ID: 1002305922

View in Genome Browser
Species Human (GRCh38)
Location 5:178282830-178282852
Sequence CCCTTGGCAGTCTATCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002305909_1002305922 12 Left 1002305909 5:178282795-178282817 CCCAAAGGAAGCACCATGAGTGG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG 0: 1
1: 0
2: 2
3: 10
4: 138
1002305915_1002305922 -1 Left 1002305915 5:178282808-178282830 CCATGAGTGGGGGATCTCCAACC 0: 1
1: 1
2: 0
3: 7
4: 63
Right 1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG 0: 1
1: 0
2: 2
3: 10
4: 138
1002305911_1002305922 11 Left 1002305911 5:178282796-178282818 CCAAAGGAAGCACCATGAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002305922 Original CRISPR CCCTTGGCAGTCTATCTCTG GGG Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
903759400 1:25687310-25687332 GCCTTGGGAGTCTCTCTCTGTGG + Intronic
905026698 1:34855396-34855418 ACATTGGCTGTCAATCTCTGTGG - Exonic
905883826 1:41481214-41481236 CCCTGGGCAGTCCATCACTTGGG - Intronic
907542879 1:55232693-55232715 CCCTCTGCTGTCTGTCTCTGTGG + Intergenic
908692966 1:66803552-66803574 CCCTTGGCTGAATATCCCTGGGG - Intergenic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
923037416 1:230293982-230294004 CCCTTTCCAGTCTCTCTCTAGGG - Intergenic
924461731 1:244265792-244265814 CCCCTGGCATTCTAACTGTGGGG + Intergenic
1063072384 10:2679830-2679852 GCCCTGGGAGCCTATCTCTGTGG - Intergenic
1071712474 10:88063101-88063123 CCTTTGGCAGTGAATTTCTGGGG - Intergenic
1073167238 10:101466622-101466644 CCCTTGACAGTCTAACTCAGTGG - Intronic
1074453778 10:113580183-113580205 CTCTTGGCAGCCTTTCTCAGAGG + Intronic
1077338647 11:2016456-2016478 CCCTGGTCAGGGTATCTCTGGGG + Intergenic
1077461695 11:2714052-2714074 TCCTTGGCGCTCTATCTCTGTGG - Intronic
1078086530 11:8236505-8236527 ACCCTGGCAGTCTATCTCTAGGG + Intronic
1079030101 11:16980370-16980392 CACTTGCCAGGCTCTCTCTGTGG - Intronic
1081442123 11:43092386-43092408 ACCTGGGCAATCTAGCTCTGAGG + Intergenic
1084680501 11:70663687-70663709 CACTTAGCAGGCTGTCTCTGGGG - Intronic
1084708523 11:70829870-70829892 CCCTTGGCAGGATTTCTGTGGGG - Intronic
1087729410 11:101761120-101761142 CCCCTGCCATGCTATCTCTGAGG - Intronic
1087977591 11:104568907-104568929 CTCTTGACAGTCTATCTGTTGGG + Intergenic
1088599674 11:111463231-111463253 GCCTTGGGAGTCTCTTTCTGAGG - Intergenic
1202821631 11_KI270721v1_random:71638-71660 CCCTGGTCAGGGTATCTCTGGGG + Intergenic
1091455611 12:605188-605210 CACTTTGCAGACTATCTGTGGGG - Intronic
1091691192 12:2598603-2598625 CCCTTGTCATCCTATCGCTGTGG + Intronic
1095467706 12:42505223-42505245 CCCTTGGCCATGTATCTGTGTGG + Intronic
1096680994 12:53255245-53255267 CCCTTGGCAGCCTTTCACTTCGG - Intergenic
1097601408 12:61697323-61697345 TCCTTGGCAGTCTATCTGCAAGG - Intergenic
1098394197 12:70001384-70001406 CCCATGTCAGTCTCTCTCTTTGG + Intergenic
1103394926 12:120600155-120600177 CTCTTAGCAGTCCCTCTCTGAGG + Intergenic
1105213465 13:18271338-18271360 CCCGTGGCAGTGAATCTGTGGGG - Intergenic
1106576254 13:30978631-30978653 CCCTTGGTAGGCGATTTCTGGGG + Intergenic
1107760909 13:43677275-43677297 CCATTGGCAGTCCATCTCCATGG - Intronic
1109331744 13:60939661-60939683 CCCTTGGCTCTCCGTCTCTGTGG - Intergenic
1110560020 13:76901152-76901174 TCCTTGGCAGTCTTCCTATGTGG - Intergenic
1114631365 14:24161482-24161504 CCCTTGTCAGTCTCACTCTCAGG - Intronic
1116103278 14:40468068-40468090 TCCTTGGCAGCCTATCTGTGAGG - Intergenic
1116953155 14:50896770-50896792 CCCTTGGCTGACTCTCTTTGCGG + Intronic
1118450863 14:65900969-65900991 GGCTTGGCAGACTATCTCTTTGG - Intergenic
1119325482 14:73757728-73757750 CCCTGGGCAGCCTTTCTCTGGGG + Intronic
1119424803 14:74528373-74528395 CCCTGGGCATCCCATCTCTGTGG - Intronic
1121537367 14:94700071-94700093 CCCTTGGGATTCTTCCTCTGAGG - Intergenic
1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG + Intronic
1125969652 15:43901570-43901592 CCCCTTCCAGTCTCTCTCTGTGG - Intronic
1127586829 15:60386253-60386275 CCCAAGGCAGACCATCTCTGAGG - Intronic
1128931506 15:71708752-71708774 CATGTGGCAGTCTTTCTCTGAGG + Intronic
1129193668 15:73952086-73952108 ACCTGGGCAATCTAGCTCTGTGG - Exonic
1131712696 15:95073359-95073381 CCCATGGTAGCCTTTCTCTGCGG - Intergenic
1136096685 16:27962078-27962100 CTCTTGGCAGCCTATCTCCTGGG + Intronic
1137978889 16:53053531-53053553 ATCCTGGCAGTTTATCTCTGTGG - Intergenic
1139560535 16:67738850-67738872 CCCTTAGCAGGCTTTCTTTGCGG - Intronic
1140804188 16:78517966-78517988 CTCTTTTCAGTCCATCTCTGTGG - Intronic
1146074375 17:29714457-29714479 CCCTTGGCAATGTGTCTTTGAGG + Intronic
1148720157 17:49746657-49746679 CACTTGGCTGTGTATATCTGAGG - Intronic
1154391340 18:13938978-13939000 CCCTTGCCAGCCTACCTGTGTGG - Intergenic
1156118198 18:33812532-33812554 TCCATGGCATTCTATCTCTAGGG + Intergenic
1158127278 18:54115060-54115082 TCCTTGGCATTTTCTCTCTGGGG - Intergenic
1159309645 18:66690306-66690328 TCCTTGGCAGTCTATCTGCAGGG - Intergenic
1160622715 18:80181831-80181853 CCTTGGGCAGTGGATCTCTGAGG - Intronic
1160659163 19:290542-290564 GCCCTGGAATTCTATCTCTGGGG - Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1167421872 19:49408833-49408855 CCCTAGGCAGTATGTGTCTGGGG + Intronic
1167672505 19:50861578-50861600 CCCTAGGCTGTGAATCTCTGTGG - Intronic
926762981 2:16295870-16295892 ACATTGGCACTTTATCTCTGTGG - Intergenic
929313134 2:40448590-40448612 CCCTTAGCTGTCTATCACTTTGG - Intronic
931794074 2:65692828-65692850 TCCTTGTGAGTCTATGTCTGTGG - Intergenic
934300860 2:91775406-91775428 CCCGTGGCAGTGAATCTGTGGGG + Intergenic
935531412 2:104236777-104236799 ACCTTTGGAGTCTATTTCTGTGG - Intergenic
943768852 2:191693360-191693382 CTCTTGGCACTCTATCTCTGAGG - Intronic
944379564 2:199092365-199092387 CCCAGGGCAATCTATCCCTGTGG + Intergenic
945206298 2:207335683-207335705 TCCTTGGAAATCAATCTCTGTGG - Intergenic
945639221 2:212401737-212401759 TCCTTGGCAATCTATTACTGTGG + Intronic
947476071 2:230448766-230448788 CCCTGGGCAGGGTAGCTCTGGGG + Intronic
948123821 2:235550306-235550328 CCTCTGGCACTCTTTCTCTGGGG + Intronic
1169470205 20:5878483-5878505 CCCTTGCCATTCTAGTTCTGTGG + Intergenic
1172449047 20:35008912-35008934 CACTTGGCAGTTTAATTCTGTGG - Intronic
1174339800 20:49888523-49888545 CACTTCGCAGTCTATCTCCCTGG + Exonic
1174923482 20:54730642-54730664 CTGTGGGCAGTCTTTCTCTGAGG + Intergenic
1175642503 20:60642789-60642811 CCCTTGCCAGCCTCCCTCTGTGG + Intergenic
1176063033 20:63180458-63180480 CCCTAGACAGTCAGTCTCTGTGG + Intergenic
1180027273 21:45174016-45174038 CCCTTGGCTGCCAATCTTTGAGG - Intronic
1180816297 22:18791738-18791760 CCCGTGGCAGTGAATCTGTGGGG - Intergenic
1181202486 22:21226070-21226092 CCCGTGGCAGTGAATCTGTGGGG - Intronic
1181699221 22:24610544-24610566 CCCGTGGCAGTGAATCTGTGGGG + Intronic
1182490518 22:30668452-30668474 CCCTTCCCAGTCTAGCTCTTGGG + Intronic
1183292468 22:37011127-37011149 GCCTTGGCTGCCTACCTCTGCGG - Exonic
1203224427 22_KI270731v1_random:69343-69365 CCCGTGGCAGTGAATCTGTGGGG + Intergenic
1203266400 22_KI270734v1_random:17449-17471 CCCGTGGCAGTGAATCTGTGGGG - Intergenic
950104421 3:10379152-10379174 CCCTTGCCAGTCTCTGTCTCTGG + Intronic
953547803 3:43876876-43876898 GCCCTGTCAGTCTTTCTCTGTGG + Intergenic
954082058 3:48218206-48218228 CCCTTGGGAGTCCCTGTCTGAGG + Intergenic
954318157 3:49812517-49812539 CCCCTGGCATTCTCACTCTGAGG - Exonic
954644466 3:52122520-52122542 CCCTTGCCAGTCCTTCACTGAGG + Intronic
957089767 3:75718130-75718152 CCCCTGGCTGTGTAACTCTGAGG - Intronic
960230282 3:115218095-115218117 CCCTTGGCAATCTTTTTCTCAGG - Intergenic
960944998 3:122960020-122960042 CCCTGGGCAGGCTCTCTCCGTGG + Intronic
967286203 3:187872985-187873007 CCTTTTGCAACCTATCTCTGAGG - Intergenic
969464938 4:7350703-7350725 CACTTGGCAGTCCTTCTCTTGGG + Intronic
971750555 4:30641597-30641619 CCCTAGGCAGACTATTTTTGAGG + Intergenic
974019009 4:56676667-56676689 GCCCTGGCACTCTAGCTCTGGGG - Intronic
974100159 4:57407431-57407453 TCCTGGGCACTCTTTCTCTGGGG + Intergenic
974876910 4:67712914-67712936 ACCTTGTCAGCCTATCTTTGTGG + Intergenic
979796307 4:124850720-124850742 CTGTTGGCTGTCTATCTCAGTGG + Intergenic
980977275 4:139623387-139623409 CCCTTCGTATTCTCTCTCTGAGG - Intergenic
981204542 4:142023826-142023848 CCCTTGGTACTCACTCTCTGTGG + Exonic
992612991 5:78523548-78523570 CCCTTGGCAGGTTATCTCTGTGG - Intronic
993671391 5:90765044-90765066 TCCTTGGGGGTCAATCTCTGTGG + Intronic
997372172 5:133369060-133369082 GCCTTGGAAGTCCATCCCTGAGG - Intronic
997661446 5:135592133-135592155 AGCTTGGCATCCTATCTCTGAGG + Intergenic
997835106 5:137185786-137185808 CCCTGTGCAGTATTTCTCTGTGG - Intronic
1000823139 5:166010179-166010201 GCCTTGTCAGTTTATCTCTCAGG - Intergenic
1001172475 5:169433451-169433473 CCCTTGCCAATCTGTCTCTCTGG - Intergenic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1003074101 6:2968612-2968634 CCCTGCGCTGCCTATCTCTGGGG + Intronic
1004471007 6:15929086-15929108 CCCTTGGCTGCCTATAGCTGTGG + Intergenic
1005172300 6:23002032-23002054 CCTTGGGCAGTCAAACTCTGGGG - Intergenic
1005204027 6:23380307-23380329 CTCTTGGCTGTCTTTCTCTTGGG - Intergenic
1007008524 6:38391961-38391983 CCCCAGGCAGTCTATTTGTGGGG + Intronic
1012054644 6:94390688-94390710 CCCTAGTCAGTGTATCTGTGAGG + Intergenic
1013269847 6:108535346-108535368 CCCTTTGCAGTCTGTCTCACAGG - Intergenic
1013808329 6:114017387-114017409 CCCTTGGCATTTAATCACTGCGG - Intergenic
1016204219 6:141453116-141453138 CCCTTGGCTGACTATCTTTTCGG + Intergenic
1016205314 6:141460572-141460594 CCCTTGGCTGACTATCTTTTCGG + Intergenic
1021246231 7:18264884-18264906 ACATTGGCAGTATATCTCAGTGG + Intronic
1023281578 7:38576045-38576067 CACTAGGCAGTCTATCCCAGAGG - Intronic
1031859945 7:126967059-126967081 GCCTAGGCATTCTATCTCTCAGG - Intronic
1032858332 7:135855561-135855583 CTCTTAACAGTGTATCTCTGAGG + Intergenic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1034702253 7:153106715-153106737 CCCATGGCAGTCTATCATGGGGG + Intergenic
1036007837 8:4687080-4687102 CCCTGTGCAGGCTAACTCTGTGG + Intronic
1037122231 8:15302500-15302522 CCCATGGCAGTAAATCTCAGTGG - Intergenic
1039378415 8:37060949-37060971 CACCTGTCAGTCTATCTCTTGGG + Intergenic
1041501123 8:58539791-58539813 CTCTTGGCTGTGAATCTCTGAGG + Intergenic
1042229506 8:66542030-66542052 ACCTTGGGAGACTCTCTCTGGGG + Intergenic
1044472914 8:92592288-92592310 CCCTTTTCAGGCTGTCTCTGTGG + Intergenic
1045357382 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG + Intergenic
1047886163 8:129252424-129252446 CAGTTGGCTGTGTATCTCTGCGG - Intergenic
1049151409 8:141037639-141037661 CACTTGGCAGTCCATCTTTCTGG + Intergenic
1050251305 9:3747758-3747780 GCCCTGGCAATCTATCTCTGCGG - Intergenic
1052972002 9:34382226-34382248 CCCCTGGCTCTCAATCTCTGGGG - Intronic
1055581859 9:77714285-77714307 CTTTAAGCAGTCTATCTCTGTGG + Intergenic
1056523568 9:87422043-87422065 CCCTTGGCATCCTATCTCAGTGG + Intergenic
1061204907 9:129157192-129157214 CCCAAGGCAGTCTGTCTCTGCGG + Intergenic
1203487799 Un_GL000224v1:73596-73618 TCCTTGGCTGTGTAACTCTGAGG + Intergenic
1203500420 Un_KI270741v1:15491-15513 TCCTTGGCTGTGTAACTCTGAGG + Intergenic
1195829362 X:109038943-109038965 CCATTGGCACTCCATCTCTCGGG - Intergenic
1197553668 X:127927799-127927821 CCTCTGGCATTTTATCTCTGAGG + Intergenic
1198417828 X:136438430-136438452 CACTTGGTAGTGTATCTCAGTGG + Intergenic
1199429716 X:147745463-147745485 CCCTTGGCAGTTTTTATCTGAGG - Intergenic
1199627814 X:149757339-149757361 CTCTTGCCAGCCTTTCTCTGTGG - Intergenic