ID: 1002307840

View in Genome Browser
Species Human (GRCh38)
Location 5:178294201-178294223
Sequence GAGGCAGATCACCACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002307840 Original CRISPR GAGGCAGATCACCACGTGGA AGG (reversed) Intronic
900796308 1:4710808-4710830 GCGGCAGAGAGCCACGTGGAAGG - Intronic
902837254 1:19054942-19054964 GGGGCAGAGAACCACCTGGAAGG + Intergenic
903121158 1:21217853-21217875 GAGGCAGATCCCAAGGTGGCAGG + Intronic
904262583 1:29298356-29298378 AAGGCAGACCAGCAAGTGGAGGG - Intronic
905148390 1:35906290-35906312 TAGGCAGATGCCCACGTGTAAGG - Intronic
913258984 1:116981585-116981607 GAGACAGATGTCCACCTGGATGG - Intronic
915719387 1:157973185-157973207 CAGGCAGATCACAAGGTTGAGGG - Intergenic
917135443 1:171784434-171784456 GGGGCTGTCCACCACGTGGAGGG - Exonic
919794158 1:201311158-201311180 GTGGCAGATGACAACATGGAGGG - Intronic
920578284 1:207079507-207079529 GAGACAAATCACCAGGTGAATGG + Intronic
923778916 1:237004415-237004437 GAGGCAGTGGAACACGTGGAGGG + Exonic
1067071200 10:43133514-43133536 GAGGCAGCTAACCAGGAGGAGGG + Intergenic
1067820447 10:49524261-49524283 GAGGAAGATGACGAGGTGGAGGG - Exonic
1068228300 10:54135539-54135561 GAGTCAGATCACCACCTGGAAGG - Intronic
1069686809 10:70324015-70324037 GTGGCAGAGCTCCACCTGGAGGG - Exonic
1074308167 10:112298221-112298243 GAGGCAGCTCACCACTGGGCAGG - Exonic
1074328152 10:112473619-112473641 AAGGCAGATGACCAAGTGAAAGG + Intronic
1074460127 10:113629153-113629175 CAGGCAGATCTCCACTTGGGAGG + Intronic
1075085853 10:119413926-119413948 GACGCAGATCCCCTCGAGGAGGG + Intronic
1077142689 11:1031360-1031382 GAGGCAGATGAGCAGGTGGGGGG - Intronic
1077354475 11:2108850-2108872 GAGGCAGAACAGCTGGTGGAGGG + Intergenic
1078743381 11:14089757-14089779 GAGACAGATCACCTCAGGGAAGG - Intronic
1083410835 11:62491256-62491278 GAGGGAGATGCCCACATGGAGGG - Intronic
1083776554 11:64896903-64896925 GAGGCAGAGCCACACATGGAGGG + Intronic
1088838252 11:113597680-113597702 GAGCCAGATGACCAGGTTGATGG + Intergenic
1092025113 12:5233283-5233305 CAGGCAGAGCACCGAGTGGAGGG + Intergenic
1094831400 12:34301900-34301922 GAGGCAGAGGAACATGTGGAAGG + Intergenic
1096941892 12:55355761-55355783 GAGGCAGAGCACCTGGGGGAAGG + Intergenic
1097170578 12:57110569-57110591 GAGCCAGTTCAGCACGAGGAGGG + Intronic
1099395680 12:82135530-82135552 AAGGCAAATGACCACATGGAAGG + Intergenic
1100102423 12:91125254-91125276 GAGTCAGAGCACCACATTGATGG - Intergenic
1101302561 12:103496283-103496305 GAGGCAGATGAGTAGGTGGAAGG - Intergenic
1102178441 12:110893457-110893479 GAGGCAGAGATCCATGTGGAAGG - Intronic
1102762271 12:115398479-115398501 GAGCCAGATCACCCCCTGGCGGG + Intergenic
1108796186 13:54033496-54033518 CAGGCTCAACACCACGTGGAAGG + Intergenic
1110451389 13:75640939-75640961 GAGGGAAATCATCAAGTGGACGG - Intronic
1111225691 13:85267420-85267442 GAGGGAGAGCACCACATTGAGGG + Intergenic
1111274844 13:85935458-85935480 GAGGCAGAGACCCAAGTGGAAGG + Intergenic
1112338065 13:98530758-98530780 GTGGCAGTTCACCACGTTGCCGG - Intronic
1112497801 13:99918563-99918585 GAGGCAGATCCCCAAGATGAGGG - Intergenic
1114303459 14:21399121-21399143 GAGGCAAAGCACCACCTGCAGGG - Intronic
1115432538 14:33336486-33336508 GAGGAAGTTCACCACCTGGTTGG + Intronic
1115646745 14:35373426-35373448 CAGGCAGATCACGAGGTGGGTGG + Intergenic
1124147089 15:27137884-27137906 GAGGCAGATCAACAAGTAGAAGG - Intronic
1124154259 15:27211182-27211204 GAGGCAGATCCACTCCTGGAGGG - Intronic
1124624419 15:31299949-31299971 GAGGCAGACCCCCAGGTGGCTGG + Intergenic
1125579587 15:40775916-40775938 GGGACAGATCACCACGGGGAGGG - Intronic
1126738639 15:51756012-51756034 GGCGCAGATCTCCAAGTGGAAGG + Intronic
1135109218 16:19677721-19677743 GAGACAGATCACCACTTGACGGG - Intronic
1136408822 16:30064908-30064930 GAGGCAGATCAGTTCGGGGACGG + Intronic
1138391007 16:56669820-56669842 GAGGCAGTGGAACACGTGGAGGG - Exonic
1139647116 16:68339410-68339432 GAGGCTGGTCTGCACGTGGATGG - Exonic
1145999695 17:29123666-29123688 TAGGAGGATCACCACGTGGCTGG + Intronic
1147836389 17:43335142-43335164 GAAGCACAGCACCACGGGGAGGG + Intergenic
1151629549 17:75301237-75301259 GAGGCAGATGAGGATGTGGAAGG - Intergenic
1153059336 18:979701-979723 GAGACAGAGCACCTCGGGGAAGG - Intergenic
1158981269 18:62764318-62764340 GAGGCAGAACCCAAAGTGGATGG - Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1165346270 19:35250351-35250373 GAAGAGGATCACCACGTGGTAGG - Exonic
1165699124 19:37924000-37924022 GAGGCAGATCACCAGAGGGTAGG - Intronic
925689201 2:6504164-6504186 CAGGCAGCTCAACACATGGAAGG + Intergenic
927345188 2:22030124-22030146 GAGGCAGATGGCCATATGGAGGG + Intergenic
928444391 2:31320116-31320138 GAGGCAGTAAACCACATGGAAGG - Intergenic
930674636 2:54187411-54187433 GAGGGAGATGTCTACGTGGATGG + Intronic
931685033 2:64785378-64785400 GAGGGAGAGCACCACCTAGAAGG + Intergenic
932219864 2:69991137-69991159 CAGGCAGGTCACCAAGAGGAAGG - Intergenic
933778405 2:85785589-85785611 GAGCCAAACCACGACGTGGAGGG - Intronic
935132154 2:100268753-100268775 GAGGAAGAGAACCAGGTGGAAGG - Intergenic
943586577 2:189748016-189748038 GAGGCAATTCAGCAAGTGGATGG - Intronic
945198973 2:207262870-207262892 GAGGCAGATCATGAGGTGCATGG - Intergenic
946760600 2:222989461-222989483 GAGGCTCAACACCACATGGAAGG + Intergenic
949073393 2:242040186-242040208 GAGGCCGTTCCCCACTTGGACGG + Intergenic
1171004565 20:21451722-21451744 GAGGCACATCATCACATGAATGG + Intergenic
1172261888 20:33574182-33574204 TAAGCAGATCACCAGGTGAATGG + Exonic
1175808550 20:61845121-61845143 AAAGCAGAAGACCACGTGGATGG - Intronic
1177017921 21:15815146-15815168 CAGGCTCAACACCACGTGGAAGG - Intronic
1177624818 21:23646263-23646285 GAGGCACATGAACACCTGGAGGG + Intergenic
1179536521 21:42056216-42056238 GAGGCAGATGACCCGGGGGAGGG - Intergenic
1182329466 22:29540556-29540578 GAGGCAGACGGCCACATGGAAGG - Intronic
1184479514 22:44738394-44738416 GTGGCAGATCAGCAGGTGAACGG - Intronic
952264712 3:31774447-31774469 GAGGCAGATGGGCAAGTGGAGGG + Intronic
952912488 3:38203022-38203044 GAAGCACAGCACCACGGGGAGGG - Intronic
955175059 3:56605878-56605900 GAGGCAGAGCACCAGGGGGAAGG - Intronic
956398079 3:68847124-68847146 GGGACAGATCACCTCGGGGAAGG - Intronic
958572988 3:95911817-95911839 GAGGCAGATCAGCTCCTGGGTGG - Intergenic
964284360 3:155101481-155101503 GAGGCAGATCACCAAGAGTAGGG - Intronic
967002014 3:185344807-185344829 AAGGCAGATCACCTGGTGAAAGG - Intronic
971615117 4:28779166-28779188 CCGGCAGATCACCAGGTCGAGGG + Intergenic
975597813 4:76066790-76066812 GAGGCAGAGTCCCACGTGGAAGG - Intronic
980223262 4:129947572-129947594 GAGACAGATCACCTGGGGGAAGG - Intergenic
986080614 5:4388796-4388818 GAAGAAGATCACCACGGTGAGGG + Intergenic
986217964 5:5738660-5738682 AGGGCAAATCACCACGTGGCTGG + Intergenic
986520214 5:8607638-8607660 GAGGCTGATGACAAGGTGGAAGG + Intergenic
988869886 5:35377577-35377599 GAAGTAGAGCAACACGTGGAAGG - Intergenic
993407638 5:87531350-87531372 GAAGCAAATCACCTGGTGGAAGG + Intergenic
995569269 5:113462197-113462219 GAGTCACATCCCCACATGGATGG - Intronic
1002307840 5:178294201-178294223 GAGGCAGATCACCACGTGGAAGG - Intronic
1004571829 6:16853657-16853679 GAGTCAGATCCCAAAGTGGAGGG + Intergenic
1006818860 6:36874606-36874628 GAGGCCGGCCTCCACGTGGAGGG - Intronic
1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG + Intergenic
1018395876 6:163377740-163377762 GAGGCTGACCACCACGAGGGCGG - Intergenic
1018646297 6:165951785-165951807 GAGCCAGGTCACCACTTGCATGG - Intronic
1019435332 7:1019671-1019693 CAGGCCCATCACCACGAGGAGGG + Intronic
1019526677 7:1483524-1483546 GTGGGAGATCCCCACGTGGTGGG - Intronic
1019617715 7:1973748-1973770 GAGGCAGAGCAGGATGTGGAGGG - Intronic
1025300378 7:57815182-57815204 CAGGCTGAACACAACGTGGAAGG + Intergenic
1034438447 7:151074827-151074849 GACACAGATCACCACGTGAGTGG + Exonic
1036046524 8:5147668-5147690 GAGGCAGAACACCAGATGGGAGG + Intergenic
1037801561 8:22038670-22038692 GAGGCAGAGCCCCACTTGAAGGG + Intergenic
1039318394 8:36399298-36399320 GAGGTAGCTCACCAGGTGGTGGG - Intergenic
1039757812 8:40542009-40542031 GAGGCAGAGCAGCAGGTGCAAGG + Intronic
1047525701 8:125632392-125632414 GAAGCAGATCATCAACTGGAAGG + Intergenic
1057765341 9:97912040-97912062 GAGTCAGATGACCACCTGGCTGG + Intronic
1058810011 9:108630379-108630401 CAGGCTCAACACCACGTGGAAGG - Intergenic
1059282721 9:113148762-113148784 ACTGCAGATCAGCACGTGGAGGG + Intergenic
1187468042 X:19543525-19543547 CTGGCAGATGACCACCTGGATGG + Intronic
1187959806 X:24557839-24557861 TAGGAACAGCACCACGTGGAGGG - Intergenic
1188561198 X:31470756-31470778 GGGACAGAGCACCACGGGGAAGG - Intronic
1190212574 X:48459926-48459948 AAGACAGATGATCACGTGGAAGG - Intronic