ID: 1002306966

View in Genome Browser
Species Human (GRCh38)
Location 5:178289284-178289306
Sequence GTGGATTAACTGGGATTTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002306962_1002306966 23 Left 1002306962 5:178289238-178289260 CCTTGAGAAGGCTGATTTTGGCT 0: 1
1: 0
2: 1
3: 20
4: 188
Right 1002306966 5:178289284-178289306 GTGGATTAACTGGGATTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002306966 Original CRISPR GTGGATTAACTGGGATTTAC CGG Intronic
No off target data available for this crispr