intronic
1019913104 7:4113489-4113511 CCCTGGATTAGTGTGTGCCCTGG - Intronic
1020324694 7:6965319-6965341 CTCTGGTTTTGGGGTTGCCCTGG + Intergenic
1021808480 7:24379601-24379623 CAGTGGATCAGGGGTTGCCTGGG + Intergenic
1022142136 7:27501575-27501597 CATCGGACTAGAGTTTGCCCAGG + Intergenic
1024325926 7:48109191-48109213 CACTGGCTTGTGGGTTGCCCAGG + Intergenic
1029232554 7:99083019-99083041 CAGTAGATTAGGGTTTGCATAGG + Intronic
1030519946 7:110586472-110586494 CATTGGATGAGGGTTGTCCCAGG - Intergenic
1033716359 7:144006953-144006975 CACTAGATTAGGGTTTGCATGGG + Intergenic
1037277814 8:17200306-17200328 CACTGGTTGAGGGTTGCCCCTGG - Intronic
1039386792 8:37143192-37143214 CACTGGATCTGAGATTGCCCTGG + Intergenic
1044834380 8:96281478-96281500 CCCTGGATTAGGGTGGTCCCTGG + Intronic
1045836809 8:106531988-106532010 CACTGAATTGAGGTTTACCCAGG - Intronic
1046871517 8:119209219-119209241 CACTGGATTAGAAACTGCCCAGG - Intronic
1050145126 9:2559617-2559639 CACAGCATTAGGATTTGCCTAGG - Intergenic
1052270690 9:26625412-26625434 CACTGGAGTTGGGGTTTCCCTGG - Intergenic
1054805858 9:69395511-69395533 CACTGGATTAGTGTTCACCTGGG + Intergenic
1055404998 9:75965176-75965198 CACTGTATTAGGGTTCTCCAGGG + Intronic
1055790081 9:79914332-79914354 TTCTAGATTAGGGTTTGCCAAGG - Intergenic
1056806155 9:89730588-89730610 CCCTGGATCAGGGCTAGCCCAGG + Intergenic
1058097830 9:100883414-100883436 CACTGAATTAGGACTTGTCCAGG + Intergenic
1059007036 9:110414121-110414143 CACTGCAATACAGTTTGCCCAGG - Intronic
1060884105 9:127138510-127138532 CCCTGGAGTAGTGTGTGCCCAGG - Intronic
1203466535 Un_GL000220v1:93626-93648 CACTGGTTTAGGGGTTGTCAAGG - Intergenic
1188342733 X:29024984-29025006 AACTGGATTAGTGGTTGCCTAGG - Intronic
1193572578 X:83161967-83161989 TACTGGATTGGGGTTTGGCCTGG - Intergenic