ID: 1002308975

View in Genome Browser
Species Human (GRCh38)
Location 5:178302811-178302833
Sequence GTTCTAAGCAAGCTGTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002308974_1002308975 -4 Left 1002308974 5:178302792-178302814 CCTGGGGACAGGGCTCTTTGTTC 0: 1
1: 0
2: 0
3: 18
4: 212
Right 1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002308975 Original CRISPR GTTCTAAGCAAGCTGTGCAT AGG Intronic
902607215 1:17575371-17575393 GGTCTAAGGAAGCTTTGCAGAGG + Intronic
904160674 1:28520073-28520095 GTTCTATACAACCTGTGCCTGGG - Intronic
904774164 1:32896511-32896533 GTCCTGAGCAGGCTGTGTATGGG - Intronic
912319141 1:108693443-108693465 GGTCTCAGCCACCTGTGCATTGG + Intronic
913150389 1:116036296-116036318 GTTATAAGGAAGCCGTCCATGGG + Intronic
913995576 1:143649878-143649900 GTTCTAAAAAAGGTTTGCATAGG - Intergenic
915836078 1:159176174-159176196 GTTGAAAGCAAGCTGTGGATTGG + Intronic
916711436 1:167413520-167413542 CTCCTGAGAAAGCTGTGCATGGG + Intronic
917799979 1:178561415-178561437 GTTTTAAAAATGCTGTGCATTGG + Intergenic
917895392 1:179482330-179482352 ATTCTCAGCATGCTATGCATAGG + Intronic
921483699 1:215692116-215692138 ATGTTAAGGAAGCTGTGCATAGG + Intronic
1063328151 10:5126230-5126252 GTTCCAGGAAAGCTGTGTATAGG - Intronic
1064742226 10:18445561-18445583 TCTCTAAGCAAGATGTGCATGGG + Intronic
1064825170 10:19390317-19390339 GTTCTAAGCACACTGTGCAAAGG + Intronic
1070989426 10:80718468-80718490 GTTCCAAGCAAGCTGAGAAAGGG - Intergenic
1074254637 10:111788765-111788787 GTTCTGAGCAAACGGTACATGGG - Intergenic
1076019501 10:127060716-127060738 GTAATAAGGAAGTTGTGCATTGG - Intronic
1076256679 10:129032076-129032098 GTTCAAACAAAGCTGTGAATTGG + Intergenic
1077128258 11:954770-954792 ATTAAAAGCAAGCTGTGGATGGG + Intronic
1082025976 11:47572666-47572688 GCTCTAAGCAAGCTGTGGTGAGG + Exonic
1082905261 11:58300853-58300875 GTTTTTAGAAAGCTGTGCTTGGG + Intergenic
1090887986 11:130896175-130896197 TTTCTAGAAAAGCTGTGCATAGG + Intronic
1091514133 12:1160969-1160991 GTTCTAAGCAATGTATGCACTGG + Intronic
1092776253 12:11947263-11947285 TTGCTCAGCAAGCTGTGCACTGG - Intergenic
1094280167 12:28728356-28728378 GTGCTAAGCAAGCACTGAATAGG - Intergenic
1097805565 12:63961273-63961295 GTCCTAAGCATGCTGTCCAATGG - Intronic
1099038431 12:77619555-77619577 CTTCTAAGCAGGCATTGCATGGG + Intergenic
1100613300 12:96210282-96210304 GTTCTAAGAAAGCAGTGTTTAGG - Intronic
1102648262 12:114417984-114418006 GTTCGAAGCAAGCTGAGAGTGGG + Intergenic
1106727751 13:32503733-32503755 GTTCTAAGGAAGCTTTACCTTGG - Intronic
1109207273 13:59496507-59496529 ATTCTAAGAAAGCTATGAATCGG - Intergenic
1122056184 14:99099715-99099737 GTTCAAAGCAAGCTGTGTCTGGG - Intergenic
1123678344 15:22735815-22735837 GTGCTAAGCAAAATCTGCATTGG + Intergenic
1126047010 15:44651180-44651202 GTTGTAAGCAAGGTGCTCATGGG - Intronic
1126908280 15:53390580-53390602 GTTTGAAGCATGTTGTGCATGGG + Intergenic
1130355529 15:83126461-83126483 ATTTAAAGCAAGCTGTGCTTTGG + Intronic
1137562556 16:49512179-49512201 GATCTGTGCCAGCTGTGCATAGG - Intronic
1144790796 17:17857779-17857801 GTTATAAGCCAGCTGTCTATGGG + Intronic
1144849833 17:18238466-18238488 CTGCTCAGCCAGCTGTGCATTGG - Exonic
1147359276 17:39921105-39921127 TTTCTAAGCAAAGTGTGAATAGG - Intronic
1150987852 17:70219346-70219368 GTGCTGAGCATACTGTGCATTGG + Intergenic
1151350219 17:73527464-73527486 GTTCTGAGCCAGATGTGAATGGG - Intronic
1156238209 18:35225035-35225057 GTTGTAAGCATCCTGTGCTTTGG - Intergenic
1156973236 18:43183560-43183582 GTTCTATTCAAACTGAGCATAGG + Intergenic
1158284864 18:55869022-55869044 GTTCCAATCTGGCTGTGCATTGG - Intergenic
1159047582 18:63383977-63383999 GTTTTAACCAAAGTGTGCATTGG - Intergenic
1164086086 19:21903904-21903926 GATCTATGCAAGCTGTTGATGGG + Intergenic
1166651298 19:44577140-44577162 GTTGAAATCAAGGTGTGCATAGG - Intergenic
925395735 2:3532475-3532497 GTTCTAAGGAAGGTGTCCTTAGG + Intronic
927506701 2:23619665-23619687 TTTCTAATCAAGCTGTTAATAGG - Intronic
929235422 2:39600409-39600431 GTTCTTACCTGGCTGTGCATTGG + Intergenic
939064795 2:137470147-137470169 CTTCTAAGCAATATGGGCATTGG - Intronic
939212602 2:139196066-139196088 GTTAAAAACAAGCTGTGCAATGG + Intergenic
939279943 2:140050591-140050613 GTTCTTAGCAACCTCAGCATAGG + Intergenic
941176502 2:162203764-162203786 GTTCCCAGCAAGTTCTGCATGGG - Intronic
942431682 2:175918329-175918351 GTGCTAAGTGAGGTGTGCATTGG - Intergenic
1169426347 20:5500413-5500435 GCTCAAAGCAAGCTGGGCCTTGG - Intergenic
1169485609 20:6029027-6029049 GTTCTAGCCTTGCTGTGCATAGG + Intronic
1175394274 20:58648306-58648328 GCTCTAAGCAGGCTGTGTTTAGG - Intergenic
1177014400 21:15767124-15767146 GTTCAAGGCAAGCTGTGACTGGG + Intronic
949635745 3:5979909-5979931 TTTCTAAGCAAGCTGAGCTCAGG + Intergenic
953902193 3:46849697-46849719 TTGCTAAGGAAGCTCTGCATGGG - Intergenic
955483294 3:59411042-59411064 GTTCTACCCAATCTCTGCATTGG + Intergenic
960915138 3:122687263-122687285 ATTCTGAGCCAGCTGTGCAGAGG + Intronic
961649515 3:128410433-128410455 GTTCCATGGAAGCTGTCCATGGG + Intergenic
968040345 3:195583521-195583543 ATTCTCAGCAAGCTGTCCAACGG - Intronic
968735832 4:2296143-2296165 GCTCTAGGCCAGCTGTGAATTGG + Intronic
972584957 4:40429320-40429342 GTTCTTAGCAACCTCAGCATAGG - Intronic
974631625 4:64497715-64497737 CTTCTGGGCAAGCTGTGCATTGG + Intergenic
980221908 4:129928732-129928754 GTTCTTAGCAACCTCTGCACAGG - Intergenic
982736287 4:159010231-159010253 GTTCTAAGGGAGCTTTGGATAGG + Intronic
990411421 5:55544777-55544799 GTTCTAAGCAATTTGTCCAAGGG - Intergenic
990747131 5:58969832-58969854 TTTCTAAGCAAGCTTTGAAAGGG - Exonic
995746916 5:115414045-115414067 GTTTAAAGCAAGCTCTGCTTAGG - Intergenic
1000446548 5:161329479-161329501 CTTCTAAGCAAGAAGTGCCTTGG + Intronic
1001244883 5:170098640-170098662 TTTCTAAGCTGGCTATGCATTGG + Intergenic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1003674189 6:8188122-8188144 GCTCTAAGAAAGCTCTGCACAGG - Intergenic
1013161537 6:107549926-107549948 ACTCTAACCCAGCTGTGCATGGG + Intronic
1014990799 6:128073648-128073670 GTCATAAGCAAGCTGTGGACTGG + Intronic
1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG + Intronic
1026426320 7:70297957-70297979 GCTCTAAGAAAGCTGAGCAAAGG - Intronic
1030968814 7:116027647-116027669 CATCTAAGGAAGCTGAGCATTGG + Intronic
1032028188 7:128460225-128460247 TTTCTAAATGAGCTGTGCATAGG - Intergenic
1033347260 7:140535081-140535103 GTTGGAAGCCAGCTGAGCATAGG - Intronic
1033560064 7:142522376-142522398 TTTCTGAGCAGCCTGTGCATGGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1038446564 8:27608636-27608658 GTTCCAAGCAGGCTCTGGATGGG - Intronic
1038749322 8:30281414-30281436 GTTTTAAACAAGATGTACATGGG - Intergenic
1038835607 8:31118145-31118167 GTTTTAATGAAGCTGTGAATTGG - Intronic
1040081438 8:43289951-43289973 GTTCTATGTAAGATGTGCAGAGG - Intergenic
1041337095 8:56798348-56798370 GTTCTAGGCAAGATGTGGATGGG - Intergenic
1054967945 9:71051154-71051176 GTTCAAAGAAAGCTCTGCAATGG - Intronic
1059841983 9:118227692-118227714 CTTCTAAGCTTGCTGGGCATTGG - Intergenic
1060117571 9:120955071-120955093 ATTCTAAGCACTCTGTGCTTTGG + Intronic
1190939263 X:55025125-55025147 GGTCTAAGCAGGCTTTGCAGAGG + Intronic
1193387021 X:80884202-80884224 GTTCTAAAGAAGCTGTCTATAGG - Intergenic