ID: 1002308127

View in Genome Browser
Species Human (GRCh38)
Location 5:178296357-178296379
Sequence GCACCTAGTGAGGTTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 618}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002308127_1002308131 11 Left 1002308127 5:178296357-178296379 CCTGCTGCAACCTCACTAGGTGC 0: 1
1: 0
2: 3
3: 17
4: 618
Right 1002308131 5:178296391-178296413 GAGGAAACTGAGGCCCAGAAAGG 0: 25
1: 400
2: 2005
3: 5206
4: 9793
1002308127_1002308130 1 Left 1002308127 5:178296357-178296379 CCTGCTGCAACCTCACTAGGTGC 0: 1
1: 0
2: 3
3: 17
4: 618
Right 1002308130 5:178296381-178296403 TTTTACAGATGAGGAAACTGAGG 0: 820
1: 4098
2: 9933
3: 17082
4: 22900
1002308127_1002308134 25 Left 1002308127 5:178296357-178296379 CCTGCTGCAACCTCACTAGGTGC 0: 1
1: 0
2: 3
3: 17
4: 618
Right 1002308134 5:178296405-178296427 CCAGAAAGGCTACCATGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 224
1002308127_1002308129 -8 Left 1002308127 5:178296357-178296379 CCTGCTGCAACCTCACTAGGTGC 0: 1
1: 0
2: 3
3: 17
4: 618
Right 1002308129 5:178296372-178296394 CTAGGTGCATTTTACAGATGAGG 0: 1
1: 3
2: 23
3: 261
4: 1582
1002308127_1002308135 26 Left 1002308127 5:178296357-178296379 CCTGCTGCAACCTCACTAGGTGC 0: 1
1: 0
2: 3
3: 17
4: 618
Right 1002308135 5:178296406-178296428 CAGAAAGGCTACCATGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002308127 Original CRISPR GCACCTAGTGAGGTTGCAGC AGG (reversed) Intronic
901114291 1:6829147-6829169 GCACCTTGGGAGGCTGAAGCGGG - Intronic
901847796 1:11995384-11995406 GCACTTTGGGAGGTTGAAGCAGG + Intronic
901904837 1:12399439-12399461 GCACTTTGGGAGGTTGCGGCAGG - Intronic
902029908 1:13414709-13414731 GCACTTTGAGAGGCTGCAGCGGG - Intronic
903209164 1:21806588-21806610 GCTCCTTGGGAGGCTGCAGCAGG - Intergenic
903626883 1:24737056-24737078 GCTACTAGTGAGGCTGAAGCAGG - Intergenic
903949170 1:26984647-26984669 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
904142944 1:28368211-28368233 GCACTTTGTGAGGTTGAGGCTGG - Intergenic
904340564 1:29831464-29831486 GCACCAAGAGAGGGGGCAGCAGG - Intergenic
904487419 1:30836117-30836139 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
905083626 1:35349232-35349254 GCACTTAGGGAGGCTGAAGCAGG - Intronic
905557605 1:38899575-38899597 GCACCTAGGGATGTGGGAGCAGG + Intronic
906138501 1:43518264-43518286 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
906646634 1:47479796-47479818 GCACCCAGTTTGGGTGCAGCTGG - Intergenic
907057170 1:51380110-51380132 GCAACTAGCGAGGCTGAAGCAGG + Intronic
907486811 1:54783742-54783764 GCACTTTGGGAGGCTGCAGCTGG + Intronic
908245196 1:62222333-62222355 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
908531647 1:65039966-65039988 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
909440519 1:75690879-75690901 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
909504511 1:76373041-76373063 GCACTTTGGGAGGTTGAAGCAGG - Intronic
911141314 1:94505458-94505480 GCACTTTGTGAGGTTGTTGCAGG - Intronic
911169833 1:94758946-94758968 GCACTTTGGGAGGTTGGAGCTGG + Intergenic
911267052 1:95754505-95754527 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
911435089 1:97845892-97845914 GCTCCATGTGAGGCTGCAGCTGG - Intronic
912317413 1:108678824-108678846 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
912989795 1:114474145-114474167 GCACTTTGGGAGGTTGAAGCGGG - Intronic
913012031 1:114692884-114692906 GCACTTTGTGAGGCTGAAGCGGG + Intronic
913297664 1:117337406-117337428 GCACCTTGGGAGGTTGAGGCAGG - Intergenic
913960805 1:143336972-143336994 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
914055159 1:144162544-144162566 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
914123987 1:144803817-144803839 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
914847030 1:151289076-151289098 GCACCTAGGGAGGAAGCAGGAGG - Exonic
914862416 1:151397731-151397753 GCTACTCGAGAGGTTGCAGCTGG + Intergenic
914928905 1:151912067-151912089 GCACTTTGTGAGGCTGCAGCGGG + Intergenic
915000040 1:152580453-152580475 GCACCTGGTGAGTGTCCAGCAGG - Exonic
916532644 1:165672688-165672710 GCACCTTGGGAGGCTGAAGCAGG + Intronic
917228112 1:172805255-172805277 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
917402274 1:174663196-174663218 GCACTTACTGAGAATGCAGCTGG - Intronic
918214386 1:182380540-182380562 ACACTTTGTGAGGCTGCAGCAGG - Intergenic
918422051 1:184374091-184374113 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
918943231 1:191027535-191027557 TCACCTAGTTAGGTTGCATGGGG - Intergenic
919051322 1:192514926-192514948 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
919300816 1:195763360-195763382 GCTCCTTGCGAGGCTGCAGCTGG - Intergenic
919461105 1:197878600-197878622 GCACCTTGTGAGGCTGAGGCAGG - Intergenic
919655934 1:200197267-200197289 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
919660044 1:200235537-200235559 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
919669040 1:200321872-200321894 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
920026808 1:203004854-203004876 GCACCTAGGGAGGTGGAGGCGGG - Intergenic
920244563 1:204578002-204578024 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
920393028 1:205622628-205622650 GCACTTTGGGAGGCTGCAGCAGG - Intronic
920785746 1:209039504-209039526 GCTCCTGGTGAGATTGCACCCGG - Intergenic
921097458 1:211899561-211899583 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
922312340 1:224406873-224406895 GCACTTTGGGAGGTTGAAGCAGG + Intronic
922421985 1:225466309-225466331 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
922813123 1:228429195-228429217 GCTCCTGGGGAGGTCGCAGCAGG - Intergenic
923116885 1:230948734-230948756 GCACTTTGGGAGGTTGAAGCAGG - Intronic
923901595 1:238332024-238332046 GCACCTTGAGAGGCTGAAGCAGG - Intergenic
924016100 1:239724896-239724918 GCACCTTGTGAGGCTGAGGCAGG - Intronic
924055030 1:240116642-240116664 GCACTTTGGGAGGTTGAAGCAGG + Intronic
924222066 1:241887883-241887905 GCACTTTGGGAGGTTGAAGCAGG - Intronic
924467467 1:244311492-244311514 GCACCTTGTGAGGCTGAGGCAGG - Intergenic
924497956 1:244608284-244608306 GCACTTTGGGAGGTTGAAGCGGG + Intronic
924665180 1:246063884-246063906 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1063858031 10:10276696-10276718 GCACTTTGTGAGGTTGAGGCAGG - Intergenic
1064249397 10:13695385-13695407 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1064413416 10:15127654-15127676 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1064532106 10:16321163-16321185 GCAACTTGTGAGGCTGAAGCAGG + Intergenic
1064545616 10:16447345-16447367 GCACTTTGGGAGGTTGCGGCTGG - Intronic
1064621477 10:17222044-17222066 GCTACTAGGGAGGTTGGAGCAGG - Intergenic
1065139078 10:22703157-22703179 GCACCTAGGGAGGCTGAGGCAGG + Intronic
1065213564 10:23427791-23427813 GCACTTTGGGAGGTTGAAGCCGG + Intergenic
1065220945 10:23495434-23495456 GCACTTAGGGAGGCTGAAGCGGG - Intergenic
1065582139 10:27182498-27182520 GCACTTTGGGAGGCTGCAGCTGG + Intronic
1065858201 10:29847794-29847816 GCACCTGGGGAGGCTGAAGCGGG - Intergenic
1065913308 10:30329478-30329500 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1066075241 10:31868687-31868709 GCACCTTGGGAGGTTGAGGCGGG + Intronic
1066091145 10:32021858-32021880 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1066142682 10:32523297-32523319 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1066491138 10:35896415-35896437 TCACATATTGAAGTTGCAGCTGG + Intergenic
1067072552 10:43145656-43145678 GCACCTTGGGAGGTTGAAGCAGG - Intronic
1067128587 10:43541329-43541351 GCACTTTGTGAGGCTGAAGCAGG - Intergenic
1068157579 10:53222061-53222083 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1068483815 10:57630476-57630498 GCACCTTGTGAGGCTGAAGCAGG + Intergenic
1069042483 10:63709965-63709987 GCACATTGGGAGGCTGCAGCAGG + Intergenic
1069460257 10:68588227-68588249 GCACTTTGTGAGTCTGCAGCGGG - Intronic
1069609624 10:69764095-69764117 GCACTTGGGGAGGCTGCAGCAGG + Intergenic
1069745383 10:70711818-70711840 GCACCCATTGAGATGGCAGCAGG + Intronic
1070242304 10:74694726-74694748 GCACTTTGTGAGGTTGAGGCAGG - Intronic
1071407006 10:85345728-85345750 GCACTTTGGGAGGTTGAAGCCGG + Intergenic
1072347832 10:94526183-94526205 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1072460918 10:95617766-95617788 GCTCCTTGTGAGGTATCAGCTGG + Intronic
1072693979 10:97589685-97589707 GCACCTAGGGAGGGTGCAGCAGG + Intronic
1073333821 10:102689583-102689605 GCACCTTGTGAGGCTGAGGCGGG + Intronic
1073428395 10:103470444-103470466 GCACTTTGTGAGGCTGAAGCGGG - Intergenic
1073828860 10:107358899-107358921 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1073845183 10:107545817-107545839 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
1074311267 10:112325159-112325181 GCACCTGGGGAGGTTGAGGCAGG + Intergenic
1074598017 10:114885146-114885168 GCACTTTGGGAGGTCGCAGCAGG + Intronic
1074839421 10:117334249-117334271 GCACTTTGGGAGGTTGAAGCTGG + Intronic
1075610359 10:123849657-123849679 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1076657023 10:132031538-132031560 GCTACTAGGGAGGGTGCAGCAGG - Intergenic
1077554882 11:3221133-3221155 GCACCAGGTGAGGTGGGAGCGGG - Intergenic
1077590847 11:3489856-3489878 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1078190091 11:9086739-9086761 GCTACTAGGGAGGTTGAAGCAGG + Intronic
1078272582 11:9810028-9810050 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1081010894 11:37811647-37811669 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
1081095885 11:38934726-38934748 GCACTTAGGGAGGCTGAAGCAGG + Intergenic
1081988904 11:47327162-47327184 GCTGCTAGAGAGATTGCAGCAGG - Intronic
1082049759 11:47761478-47761500 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1083240425 11:61383969-61383991 GCACTTAGGGAGGCTGAAGCAGG + Intergenic
1083665281 11:64270681-64270703 GCACTTTGGGAGGTTGAAGCGGG + Intronic
1083787887 11:64963589-64963611 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1083975032 11:66111759-66111781 GCACCTAGGGAGGCTGAGGCAGG - Intronic
1084134243 11:67163742-67163764 GCTACTCGGGAGGTTGCAGCAGG + Intronic
1084246570 11:67861643-67861665 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1084619047 11:70256110-70256132 GCACTTAGGGAGGTTGAAGTAGG + Intergenic
1084826110 11:71732857-71732879 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1085373631 11:76037454-76037476 GCACTTTGGGAGGTTGCAGCGGG + Intronic
1087145874 11:94811244-94811266 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1087165710 11:95000204-95000226 GCACCTCATGTGGTTGGAGCAGG + Intergenic
1087534302 11:99424557-99424579 GCTCCATGTGAGGCTGCAGCTGG + Intronic
1088046372 11:105457354-105457376 TGACCTAGTGAGGTACCAGCTGG + Intergenic
1088287858 11:108206477-108206499 GCTCCCTGTGAGGTTGCATCTGG + Intronic
1089871967 11:121682970-121682992 GCACCTAGTGAGGTGGGATGTGG + Intergenic
1090034415 11:123236209-123236231 GCACTTCGGGAGGTTGAAGCAGG + Intergenic
1090194517 11:124803047-124803069 GCTCCCTGTGAGGTTGCGGCTGG + Intergenic
1090194616 11:124803947-124803969 GCTACTTGGGAGGTTGCAGCAGG - Intergenic
1090345874 11:126069943-126069965 GCACCTACTGAGGGCTCAGCTGG + Intergenic
1091020613 11:132096314-132096336 GCACCCAGAGAGGTTGCACTAGG - Intronic
1091450382 12:569097-569119 GCAGCCAGTGAGGTTGGAGGAGG + Intronic
1091454486 12:596674-596696 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1092018592 12:5181084-5181106 GCACCTTGGGAGGTTGCGGTGGG + Intergenic
1092417131 12:8298766-8298788 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1092858627 12:12699094-12699116 GCACTTTGGGAGGTTGCAGTGGG + Intergenic
1093021837 12:14211164-14211186 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1093058826 12:14581690-14581712 GCAACTAGGGAGGTTGAGGCAGG + Intergenic
1095054423 12:37582545-37582567 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
1095292731 12:40493961-40493983 GCTCCTGGGGAAGTTGCAGCAGG - Intronic
1095453402 12:42355637-42355659 GCAACTAGGGAGGTTGAGGCAGG + Intronic
1095593579 12:43933805-43933827 GCACTTTGTGAGGCTGAAGCCGG - Intronic
1096274422 12:50193910-50193932 GCACTTCGTGAGGTTGAGGCAGG - Intronic
1098580895 12:72097695-72097717 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1099203527 12:79702573-79702595 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1100299024 12:93290319-93290341 GCACCAAGTGAGGATGGGGCAGG + Intergenic
1100906515 12:99306236-99306258 GCACCTTGTGAGGTTGCTGAGGG - Intronic
1101116960 12:101541399-101541421 GCACTTAAGGAGGTTGAAGCAGG - Intergenic
1101340584 12:103839486-103839508 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1101342804 12:103858201-103858223 GCACCAAGTGAGGTGGGAGAAGG + Intergenic
1102103183 12:110297321-110297343 GCCACTTGTGAGGCTGCAGCAGG + Intronic
1102152016 12:110695160-110695182 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1102193395 12:111006418-111006440 GCACTTTGGGAGGTTGAAGCGGG + Intergenic
1102299274 12:111759249-111759271 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1102970793 12:117164520-117164542 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1103068519 12:117920344-117920366 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1103241147 12:119414263-119414285 GCACTTTGGGAGGTTGCGGCAGG - Intronic
1103360270 12:120349478-120349500 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1103503565 12:121424483-121424505 GGACCTTGTGAGGTTGAGGCTGG + Intronic
1103598938 12:122041819-122041841 GCACTTTGGGAGGTTGAAGCGGG + Intronic
1104769761 12:131354045-131354067 GCACCCAGGGAGGGAGCAGCTGG + Intergenic
1105734412 13:23253133-23253155 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1106915142 13:34505892-34505914 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1107064345 13:36196370-36196392 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1107147166 13:37071053-37071075 GCTCTCAGTGAGGCTGCAGCTGG - Intergenic
1107423734 13:40273191-40273213 GCTCCTTGGGAGGTTGAAGCGGG + Intergenic
1107971233 13:45644922-45644944 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1108581772 13:51834018-51834040 GCACCTAGGGAGGCGGCACCAGG + Intergenic
1109299952 13:60580609-60580631 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1109521175 13:63512173-63512195 GCTCCTTGTGAGGCTACAGCTGG - Intergenic
1109687893 13:65844540-65844562 GCACCATGCGAGGCTGCAGCTGG - Intergenic
1109692687 13:65913764-65913786 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1109988213 13:70017414-70017436 GCTCTTTTTGAGGTTGCAGCTGG - Intronic
1111487697 13:88926258-88926280 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
1112531648 13:100209876-100209898 GCACCTTGGGAGGATGAAGCAGG - Intronic
1112617122 13:101017295-101017317 GCACCCAGGGAGGTTGCAGCAGG + Intergenic
1112637105 13:101227267-101227289 GTAGCTAGTGAGGTTGCAGATGG - Intronic
1113260205 13:108553235-108553257 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1113481092 13:110621781-110621803 GCACTTTGAGAGGCTGCAGCTGG + Intronic
1114248891 14:20940548-20940570 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1114755617 14:25256416-25256438 GCTACTTGTGAGGTTGAAGCGGG - Intergenic
1116045652 14:39740001-39740023 GGACCTAGTGAGATGCCAGCTGG + Intergenic
1116514588 14:45789507-45789529 GCACCTTGGGAGGCTGAAGCCGG - Intergenic
1116637443 14:47415814-47415836 CCACCATGTGAGGATGCAGCAGG - Intronic
1117616383 14:57537623-57537645 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1118252802 14:64178822-64178844 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1118625265 14:67653033-67653055 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1118761613 14:68883664-68883686 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1118864338 14:69691093-69691115 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1118867941 14:69718058-69718080 TCACCCAGTGAGGTGGAAGCAGG - Intergenic
1118959047 14:70511808-70511830 GCACCTTGTGAGGCTGAGGCAGG + Intergenic
1119303342 14:73588244-73588266 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1119462586 14:74820492-74820514 GCACTTTGTGAGGTTGGGGCAGG - Intronic
1119733785 14:76967846-76967868 GCACTTAGGGAGGTTGATGCGGG - Intergenic
1119733926 14:76968926-76968948 GCACTTAGGGAGGTTGATGCGGG - Intergenic
1120564292 14:86035981-86036003 GCTTCTAGTGAGGGTGCAGTAGG + Intergenic
1121368760 14:93337914-93337936 GCTCCATGTGAGGCTGCAGCTGG - Intronic
1122476132 14:102010667-102010689 GCACCTCCTGGGGATGCAGCGGG + Intronic
1122831798 14:104401652-104401674 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1122843757 14:104479429-104479451 GCACCGAGGGAGGTGGGAGCTGG - Intronic
1202840295 14_GL000009v2_random:114972-114994 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1202909678 14_GL000194v1_random:105169-105191 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1124434421 15:29635272-29635294 GCACCTAGGAAGGTTGGGGCTGG - Intergenic
1125282888 15:38061675-38061697 GCACTTTGGGAGGTCGCAGCAGG + Intergenic
1125811392 15:42544574-42544596 GCACCTTGGGAGGCTGCGGCGGG + Intronic
1125930051 15:43593920-43593942 GCACCTAGCGCGGTGGCAGGCGG + Intronic
1125943219 15:43693752-43693774 GCACCTAGCGCGGTGGCAGGCGG + Exonic
1125961061 15:43830314-43830336 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1126077352 15:44924020-44924042 GCACTTAGGGAGGCTGAAGCTGG - Intergenic
1126081369 15:44966850-44966872 GCACTTAGGGAGGCTGAAGCCGG + Intronic
1126199596 15:45971045-45971067 GCACTTAGGGAGGTTGAGGCAGG - Intergenic
1126682083 15:51212187-51212209 GCTCCTGGTGAGGTGGCAGAGGG + Intronic
1126711090 15:51456923-51456945 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1126770546 15:52051625-52051647 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1127143555 15:56001924-56001946 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1127504359 15:59583342-59583364 GCACCCACTGAGGTTGTGGCTGG + Intergenic
1129088477 15:73122921-73122943 GCACTTTGGGAGGTTGAAGCGGG + Intronic
1129446742 15:75624410-75624432 GCACTTTGGGAGGTTGAAGCGGG + Intronic
1129529365 15:76250781-76250803 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1130528065 15:84724196-84724218 GCACCTTGGGAGGTCGAAGCGGG - Intergenic
1131418733 15:92285243-92285265 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1132826016 16:1906066-1906088 GCACCTTGGGAGGTTGAGGCGGG - Intergenic
1133192155 16:4142064-4142086 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1133205782 16:4232756-4232778 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1133269983 16:4606334-4606356 GCACTTTGGGAGGGTGCAGCGGG - Intergenic
1133414368 16:5594883-5594905 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1133892731 16:9896159-9896181 GCTACTAGTGAGGCTGAAGCAGG - Intronic
1134806785 16:17132654-17132676 GCACTTAGGGAGGCTGAAGCGGG + Intronic
1134977725 16:18584261-18584283 ACACCTTGGGAGGCTGCAGCAGG + Intergenic
1135197063 16:20403399-20403421 GCTGCTAGGGAGGTTGAAGCAGG - Intronic
1135335220 16:21596125-21596147 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1135351934 16:21736582-21736604 GCACTTTGTGAGGTTGAGGCAGG + Intronic
1135450423 16:22552705-22552727 GCACTTTGTGAGGTTGAGGCAGG + Intergenic
1136459856 16:30403207-30403229 GCACCTTGGGAGGTTGAGGCAGG - Intergenic
1136536535 16:30902921-30902943 GCACTTAGGGAGGCTGAAGCGGG - Exonic
1136597926 16:31264785-31264807 GCACCTTGGGAGGTTGAGGCAGG - Intronic
1136629625 16:31482307-31482329 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1136643765 16:31591086-31591108 GCACCTAGTCAAGTTGCCACTGG + Intergenic
1137790785 16:51172991-51173013 GCACCTAGGGAGGCTGAGGCAGG - Intergenic
1138151434 16:54661209-54661231 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1138370622 16:56523809-56523831 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1138644165 16:58411144-58411166 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1139148093 16:64346240-64346262 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
1139540785 16:67614448-67614470 GCACCTAGGGAGGCTGAGGCGGG + Intronic
1139625715 16:68187165-68187187 GCGCCCTGTGAGGCTGCAGCTGG + Intronic
1139737495 16:69004598-69004620 GCACTTAGGGAGGTTGAGGCGGG - Intronic
1139819349 16:69708292-69708314 GCTACTAGAGAGGTTGAAGCAGG - Intronic
1141656065 16:85417243-85417265 GCATCTAGTGGGGTTGAGGCTGG - Intergenic
1142164086 16:88576286-88576308 GCACTTTGGGAGGTTGCAACGGG - Intronic
1142368663 16:89665239-89665261 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1142791619 17:2271050-2271072 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1142833320 17:2565639-2565661 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1143643827 17:8216642-8216664 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1144745961 17:17614651-17614673 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1145292333 17:21558357-21558379 GCACCTTGGGAGGTTGATGCAGG + Intronic
1146781813 17:35680939-35680961 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1147061424 17:37882109-37882131 GCAACTTGGGAGGCTGCAGCAGG + Intergenic
1147561905 17:41514467-41514489 GCCCCAGGTGAGATTGCAGCTGG - Intronic
1147841994 17:43378534-43378556 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1148834616 17:50459487-50459509 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1149731496 17:58951217-58951239 GCTCCTTGGGAGGCTGCAGCAGG + Intronic
1150048960 17:61939988-61940010 GCACTTAGGGAGGTTGAGGCGGG + Intergenic
1150237887 17:63607825-63607847 GCACCAAGTGAGGAAGAAGCTGG + Exonic
1150827696 17:68491336-68491358 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1151529837 17:74697188-74697210 GCACTTAGGGAGGTTGAGGCGGG - Intronic
1152155666 17:78631184-78631206 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1152479498 17:80540841-80540863 GCTACTTGTGAGGTTGAAGCAGG - Intergenic
1154013712 18:10597411-10597433 GCACCTGGTGAGGCTGAGGCAGG + Intergenic
1154350376 18:13578216-13578238 GCACTTACTGAGTTTGTAGCAGG - Intronic
1154474817 18:14746135-14746157 GCACTTGGTGAGGTTGAGGCGGG + Intronic
1154474900 18:14746894-14746916 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1154936311 18:21061324-21061346 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1155169455 18:23256590-23256612 GCTCCTCGGGAGGTTGAAGCAGG - Intronic
1155188111 18:23405052-23405074 GTACCAAGTGAGGATGCAGATGG + Intronic
1157273041 18:46291097-46291119 CCACCTGGAGAGGTTGCACCAGG + Intergenic
1158362724 18:56693816-56693838 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1158457914 18:57623579-57623601 GCACCTTGGGAGGTTGAGGCGGG + Intergenic
1158645838 18:59246307-59246329 CCACCATGTGAGGATGCAGCAGG - Intergenic
1159752170 18:72315993-72316015 GTACCAAGTGAGGATGAAGCAGG - Intergenic
1160015374 18:75136050-75136072 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1160137259 18:76282965-76282987 GCACATAGGGAGGCTGAAGCAGG - Intergenic
1160632541 18:80256908-80256930 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1161132843 19:2601793-2601815 GCTACTAGGGAGGTTGAAGCGGG + Intronic
1161476381 19:4488215-4488237 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1161556702 19:4946820-4946842 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1161776529 19:6265732-6265754 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1161847801 19:6721842-6721864 GCACTTTGTGAGGCTGCTGCGGG - Intronic
1162072377 19:8161758-8161780 GCAACTAGGGAGGTTGAGGCAGG + Intronic
1162836393 19:13321278-13321300 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1163341647 19:16711672-16711694 GCACTTTGAGAGGCTGCAGCAGG - Intergenic
1163642851 19:18471419-18471441 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1164011958 19:21211565-21211587 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1164694411 19:30232834-30232856 GCATCTAGTGGGGTAGAAGCTGG - Intronic
1165344663 19:35237155-35237177 GCAACTAATGATGTTGCAGATGG - Intergenic
1165411193 19:35662785-35662807 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1165588504 19:36944150-36944172 GCACTTGGGGAGGTTGAAGCAGG + Intronic
1166663871 19:44665398-44665420 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1166775691 19:45311162-45311184 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1166845171 19:45722812-45722834 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1167034290 19:46984767-46984789 CCATCTAGTGAAGTTTCAGCAGG + Intronic
1167394975 19:49222590-49222612 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1167676215 19:50887744-50887766 GCACCCAGTGAGGATGCAGCAGG + Intergenic
1167840838 19:52118189-52118211 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1167844905 19:52154294-52154316 GCATTTAGGGAGGTTGGAGCAGG - Intronic
1167865054 19:52318352-52318374 GCACTTTGAGAGGCTGCAGCAGG - Intronic
1167956845 19:53072603-53072625 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1168398393 19:56067797-56067819 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1168653058 19:58105731-58105753 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1202632762 1_KI270706v1_random:15585-15607 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1202653115 1_KI270707v1_random:24464-24486 GCTCCCTGTGAGGTTGCAGCTGG - Intergenic
1202659038 1_KI270708v1_random:51281-51303 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1202694641 1_KI270712v1_random:115221-115243 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
925225044 2:2176608-2176630 GCTACTAGGGAGGTTGAAGCAGG - Intronic
925990827 2:9252667-9252689 GCACTTAGGGAGGTTGAGGCGGG + Intronic
926497097 2:13604176-13604198 GCACCTTGGGACGTTGCTGCCGG - Intergenic
926841102 2:17081191-17081213 ACACATAGTGTGGGTGCAGCTGG - Intergenic
927797484 2:26062866-26062888 GCACTTTGGGAGGTTGCGGCAGG + Intronic
927814493 2:26202492-26202514 GCACTTTGGGAGGCTGCAGCAGG + Intronic
928819453 2:35342988-35343010 GCATCTAGTGTGCCTGCAGCAGG + Intergenic
929449837 2:42029519-42029541 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
932129517 2:69175361-69175383 GCACCTTGGGAGGCTGAAGCAGG + Intronic
932170855 2:69554709-69554731 TCACCTAAAGAGGTTGCCGCTGG + Intronic
933346225 2:81088963-81088985 GCACTTTGTGAGGCTGAAGCGGG + Intergenic
933878182 2:86640886-86640908 GCACTTTGTGAGGTTGAAGCGGG - Intronic
934050287 2:88204664-88204686 GCACCTTGGGAGGCTGGAGCAGG - Intergenic
934275810 2:91572267-91572289 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
934716992 2:96550157-96550179 GCACCTCGTGAGGGCGCGGCCGG - Intronic
934924923 2:98375468-98375490 GCACCTAGGTTGGTTGCAGGAGG - Intronic
935821114 2:106893873-106893895 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
937445622 2:121955502-121955524 GCACCTGCTGAGCTGGCAGCTGG - Intergenic
937966374 2:127514678-127514700 GCTCCGTGTGAGGCTGCAGCTGG - Intronic
942147052 2:173037330-173037352 GCACCTAGGGAGGCTGAGGCAGG - Intronic
942563757 2:177246842-177246864 GCACCTTGGGAGGCTGAAGCCGG - Intronic
942660635 2:178260897-178260919 GCACCTTGGGAGGTTGAGGCAGG + Intronic
944059277 2:195555016-195555038 GCACTTTTTGAGGCTGCAGCAGG + Intergenic
944178431 2:196860283-196860305 GCACTTTGGGAGGCTGCAGCAGG + Intronic
944449131 2:199823094-199823116 GCACTTTGGGAGGCTGCAGCTGG - Intronic
944527055 2:200630125-200630147 GCACTTTGTGAGGCTGAAGCAGG + Intronic
944540977 2:200753260-200753282 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
944801046 2:203238513-203238535 GCACCTTGGGAGGCTGAAGCGGG - Intronic
945589003 2:211705196-211705218 GCACTTAGGGAGGTTGAGGCGGG - Intronic
945664228 2:212721281-212721303 GCAACTACGGAGGGTGCAGCGGG - Intergenic
946625139 2:221603600-221603622 GCACTTTGTGAGGCTGAAGCAGG - Intergenic
947374219 2:229479464-229479486 GCACTTTGGGAGGTTGAAGCAGG + Intronic
947761865 2:232609305-232609327 GCACCTTGGGAGGCTGAAGCAGG - Intronic
948334819 2:237199833-237199855 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
948438781 2:237972035-237972057 CCTACTAGTGAGCTTGCAGCAGG + Intronic
948756845 2:240165098-240165120 GCACCTAGGAAGGTCTCAGCTGG + Intergenic
948768518 2:240235549-240235571 GCTCCCAGGCAGGTTGCAGCTGG - Intergenic
1168793591 20:596290-596312 GCACTTCGGGAGGCTGCAGCAGG + Intergenic
1169739929 20:8881110-8881132 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1170953522 20:20957456-20957478 GCACTTTGGGAGGTTGCAGTGGG + Intergenic
1172735037 20:37120315-37120337 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1173707136 20:45119058-45119080 GCACTTTGTGAGGCTGAAGCGGG - Intergenic
1174016401 20:47491926-47491948 GCACCTAGGGAGGCTGAGGCGGG + Intergenic
1174329430 20:49806211-49806233 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1174589417 20:51633497-51633519 GTACTTAGGGAGGTTGAAGCGGG + Intronic
1175098645 20:56562221-56562243 GCTACTAGTGAGGCTGAAGCAGG - Intergenic
1175287055 20:57844111-57844133 GCACCAAGTGAGCTTGCAGAGGG + Intergenic
1175959813 20:62630276-62630298 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1175968421 20:62671635-62671657 GGACCTGGTGAGGGTGCTGCAGG + Intronic
1176422767 21:6529386-6529408 GCTCCTGGTGAGGTTGTAGGAGG - Intergenic
1176599037 21:8775187-8775209 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1176629025 21:9119877-9119899 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1176644975 21:9341465-9341487 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1177153319 21:17476674-17476696 GCACCTTGAGAGGTTGAGGCAGG + Intergenic
1177371544 21:20210505-20210527 GCACTTAGGGAGGTTGAGGCGGG - Intergenic
1178346953 21:31837655-31837677 GTACATGGTGAGGTTGGAGCAGG + Intergenic
1178363760 21:31971316-31971338 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1178540846 21:33448398-33448420 GCACTTTGTGAGGTTGAGGCAGG + Intronic
1178620653 21:34171555-34171577 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1178643734 21:34367212-34367234 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1178888469 21:36500541-36500563 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1178893248 21:36537892-36537914 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1179244990 21:39625360-39625382 GGACCGAGTGGGGTTGCAGCCGG - Intronic
1179503944 21:41827586-41827608 GCACTTTGAGAGGCTGCAGCTGG - Intronic
1179698260 21:43137702-43137724 GCTCCTGGTGAGGTTGTAGGAGG - Intergenic
1180025208 21:45156842-45156864 GCACCTAGTGGGATTTCAGGTGG - Intronic
1180326501 22:11434797-11434819 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1180367977 22:11957769-11957791 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1180378112 22:12113567-12113589 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1181130539 22:20729060-20729082 GAGCCTAGGGAGGTAGCAGCAGG - Intronic
1181526215 22:23489888-23489910 GCACATTGGGAGGTGGCAGCGGG - Intergenic
1182397217 22:30045339-30045361 GCACTTGGGGAGGCTGCAGCAGG + Intergenic
1182594311 22:31406561-31406583 GCTCCTAGGGAGGTTGAGGCAGG + Intronic
1182672735 22:32010859-32010881 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
1182801071 22:33032259-33032281 GCACTTAGGGAGGCTGAAGCAGG + Intronic
1183128754 22:35812012-35812034 GCACCTTGTGAGGCTGAGGCGGG + Intronic
1183170826 22:36186776-36186798 GCACTTCGCGTGGTTGCAGCGGG - Intergenic
1183554161 22:38512219-38512241 GCACTTAGGGAGGTTGAGGCAGG - Intergenic
1183955527 22:41378455-41378477 GCAACTCGGGAGGTTGAAGCAGG - Intronic
1184529374 22:45044799-45044821 GCACTTAGTGAGGCTGATGCAGG - Intergenic
1184574111 22:45348303-45348325 GCACTTTGGGAGGTTGAAGCGGG + Intronic
1184594265 22:45504330-45504352 GCACCTCGTGGGGTTGGAGATGG + Intronic
1184675851 22:46042958-46042980 GTTCCCAGTGAGGATGCAGCGGG + Intergenic
949549945 3:5104398-5104420 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
951353093 3:21630449-21630471 GCACTTTGGGAGGTTGAAGCGGG - Intronic
951511130 3:23503435-23503457 GCACCTTGGGAGGCTGAAGCAGG - Intronic
952262425 3:31753429-31753451 GCACTTTGTGAGGCTGCGGCGGG - Intronic
953028850 3:39162946-39162968 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
953937555 3:47059053-47059075 GCACTTTGGGAGGTTGAAGCAGG - Intronic
955111785 3:55957756-55957778 GCTCCGTGTGAGGCTGCAGCTGG + Intronic
955357973 3:58247248-58247270 GCACCTTGGGAGGCTGAAGCAGG - Intronic
956136847 3:66107850-66107872 GCACTTTGGGAGGTTGCGGCTGG - Intergenic
956605804 3:71071820-71071842 GCACCTTGGGAGGCTGAAGCAGG - Intronic
956908115 3:73788205-73788227 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
957554403 3:81748006-81748028 GCTACTAGGGAGGTTGAAGCAGG + Intronic
957768020 3:84650729-84650751 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
960508022 3:118516579-118516601 GCAACTAGGGAGGTTGAGGCAGG + Intergenic
961183975 3:124898681-124898703 GCACTTTGGGAGGTTGAAGCAGG + Intronic
961894682 3:130157362-130157384 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
962250941 3:133835794-133835816 CCACCTTGTGAGGATGCAGCAGG + Intronic
962494080 3:135922103-135922125 GAAACTAGTGAGGTTACAGTTGG + Intergenic
962797216 3:138859743-138859765 GCACTTTGTGAGGCTGAAGCGGG + Intergenic
963035828 3:141027903-141027925 TCAACTAGGGAGGTTGCAGGGGG - Intergenic
963905286 3:150768749-150768771 GCACTTAGCGAGGCTGAAGCGGG + Intergenic
965121812 3:164569192-164569214 GCACTTTGTGAGGCTGAAGCGGG + Intergenic
965122335 3:164577251-164577273 GCTACTCGTGAGGTTGAAGCAGG - Intergenic
965582090 3:170279275-170279297 GCACTTAGGGAGGCTGAAGCAGG - Intronic
965871800 3:173274314-173274336 GCACCAAATGAGGATGGAGCAGG - Intergenic
965924193 3:173957988-173958010 GCTCCCTGTGAGGCTGCAGCTGG + Intronic
965984548 3:174736028-174736050 GCTCCCTGTGAGGCTGCAGCTGG + Intronic
966677220 3:182602536-182602558 GCACTTTGTGAGGCTGAAGCGGG - Intergenic
966880940 3:184350681-184350703 GCACTTTGGGAGGCTGCAGCAGG - Intronic
967373541 3:188775295-188775317 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1202741916 3_GL000221v1_random:63603-63625 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
968422081 4:494291-494313 GCTACTCGGGAGGTTGCAGCAGG - Intronic
969004782 4:4010442-4010464 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
969748095 4:9089694-9089716 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
969809117 4:9634251-9634273 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
970030652 4:11670259-11670281 GTACTTTGTGAGGCTGCAGCAGG - Intergenic
970438502 4:16058910-16058932 GAGCCTAGTCATGTTGCAGCAGG + Intronic
970826770 4:20285792-20285814 GCACTTTGGGAGGTTGAAGCAGG - Intronic
971335042 4:25714816-25714838 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
972376024 4:38471291-38471313 GCACTTAGGGAGGCTGAAGCAGG + Intergenic
972544112 4:40064042-40064064 GCACCTTGGGAGGCTGAAGCAGG - Intronic
972891299 4:43559388-43559410 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
973118870 4:46492855-46492877 GGTCATAGTCAGGTTGCAGCTGG - Intergenic
973362392 4:49177559-49177581 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
973398707 4:49619302-49619324 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
973566602 4:52194950-52194972 GCACCTAGTGAGGCTGAGGCAGG - Intergenic
976206055 4:82624588-82624610 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
976653592 4:87462749-87462771 GCACTTAGGGAGGCTGAAGCGGG + Intergenic
976744176 4:88387148-88387170 GCACTTAGGGAGGCTGAAGCAGG + Intronic
976800796 4:88989353-88989375 GCACTTAGGGAGGTCGCGGCAGG + Intronic
977588316 4:98799911-98799933 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
977612919 4:99055142-99055164 GCACCTTGGGAGGCTGAAGCAGG + Intronic
978725197 4:111961194-111961216 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
978886549 4:113772469-113772491 GCACCTACAGAGGGTGCACCGGG + Intergenic
978944320 4:114476707-114476729 GCACCTTGGGAGGTTGAGGCAGG - Intergenic
979134322 4:117090195-117090217 GCTCCTAGGGAGGTTGAGGCAGG - Intergenic
979946909 4:126843681-126843703 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
980669323 4:135983647-135983669 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
981709213 4:147692335-147692357 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
981925932 4:150139109-150139131 GCACCTTGTGAGGCTGAGGCAGG - Intronic
981967903 4:150629146-150629168 GCACGTAGTGAGGCTGAGGCAGG - Intronic
982243011 4:153319480-153319502 GCACCTTGGGAGGCCGCAGCGGG + Intronic
982262300 4:153505350-153505372 GCACTTTGGGAGGTTGAAGCGGG - Intronic
982918806 4:161249181-161249203 GCTCCTTGTGAGGCTACAGCTGG + Intergenic
983427285 4:167601760-167601782 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
983451754 4:167920506-167920528 GCACTTTGGGAGGCTGCAGCGGG - Intergenic
983641788 4:169950143-169950165 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
983906145 4:173184348-173184370 GCACCTAGGGAGGCTGAGGCTGG + Intronic
984113100 4:175644346-175644368 GCAAGAAGTGAGGTTGCTGCAGG + Intronic
1202759729 4_GL000008v2_random:99032-99054 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
985663777 5:1171094-1171116 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
985853381 5:2405702-2405724 GAACCTAATGAGGTTGCTGGAGG - Intergenic
988346450 5:30042844-30042866 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
989227792 5:39050446-39050468 GCAACTTGGGAGGTTGAAGCAGG - Intronic
989568922 5:42927094-42927116 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
990438209 5:55816030-55816052 GCACTTTGGGAGGTTGAAGCAGG - Intronic
991044710 5:62210735-62210757 GCACCTTGGGAGGTTGAGGCAGG + Intergenic
991965532 5:72086669-72086691 TCACCTAGTGTGGCTACAGCTGG - Intergenic
992419701 5:76590838-76590860 GCACTTTGGGAGGCTGCAGCGGG + Intronic
992537574 5:77725195-77725217 GCAGCTAATGAGCATGCAGCTGG - Intronic
992543776 5:77790006-77790028 GCACTTAGGGAGGCTGAAGCAGG - Intronic
992827062 5:80560407-80560429 GCACTTTGGGAGGTTGAAGCAGG + Intronic
992878472 5:81081363-81081385 GCAACTAGTCAGGTGGCCGCAGG + Intronic
993971559 5:94426115-94426137 GCACCTAGGGAGGGTGAGGCGGG - Intronic
994377214 5:99028490-99028512 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
994840617 5:104920713-104920735 ACACCTAGTGGGGTGGCAGGAGG - Intergenic
995524157 5:113037444-113037466 GCACTTTGTGAGGTTGAGGCGGG + Intronic
995742523 5:115369520-115369542 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
995895094 5:117002643-117002665 GCACCTAGGGAGGCTGAGGCTGG + Intergenic
996401007 5:123062339-123062361 GCTACTAGAGAGGTTGAAGCAGG + Intergenic
996740811 5:126797033-126797055 GCACTTTGGGAGGCTGCAGCGGG - Intronic
997511323 5:134456617-134456639 GCACCTCTTAAGGTTGCTGCAGG + Intergenic
997562905 5:134864084-134864106 GCACTTAGGGAGGCTGAAGCAGG - Intergenic
997859256 5:137401473-137401495 GCACTTTGGGAGGTTGAAGCAGG + Intronic
998834309 5:146189336-146189358 GCTACTAGGGAGGTTGCGGCAGG - Intergenic
999887056 5:155935970-155935992 GCTCCCTGTGAGGCTGCAGCTGG + Intronic
1000035738 5:157446568-157446590 GCTCCTAGGGAGGCTGAAGCAGG + Intronic
1000286133 5:159827580-159827602 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1000558502 5:162756444-162756466 GCACTTTGGGAGGTTGAAGCTGG - Intergenic
1000824985 5:166033764-166033786 GCACATTGAGAGGTTGAAGCAGG - Intergenic
1002070089 5:176674009-176674031 CCACCCAGTGGGGTTGCACCTGG - Intergenic
1002290569 5:178197866-178197888 GCTGCTAGGGAGGTTGAAGCGGG + Intergenic
1002308127 5:178296357-178296379 GCACCTAGTGAGGTTGCAGCAGG - Intronic
1002511778 5:179724903-179724925 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1003002347 6:2347889-2347911 GCACTTAGGGAGGTTGAGGCAGG + Intergenic
1003150255 6:3542240-3542262 GTACCTAGAGAGCCTGCAGCAGG + Intergenic
1003209996 6:4054146-4054168 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1004427860 6:15518206-15518228 GCACCTTGTGGGGGTGCAGGCGG + Intronic
1006263810 6:32898687-32898709 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1006920809 6:37625923-37625945 GCATCTGGCCAGGTTGCAGCAGG + Intergenic
1006927036 6:37662359-37662381 GCACTTAGGGAGGCTGAAGCAGG + Intronic
1007015542 6:38463040-38463062 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1007639849 6:43329569-43329591 GCACCTAGTGAGGCTAAGGCGGG + Intronic
1007763484 6:44147875-44147897 GCACTTTGTGAGGCTGAAGCAGG + Intronic
1007796755 6:44355065-44355087 GCACTTTGTGAGGCTGCAGCAGG - Intronic
1009421314 6:63467936-63467958 GCACTTAGTGAGGCTGAGGCGGG - Intergenic
1010195817 6:73239316-73239338 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1011853739 6:91663048-91663070 GCACCTAAAGAGTGTGCAGCAGG - Intergenic
1012367552 6:98460744-98460766 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1012910565 6:105113176-105113198 GCACTTTGGGAGGTTGAAGCTGG - Intronic
1013774614 6:113665801-113665823 GCCCCTAGTGGGGTCCCAGCTGG - Intergenic
1014500047 6:122176459-122176481 GCTCCTCGGGAGGTTGAAGCAGG - Intergenic
1015128504 6:129783160-129783182 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1015526649 6:134180624-134180646 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1015993910 6:138978554-138978576 GCACTTTGTGAGGTTGAGGCGGG - Intronic
1016046562 6:139486972-139486994 GCACCTAGGATGATTGCAGCAGG + Intergenic
1016644654 6:146392319-146392341 GAACCTAGAGAGCTTGCACCTGG + Intronic
1016758615 6:147714144-147714166 GCTCCTAGTGAGGTGGGAGGGGG - Intronic
1018220272 6:161571189-161571211 GCACTTTGTGAGGCTGAAGCGGG - Intronic
1018714753 6:166523403-166523425 TCATCTGGTGAGGATGCAGCTGG + Intronic
1019467682 7:1199088-1199110 GCACTTTGTGAGGCTGAAGCAGG - Intergenic
1019581649 7:1766788-1766810 GCACCTTGGGAGGTTGAGGCCGG - Intergenic
1019675309 7:2308419-2308441 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1020018684 7:4847947-4847969 GCACTTAGGGAGGCCGCAGCAGG + Intronic
1020063012 7:5166736-5166758 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1020324911 7:6966936-6966958 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1020652264 7:10889914-10889936 GCTACTAGGGAGGCTGCAGCAGG - Intergenic
1021500670 7:21329388-21329410 GCTCCTTGAGAGGCTGCAGCTGG + Intergenic
1021932519 7:25595864-25595886 GCACTTAGGGAGGCTGAAGCAGG - Intergenic
1022028444 7:26469655-26469677 GCACTTTGGGAGGTTGAAGCAGG + Intergenic
1023947793 7:44817384-44817406 GCACTTAGTGAGGCTGAGGCAGG + Intronic
1024078093 7:45833550-45833572 GCACTTAGGGAGGTCACAGCAGG + Intergenic
1024146297 7:46520849-46520871 GCACCTCGGGAGGCTGAAGCAGG + Intergenic
1024500922 7:50104832-50104854 GAAGCTAGTGAGAATGCAGCTGG - Intronic
1024856940 7:53793844-53793866 GCACTATGTGAGGCTGCAGCAGG + Intergenic
1026423020 7:70260117-70260139 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1026443080 7:70460595-70460617 GCACTTTGGGAGGTTGAAGCGGG - Intronic
1026574358 7:71559947-71559969 GCACTTTGAGAGGCTGCAGCGGG + Intronic
1026619865 7:71940856-71940878 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1026818344 7:73529705-73529727 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1027006559 7:74698656-74698678 CCACCTTGTGAGGCTGAAGCAGG - Intronic
1027328257 7:77064957-77064979 GCACCTGGGGAGGCTGAAGCGGG - Intergenic
1027639915 7:80720156-80720178 GCACCTTGTGAGGTCGAGGCAGG - Intergenic
1029749313 7:102534056-102534078 GCACCTGGGGAGGCTGAAGCGGG + Intergenic
1029767256 7:102633160-102633182 GCACCTGGGGAGGCTGAAGCGGG + Intronic
1029829323 7:103239202-103239224 GCACTTAGGGAGGCTGAAGCGGG + Intergenic
1032226313 7:130034604-130034626 GCTACTCGTGAGGTTGAAGCAGG - Intronic
1032375786 7:131416040-131416062 GCACTTTGCGAGGTTGCAGCAGG - Intronic
1033090369 7:138379917-138379939 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1033214928 7:139486532-139486554 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1034412798 7:150950110-150950132 GCACCTCTTGAGGCTGCAGAGGG + Intronic
1034530265 7:151691938-151691960 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1034734971 7:153420316-153420338 GCAACTGGGGAGGTTGAAGCAGG + Intergenic
1034915694 7:155036936-155036958 GCACTTCGTGAGGTTGAGGCAGG - Intergenic
1036409697 8:8487995-8488017 GCACCACGTGAGGATACAGCAGG - Intergenic
1036464292 8:8982046-8982068 GCACTTAGTGAGGTCGAGGCAGG + Intergenic
1038026774 8:23597881-23597903 GCACTTAGGGAGGTTGAGGCGGG - Intergenic
1038461072 8:27717536-27717558 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1039167534 8:34701395-34701417 GCACGTTGGGAGGTTGAAGCAGG + Intergenic
1039263469 8:35798697-35798719 ACACATAGTGAGGTTACAGCAGG + Intergenic
1040996207 8:53405539-53405561 GCTACTAGGGAGGCTGCAGCAGG + Intergenic
1041693479 8:60713221-60713243 GCTACTAGTGAGGCTGAAGCAGG - Intronic
1044139526 8:88633331-88633353 GCACTTTGGGAGGTTGAAGCGGG - Intergenic
1044656570 8:94554467-94554489 GCACTTAGGGAGGATGAAGCGGG + Intergenic
1045284976 8:100782681-100782703 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1045308307 8:100978376-100978398 GCACTTAGGGAGGCTGAAGCGGG - Intergenic
1045448158 8:102288917-102288939 GCACTTAGGGAGGTTGAGGCAGG + Intronic
1045615573 8:103906490-103906512 GCACTTAGTGAGGCTGAGGCAGG - Intronic
1045746886 8:105432851-105432873 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1046938724 8:119910685-119910707 GCACTTTGTGAGGTTGAGGCGGG - Intronic
1047131573 8:122026550-122026572 AGATGTAGTGAGGTTGCAGCTGG + Intergenic
1047872313 8:129097629-129097651 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1048334494 8:133492472-133492494 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1048868980 8:138781734-138781756 GCACCAAGTGGTGTTGGAGCTGG - Intronic
1048873062 8:138814603-138814625 GCTCCTAGTGAGATTGGAGGTGG + Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049094931 8:140542890-140542912 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1050251972 9:3754086-3754108 GCACCTTGGGAGGTTGAGGCAGG - Intergenic
1051150577 9:14074697-14074719 GCACTTTGGGAGGTTGAAGCGGG + Intergenic
1051177377 9:14374661-14374683 GCACTTTGTGAGGCTGAAGCGGG + Intronic
1051390396 9:16557250-16557272 GCACTTTGGGAGGTTGCAGTGGG + Intronic
1051615453 9:19001419-19001441 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1051640804 9:19222999-19223021 ACACATTGTGAGGTTGCAGCAGG - Intergenic
1053243445 9:36515702-36515724 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1053321121 9:37099771-37099793 GCACTTTGTGAGGATGAAGCAGG + Intergenic
1055378172 9:75673643-75673665 GCACTTAGGGAGGTTTAAGCAGG - Intergenic
1056306259 9:85293908-85293930 GCACCTTGAGAGGTTGAGGCAGG - Intergenic
1057022228 9:91708322-91708344 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1057326539 9:94069759-94069781 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1057376959 9:94533733-94533755 GCACTTAGTGAGGTCGAGGCTGG - Intergenic
1057574424 9:96230626-96230648 GCACCTAGGGAGGCTGAGGCAGG + Intergenic
1058567119 9:106297916-106297938 GCCCTTAGTAAGGCTGCAGCAGG - Intergenic
1060464913 9:123895178-123895200 GCACCTAGGGAGGCTGAAGTGGG - Intronic
1060804655 9:126567103-126567125 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1061522385 9:131126657-131126679 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1061622721 9:131822262-131822284 GCACTTTGAGAGGTTGAAGCAGG - Intergenic
1061984557 9:134122520-134122542 GCACTTAGGGAGGCTGAAGCTGG + Intergenic
1062619446 9:137413026-137413048 GCACTTAGGGAGGTTGAGGCAGG - Intronic
1062704412 9:137928340-137928362 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1203751868 Un_GL000218v1:87558-87580 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1203710546 Un_KI270742v1:93527-93549 GCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1203540505 Un_KI270743v1:83927-83949 GCTCCCTGTGAGGCTGCAGCTGG + Intergenic
1186341074 X:8646683-8646705 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1187537551 X:20156780-20156802 GCACCTTGAGAGGCTGAAGCGGG - Intronic
1188454139 X:30342927-30342949 GCAACTTGTGAGGTTCCCGCTGG - Intergenic
1189711871 X:43821422-43821444 GAGCCCAGTGAGGCTGCAGCCGG - Intronic
1189781664 X:44520193-44520215 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1189845858 X:45136309-45136331 GAACTTTGGGAGGTTGCAGCGGG + Intergenic
1190027172 X:46935178-46935200 GCACTTTGGGAGGTTGAAGCAGG - Intronic
1190068824 X:47262509-47262531 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1190078844 X:47339053-47339075 GCACTTTGGGAGGTTGAAGCAGG - Intergenic
1190187329 X:48246788-48246810 GCACTTTGGGAGGTTGCGGCGGG - Intronic
1190382743 X:49855407-49855429 GGACCAAGTCAGGTGGCAGCTGG + Intergenic
1190686409 X:52877674-52877696 GCACTTTGGGAGGTTGCAACAGG + Intergenic
1193024096 X:76825642-76825664 GCACTTAGGGAGGCTGAAGCAGG + Intergenic
1193467500 X:81867087-81867109 GCTCTTTGTGAGGCTGCAGCTGG + Intergenic
1194146785 X:90276208-90276230 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1195006753 X:100692732-100692754 GCAGCCAGTGAGGTTGGAGGAGG - Intronic
1195257345 X:103103400-103103422 GCACCTTGGGAGGTTGAGGCGGG - Intergenic
1195692757 X:107641602-107641624 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1195892366 X:109709858-109709880 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1195900169 X:109789365-109789387 GCACCTTGGGAGGCTGCAGCTGG - Intergenic
1196680846 X:118467927-118467949 GCACTTTGTGAGGCTGAAGCTGG + Intergenic
1196816442 X:119668704-119668726 GCACTTTGGGAGGTTGAAGCAGG + Intronic
1197017062 X:121637540-121637562 ACACCATGTGAGGGTGCAGCAGG - Intergenic
1198111573 X:133506926-133506948 GCACTTTGTGAGGTTGAGGCGGG + Intergenic
1200242373 X:154504062-154504084 GCACTTACGGAGGTTGAAGCAGG - Intergenic
1200773242 Y:7146747-7146769 GTAACTAGAGAGGTTGAAGCAGG - Intergenic
1201073188 Y:10168766-10168788 GCTCCTGGTGGGGCTGCAGCCGG - Intergenic
1201533360 Y:15017070-15017092 GCACTTTGGGAGGTTGCGGCAGG + Intergenic
1201549526 Y:15205453-15205475 GCACTTTGTGAGGCTGAAGCAGG + Intergenic
1201565948 Y:15365524-15365546 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1202173193 Y:22072855-22072877 GCACCTCGGGAGTCTGCAGCAGG + Intronic
1202218167 Y:22513516-22513538 GCACCTCGGGAGTCTGCAGCAGG - Intronic
1202325018 Y:23682539-23682561 GCACCTCGGGAGTCTGCAGCAGG + Intergenic
1202545753 Y:25987515-25987537 GCACCTCGGGAGTCTGCAGCAGG - Intergenic