ID: 1002304618

View in Genome Browser
Species Human (GRCh38)
Location 5:178275869-178275891
Sequence GTGTTTAAGGGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 16, 2: 37, 3: 67, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002304618_1002304631 1 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304631 5:178275893-178275915 CTGGCCCAGAACTCCTTGGGGGG 0: 1
1: 0
2: 1
3: 37
4: 210
1002304618_1002304637 14 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304637 5:178275906-178275928 CCTTGGGGGGATGGATTTGAGGG No data
1002304618_1002304628 -1 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304628 5:178275891-178275913 CCCTGGCCCAGAACTCCTTGGGG 0: 1
1: 2
2: 9
3: 64
4: 402
1002304618_1002304626 -2 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304626 5:178275890-178275912 ACCCTGGCCCAGAACTCCTTGGG 0: 1
1: 1
2: 9
3: 50
4: 240
1002304618_1002304630 0 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304630 5:178275892-178275914 CCTGGCCCAGAACTCCTTGGGGG No data
1002304618_1002304625 -3 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304625 5:178275889-178275911 CACCCTGGCCCAGAACTCCTTGG 0: 1
1: 1
2: 8
3: 194
4: 2872
1002304618_1002304635 13 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304635 5:178275905-178275927 TCCTTGGGGGGATGGATTTGAGG 0: 1
1: 24
2: 55
3: 111
4: 334
1002304618_1002304633 5 Left 1002304618 5:178275869-178275891 CCCTCCATGATCCCCTTAAACAC 0: 1
1: 16
2: 37
3: 67
4: 225
Right 1002304633 5:178275897-178275919 CCCAGAACTCCTTGGGGGGATGG 0: 1
1: 9
2: 22
3: 66
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002304618 Original CRISPR GTGTTTAAGGGGATCATGGA GGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908960405 1:69690809-69690831 CTTTTTAAGGGAATCATAGAGGG + Intronic
911118407 1:94270658-94270680 CTGTTTAAGCTGATCATGTAGGG - Intronic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
912874954 1:113348511-113348533 GTGTATTAGTGGATAATGGATGG + Intergenic
913049656 1:115106143-115106165 GTGTTTAATGGGATGCTGGAAGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914414173 1:147463061-147463083 GTCTTTTGGGGGAACATGGATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916173287 1:162017971-162017993 GTCTTTTATGGGAACATGGATGG + Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918622965 1:186625779-186625801 GGGATGAAGGGGATCAGGGATGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919369930 1:196710188-196710210 GACCTTAAGGGGATCATGGAGGG - Intronic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920816349 1:209336773-209336795 GTCTTTTATGGGAACATGGATGG + Intergenic
922381434 1:225032382-225032404 GTGTTTTACAGGAACATGGATGG - Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
922745733 1:228042540-228042562 ATGATGAAGGGGATGATGGATGG + Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
924805362 1:247357443-247357465 GTGTTAAGGGGAATTATGGAAGG + Intergenic
1062849438 10:732057-732079 GTCTTTTATGGGAACATGGATGG + Intergenic
1064984629 10:21197920-21197942 TTTCTTAAGGGAATCATGGAGGG - Intergenic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1066030828 10:31421957-31421979 GTGTCTAAGGGGATCAGAGGTGG - Intronic
1066224186 10:33366230-33366252 GTTTTTAAGGGAGACATGGAGGG - Intergenic
1067201168 10:44173052-44173074 GTGATTAATGAGACCATGGAGGG + Intergenic
1067665775 10:48277279-48277301 GTTTTTCATGGGAACATGGATGG - Intergenic
1067671985 10:48332020-48332042 GTGTTAAGGGGAATTATGGAAGG - Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1069234194 10:66049632-66049654 GTCTTTTATGGGAACATGGATGG + Intronic
1071144889 10:82556942-82556964 GTGTTTTGTGGGAACATGGATGG - Intronic
1071343535 10:84669780-84669802 GTGTTTTGTGGGAACATGGATGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1074407513 10:113191902-113191924 GAGATGAAGGGAATCATGGAGGG + Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075951166 10:126478984-126479006 GTGTTTAAGGGCATCTTTGAAGG - Intronic
1076770063 10:132657900-132657922 GTGATTTAGGGGAGCATGAAGGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080689365 11:34543442-34543464 GTGGTTAAGAGCATCATCGAAGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082216616 11:49578144-49578166 GTGTTTACGGGGATCATGGTGGG + Intergenic
1083014577 11:59440001-59440023 ATGTATAAAGGGATCATGGTGGG - Intergenic
1084727209 11:70949618-70949640 GTGTTTGCAGGGATCATGGGGGG + Intronic
1084769065 11:71331026-71331048 GTGCTTCTGGGGATCAGGGAGGG - Intergenic
1086460338 11:86999498-86999520 GTGTTTAAGGGCAACATGAATGG + Intergenic
1086551815 11:88061272-88061294 GTGTTCAAGGGGATCACAAATGG + Intergenic
1086632938 11:89045947-89045969 GTGGTTATGGGGGTCATGGTGGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1088982814 11:114878925-114878947 ATGTTTAAGGGGATCATTAGAGG + Intergenic
1089687538 11:120165975-120165997 GTCTTTTATGGGAACATGGATGG - Intronic
1092235714 12:6807550-6807572 GGGGTTAAGGGGCTCAGGGATGG + Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092995317 12:13944216-13944238 GGGTTTTAGGAAATCATGGAAGG - Intronic
1093805037 12:23421883-23421905 ATCGCTAAGGGGATCATGGAAGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095947413 12:47761316-47761338 GTGTTGAAGGGGAACATAGGTGG - Intronic
1096117547 12:49064120-49064142 GTAATTAAGGGGATCTTGAAAGG + Intergenic
1098850939 12:75594926-75594948 GTCTTTTGGGGGAACATGGATGG + Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1100432870 12:94546265-94546287 GTGTTCCAGGGGAGCACGGAGGG - Intergenic
1100616641 12:96236186-96236208 GTGTTTAAGGAGAGCCAGGAGGG + Intronic
1101356014 12:103978239-103978261 GTGTTTGGGGGGAGCATGGCAGG + Intronic
1101742562 12:107512115-107512137 GGGATTTAGGGGATCATGGCTGG - Intronic
1101993742 12:109509684-109509706 GTGTTTAAGATGATCTGGGATGG + Exonic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1106680651 13:32003714-32003736 GTCTTTCATGGGAACATGGATGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111836094 13:93390078-93390100 GTGTTTAAGAGGAACTTGGAGGG + Intronic
1112126343 13:96472506-96472528 GTGTTTCATGGAATCATGGAGGG - Intronic
1112217214 13:97445247-97445269 GAGTGTAAGTGGATCATTGAGGG - Intronic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1116947938 14:50853606-50853628 GCGTTTAAGGGAATCACGGCTGG + Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1119720848 14:76889163-76889185 GTATTCAAGGGGCTCAGGGATGG + Intergenic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1124172887 15:27392517-27392539 GTGTTTAAGGTTATCATCAAAGG - Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127102961 15:55586785-55586807 GTATGTAAGGTGATCATGAAAGG - Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1127769668 15:62221028-62221050 GAGTTTAAGGGGAACAAGGTTGG - Intergenic
1129367707 15:75066878-75066900 GTGTTAAGGGGAATTATGGAAGG + Intronic
1129962256 15:79697874-79697896 GTGTTTAAGGGGCTTAAGGTGGG - Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1131779285 15:95839000-95839022 GTGTTTACTGGGCTCATAGAAGG + Intergenic
1133653932 16:7841148-7841170 GTCTTTTATGGGAACATGGATGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134201773 16:12205140-12205162 GTGTTTCAGGGGAGCTTGCAGGG + Intronic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138372774 16:56540523-56540545 GTTTTTAAGAGGATCATGACAGG - Intergenic
1138718565 16:59052386-59052408 GTGTTTATGGTGATCACGGTTGG - Intergenic
1139938661 16:70589540-70589562 GTCTTTTATGGGAACATGGATGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140595457 16:76403887-76403909 GTCTTTTATGGGAACATGGATGG + Intronic
1141293405 16:82742862-82742884 GTTTTTAATGGACTCATGGAGGG - Intronic
1142317858 16:89360208-89360230 GTCTTTTATGGGAACATGGATGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1146939006 17:36830991-36831013 GTGTTTTAGGGGGTCAAGGCAGG + Intergenic
1147373995 17:40013414-40013436 GTTTTTAACAGGACCATGGAAGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148339770 17:46866486-46866508 GTGTGTAGGGGGATCAGTGAGGG + Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149202866 17:54208090-54208112 GTCTTTTATGGGAACATGGATGG + Intergenic
1150518005 17:65835032-65835054 GTCTTTTATGGGAACATGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1154471861 18:14711299-14711321 GTGTTTACTGGCAACATGGATGG - Intergenic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157788522 18:50508443-50508465 GTCTTTTGGGGGAACATGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163045323 19:14637290-14637312 ACTTTTAAAGGGATCATGGAGGG - Intronic
1163245767 19:16093099-16093121 GTGTTTTGGGGGACCATGGTGGG - Intronic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1166331671 19:42081345-42081367 ATGCTTAAGGGGATGCTGGAGGG - Exonic
1168021627 19:53612988-53613010 GTGTTTACAGGGAAGATGGAGGG + Intergenic
926758660 2:16256976-16256998 GTGTTTAAGTTTATCATGAAGGG + Intergenic
926761083 2:16279784-16279806 CTGTTTATGGGGGTCATGAAGGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931313052 2:61100720-61100742 GGGTTTGAGGGGAGTATGGAAGG + Intronic
932524269 2:72446462-72446484 GTCTTTTATGGGAACATGGATGG + Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933115918 2:78471296-78471318 GTCTTTAGGGGTATCATAGAAGG - Intergenic
933562477 2:83905727-83905749 GGGTTTAAGGGGAGGAGGGAAGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
936273484 2:111070344-111070366 GTCTTTTACGGGAACATGGATGG + Intronic
936987829 2:118328525-118328547 GGGTGTAAGGGAATCAAGGAAGG - Intergenic
937081372 2:119142375-119142397 GCGTTTAAGGAGCTCATGCATGG - Intergenic
937446751 2:121964925-121964947 GTGTTTTATGGGAACATGGATGG + Intergenic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939236623 2:139502613-139502635 GTCTTTTATGGGAACATGGATGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941783997 2:169478747-169478769 GTTTTTAAGAGGATCACAGAGGG - Intergenic
942624912 2:177889976-177889998 GTGTTTAAATGAATAATGGATGG + Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
944338577 2:198567539-198567561 GTGTTTAAGGGCATCTAGAATGG - Intronic
944614125 2:201442609-201442631 ATGTTTAAGAGGATAATGGGGGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945160695 2:206887388-206887410 TTTTTTCAGGGGCTCATGGATGG - Intergenic
946515219 2:220404298-220404320 GTATTTCATGGGAACATGGATGG - Intergenic
946590169 2:221237742-221237764 ATGGTTAAAGAGATCATGGAGGG - Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947309612 2:228786756-228786778 ATGTTTGTGGGGATCAGGGAAGG + Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1172266427 20:33618967-33618989 GTGGTGAAGGGAATCAAGGAGGG + Intronic
1176802631 21:13446618-13446640 GTGTTTACTGGCAACATGGATGG + Intergenic
1178892338 21:36530637-36530659 TAGGTTGAGGGGATCATGGAGGG + Intronic
1180741434 22:18055787-18055809 GAGTTTGAGGCTATCATGGAAGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182356536 22:29724710-29724732 GTGTTAAAGGGACTCATGCATGG + Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949426833 3:3926809-3926831 TGGTTTAAGGGGTTCATGCAGGG - Intronic
949524897 3:4893836-4893858 GTCTTTTGGGGGAACATGGATGG + Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
951112195 3:18817284-18817306 GTCTTTCATGGGAACATGGATGG - Intergenic
951227564 3:20138547-20138569 GTGTATAAGGGGGTCAGGAAAGG + Intronic
951654611 3:24991774-24991796 GAGGTTAAGGGGAGCAGGGAGGG - Intergenic
952044914 3:29306831-29306853 GTGTATGAGGAGAACATGGAAGG - Intronic
952577256 3:34790262-34790284 GTTTTTAAAGGGCCCATGGATGG - Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953934160 3:47025247-47025269 GTGAGTAAGGGAGTCATGGATGG - Intronic
957178009 3:76838073-76838095 GTCTTTTACGGGAACATGGATGG + Intronic
958496909 3:94856545-94856567 GTCTTTTGGGGGAACATGGATGG - Intergenic
960506302 3:118499126-118499148 GTGTTAAAGGGAATCAGGAAAGG - Intergenic
961222404 3:125211644-125211666 GTATTTAAGGAGCTCAGGGAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
965052612 3:163670631-163670653 GTGATTAAGGTAATCAGGGAGGG - Intergenic
966500895 3:180637768-180637790 GTGTTTCATGGGAACGTGGATGG + Intronic
967630789 3:191741286-191741308 GTGTTAAGGGGAATTATGGAAGG - Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
971582540 4:28361163-28361185 ATGTTTGCGGGGAGCATGGAGGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974255121 4:59442532-59442554 GTGTTTAAGGGGACCATTCAGGG - Intergenic
974475286 4:62371116-62371138 GTTTTCAAGGTCATCATGGAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975626637 4:76356321-76356343 CTGATTAAGTGGATCATGGTTGG + Intronic
976802181 4:89005217-89005239 GTCTTTCATGGGAACATGGATGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977675444 4:99742162-99742184 GTGTTTAAGGGATTCAGGAAGGG - Intergenic
977729815 4:100337892-100337914 GTCTTTTGGGGGAACATGGATGG + Intergenic
978211814 4:106146285-106146307 GTCTTTTATGGGAACATGGATGG + Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980102172 4:128552676-128552698 GTGTTTAAAGGGATATTGGTGGG + Intergenic
981079053 4:140620096-140620118 GTATTTTATGGGAACATGGATGG - Intergenic
981283414 4:142987373-142987395 GTCTTTTATGGGAACATGGATGG - Intergenic
981300198 4:143178400-143178422 GTGTTAAGGGGAATTATGGAAGG - Intergenic
982782804 4:159508682-159508704 GTCTTAAAGGGAATGATGGAAGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
985328489 4:188799210-188799232 GTGATTCATGGAATCATGGAAGG + Intergenic
985436805 4:189938641-189938663 CTGATTCAGGAGATCATGGATGG - Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987013271 5:13790387-13790409 GTCTTTCATGGGAACATGGATGG + Intronic
987597119 5:20016151-20016173 GTCTTTTGGGGGAACATGGATGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990085269 5:51968851-51968873 GTTTCTAAGGGAACCATGGAGGG + Intergenic
990939949 5:61191946-61191968 ATGTTTCAGAGCATCATGGATGG + Intergenic
992266733 5:75026132-75026154 GTATTCAAAGGGAACATGGAAGG - Exonic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996655116 5:125926062-125926084 GTGTTAAGGGGAATTATGGAAGG + Intergenic
997064387 5:130544778-130544800 GTGTTAAGGGGAATTATGGAAGG - Intergenic
997774239 5:136585242-136585264 GTGTTGAGGAGGATCAGGGATGG + Intergenic
998771100 5:145546686-145546708 GTAGTTAAGGGAATCATGGCAGG - Intronic
1001341908 5:170854900-170854922 GTGTTCAAGGAGACCATGGCTGG - Intergenic
1001412895 5:171523459-171523481 GAGTTTAATGAGATGATGGATGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012339315 6:98099834-98099856 GTCTTTCATGGGAACATGGATGG - Intergenic
1014552279 6:122802720-122802742 GTGTTTAACTGGATCTTTGAGGG - Intronic
1016095123 6:140027445-140027467 GTCTTTTATGGGAACATGGATGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1018557034 6:165060662-165060684 GTGTTGAGGGGAATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553666 7:1617788-1617810 GTCTTTAAAGAGATAATGGAGGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021522358 7:21550671-21550693 GTGTTAAGGGGAATTATGGAAGG - Intronic
1021525113 7:21578185-21578207 ATTTTACAGGGGATCATGGAGGG - Intronic
1024287122 7:47767805-47767827 GTGTTGGAGGGGATGATGAATGG - Intronic
1026213838 7:68330703-68330725 GTGTTTAAGGAAATCACGGAGGG - Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026397211 7:69967508-69967530 GTGTTTTAGGAGCTCAGGGAAGG + Intronic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026597852 7:71749399-71749421 GATTTTAAGGGAATCATGAAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026739770 7:72971629-72971651 GTGTTTGGGGGGATCAAGGGAGG - Intergenic
1026790801 7:73330254-73330276 GTGTTTGGGGGGATCAAGGGAGG - Exonic
1027103962 7:75393441-75393463 GTGTTTGGGGGGATCAAGGGAGG + Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028078044 7:86538951-86538973 GTCTTTAGGGGGAACATGGATGG + Intergenic
1028450023 7:90971362-90971384 ATGATTAAGGGGATCAGGGGAGG + Intronic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034464603 7:151219227-151219249 GAGTTTAGGGGGATGAGGGATGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1037730848 8:21523027-21523049 GAGTTGAAGGAGATCAGGGAAGG - Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042255963 8:66804048-66804070 GTTTTAAAGGAGATCATGTATGG - Intronic
1043263481 8:78231515-78231537 GAGTTTAAGTGGATCAAGGCAGG - Intergenic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048840517 8:138561951-138561973 ATGTGTAATGTGATCATGGAAGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049262137 8:141645550-141645572 GTGATAAAGGGGACCCTGGAGGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050974956 9:11926310-11926332 GTTTTTGGGGGGAACATGGATGG + Intergenic
1051017783 9:12501672-12501694 GTGTTTTGGGGAATCATGGCAGG + Intergenic
1051217856 9:14817815-14817837 GTGCGTGAGAGGATCATGGAGGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054345489 9:63910655-63910677 GTGTTAAGGGGGATGTTGGAAGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055295336 9:74827538-74827560 ATCTTTGGGGGGATCATGGAAGG + Intronic
1055629052 9:78204276-78204298 GTGTTTAAAGTGTTCTTGGATGG - Intergenic
1055912396 9:81367620-81367642 GTCTTTTATGGGAACATGGATGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1059912606 9:119062567-119062589 GTCTTTCATGGGAACATGGATGG - Intergenic
1060776524 9:126378682-126378704 GTGTGTAAAGGCATCATGAAGGG - Intronic
1060803412 9:126558736-126558758 GGATTTAAAGGGATCCTGGAGGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1185809149 X:3088895-3088917 TTTTTTAGGGGAATCATGGAGGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187611358 X:20947258-20947280 GGGTTTAAGGGGGACATGAAAGG - Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193030732 X:76895928-76895950 GTCTTTTAGGGGAACATGAATGG + Intergenic
1194094029 X:89614470-89614492 GTCTTTTATGGGAACATGGATGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195472962 X:105253852-105253874 GTCTTTTATGGGAACATGGATGG - Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196279961 X:113812492-113812514 ATTTTTGAAGGGATCATGGAGGG - Intergenic
1196741433 X:119029286-119029308 GTCATTCAGGTGATCATGGAAGG + Intergenic
1198605472 X:138332503-138332525 GTTTTTAAGGGAATGATGGCAGG - Intergenic
1198693799 X:139313905-139313927 GTGATTAAGTGCATCATTGAGGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200446649 Y:3270614-3270636 GTCTTTTATGGGAACATGGATGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic