ID: 1002313979

View in Genome Browser
Species Human (GRCh38)
Location 5:178331557-178331579
Sequence TGCTCCGCACCCTGCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313979_1002313991 25 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313991 5:178331605-178331627 GGCAGCCACCGACAGGAGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 220
1002313979_1002313990 22 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313990 5:178331602-178331624 AGAGGCAGCCACCGACAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 215
1002313979_1002313992 26 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313992 5:178331606-178331628 GCAGCCACCGACAGGAGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1002313979_1002313987 4 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313979_1002313986 -3 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313986 5:178331577-178331599 GCAGGGAGGGCGAGGCTCTGAGG 0: 1
1: 0
2: 2
3: 53
4: 564
1002313979_1002313988 18 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313988 5:178331598-178331620 GGACAGAGGCAGCCACCGACAGG No data
1002313979_1002313989 21 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 234
1002313979_1002313993 27 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313993 5:178331607-178331629 CAGCCACCGACAGGAGGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313979 Original CRISPR TGCTCCGCACCCTGCCCCGA GGG (reversed) Intronic
901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG + Intronic
902461849 1:16583560-16583582 TGCTCCCCCACCTGCCCCCATGG + Intronic
902462629 1:16589865-16589887 TGCTCCCCTGCCTGCCCCCATGG + Intronic
903284425 1:22268071-22268093 TGCTCTGGACCCCGCCCCGCTGG - Intergenic
904671715 1:32171032-32171054 TGCTCCGCCCCCTTCCCTGGAGG + Exonic
904689941 1:32286300-32286322 TGCTCCTCACCCCTCCCCAAAGG + Intergenic
915598372 1:156907924-156907946 TGCTCCCTGCCCTGCCCAGAGGG + Exonic
920218513 1:204378201-204378223 GGCTCCGCCCCCGGCCCCGCCGG - Intergenic
1063220501 10:3962938-3962960 TGGTCCTCACCAAGCCCCGATGG + Intergenic
1067985334 10:51137228-51137250 TGCCCCCCACCCTGCCCCCACGG - Intronic
1075777660 10:124998764-124998786 TGCTCAGCACCCTGCTCTGCTGG + Intronic
1077105177 11:839104-839126 TGCTCCCCACCATGGCCAGAAGG - Intronic
1081441831 11:43089352-43089374 TGCCCCTCACCCTGCCCCCGAGG - Intergenic
1084665459 11:70573921-70573943 GGCTCCACACCCTGCCCCAGGGG + Intronic
1086648669 11:89258854-89258876 TGCTCCCCACTCTGCTCTGAAGG - Intronic
1088144954 11:106665305-106665327 TGCTCCCCAACCTGGCCCCAGGG - Intergenic
1091875877 12:3932357-3932379 TGTTCCTCTCCCTGCCCTGATGG + Intergenic
1098543164 12:71682156-71682178 TGCTCCCCACCCTCTCCCTAAGG + Intronic
1100985666 12:100199868-100199890 TGCTGCGCTCCCTGCCCCCGCGG + Intronic
1104437218 12:128765824-128765846 TGTTCCGTTCCCTGCCCCCATGG + Intergenic
1105016407 12:132788582-132788604 AGCTCCGCACTCAGCCACGAGGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1105884073 13:24627389-24627411 TGCTCCGCGCCCTGCTCCCGCGG - Intergenic
1113885851 13:113658034-113658056 TGGGCCGCACCCTGTCCCGGTGG - Exonic
1114736563 14:25049336-25049358 GGCACGGCACCCTGCCCCCAGGG - Intronic
1127718336 15:61673863-61673885 TGCTCCTCCACCTGCCCTGATGG - Intergenic
1130015106 15:80180270-80180292 TGCTCCCCACACAGCCCCAAGGG + Intronic
1130575768 15:85092082-85092104 TGCACAGCACCCTGCCCCTGTGG - Intronic
1130967206 15:88706103-88706125 TGCTCACCACCCTGCCCCGATGG + Intergenic
1132346579 15:101112369-101112391 TGCTCAGCCCCCTGCACTGAGGG + Intergenic
1133149603 16:3817804-3817826 TGCTCCCTCCCCTGCCCCCATGG - Intronic
1133326367 16:4944726-4944748 TGCTCCTGTCCCTGCTCCGAGGG + Intronic
1136294941 16:29296205-29296227 TGCTCCCCACCCTGGGCCCAGGG + Intergenic
1137434140 16:48441737-48441759 TGCTCCCCACCTTGCCTCAAAGG - Intronic
1138195397 16:55048129-55048151 TGCTGGGGACCCTTCCCCGAGGG - Intergenic
1141667676 16:85474345-85474367 TCCTCCGCATCCTGCCACGTTGG + Intergenic
1142100835 16:88270214-88270236 TGCTCCCCACCCTGGGCCCAGGG + Intergenic
1142431266 16:90029149-90029171 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142431281 16:90029197-90029219 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142550036 17:732715-732737 TGCGCCGCTCCCAGCCCGGATGG + Exonic
1143359623 17:6358366-6358388 TGCTGCCCACCCTGCCCTGCAGG + Intergenic
1145791245 17:27628636-27628658 TGCTCCACACCCTGCCTGGAGGG - Intronic
1145806811 17:27740174-27740196 TGCTCCACACCCTGCCTGGATGG - Intergenic
1147934843 17:44005477-44005499 TGCTCCGCCCTTTGCCCCGTTGG - Intronic
1148393068 17:47287328-47287350 AGCCCTGCACCCTGCCCAGAAGG - Intronic
1152195517 17:78916065-78916087 TCCTCCCCACCCCGCCCTGAGGG - Intronic
1152234839 17:79133151-79133173 TGCTCCCCACCCTGCTCCTGTGG - Intronic
1152404560 17:80089231-80089253 TGCTCCGCACCCTTTCCACAGGG - Intronic
1152618120 17:81346992-81347014 TGCCCCGCGCCCTCCCCAGAGGG + Intergenic
1154097555 18:11432319-11432341 GGCGCCGCCCCCTGCTCCGAGGG - Intergenic
1154121222 18:11654127-11654149 TGCTCCCCATCCTGCCACCACGG - Intergenic
1155257840 18:24014386-24014408 AGCGCCCCACCCTCCCCCGAAGG - Intronic
1160861266 19:1238043-1238065 GGCTCCGCCCCCCGCCCCGCCGG - Intergenic
1160956803 19:1697351-1697373 TCCTTCGCACCCCACCCCGATGG - Intergenic
1161160231 19:2757587-2757609 TGCTGCGTCCCCTGCTCCGAAGG - Intronic
1161316508 19:3619932-3619954 TCCTCTGCACCCTGCCCAGCAGG + Intronic
1161394250 19:4037049-4037071 TCCTCCCCACCCTGCCCCTCTGG - Intronic
1163334253 19:16660937-16660959 TGCCCCGCACCCCGCCTCGCTGG + Intergenic
1163700156 19:18782838-18782860 GGCTCTGCACCCAGCCCCAAGGG - Exonic
1164669198 19:30063297-30063319 TGCTCCCCACTCTCCCCCCAGGG + Intergenic
1168263687 19:55209578-55209600 AGCTCCCAACCCTGCCCCGCTGG + Intergenic
929561973 2:42961757-42961779 TGTTCCTGTCCCTGCCCCGATGG - Intergenic
931645049 2:64414561-64414583 TGCTCCACTCCCTGCCGCTAAGG - Intergenic
932586629 2:73034246-73034268 TGGTCAGCACCCTGCCCCTCTGG - Intronic
932844575 2:75122275-75122297 TGCTGAGCATCCTGCCCCAACGG + Intronic
933891507 2:86775674-86775696 TGGTCCTCACCCTGCCCAGTGGG - Exonic
934768912 2:96895652-96895674 TACTCCCCGCCCTGCCCCCAGGG - Intronic
935082025 2:99807664-99807686 TTCTCCCCACACTGCCCCTATGG + Intronic
935663652 2:105490860-105490882 TTCTCTGCACACTGCCCCGTTGG - Intergenic
937207430 2:120245716-120245738 CCCTCCACACCCTGCCCCGGGGG - Intronic
946203968 2:218090010-218090032 TGCTGCCCACCCTGCGCCCAGGG + Exonic
947669734 2:231928653-231928675 TGCTCCACAGCCTGCCCCCCGGG - Intergenic
948667648 2:239546334-239546356 TGCTGCCCTCCCTGCCCCGTGGG + Intergenic
948717409 2:239874299-239874321 TGCTCCTCCCTCTGCCCGGAAGG + Intergenic
1168806926 20:676929-676951 AGCTCAGCCCCCTGCCCAGAGGG + Intergenic
1169196080 20:3682496-3682518 TGCTACCCGTCCTGCCCCGAGGG + Intergenic
1171255513 20:23686600-23686622 TGCCCAGCACCCAGCCCCGCAGG + Intronic
1173224776 20:41156002-41156024 TGCTCTGCTCCCTGCCCTGATGG - Intronic
1175544671 20:59770727-59770749 TGGTCCCCACCCTGCCCCCATGG + Intronic
1179810094 21:43864944-43864966 GGCTCCGCGCCCGGCCCCGCCGG + Intergenic
1180951998 22:19724640-19724662 TCCTGCCCACCCTACCCCGAGGG + Exonic
1181029723 22:20143891-20143913 TGCGCCTCACCCTGCCTTGAAGG + Intronic
1182621306 22:31620160-31620182 TGCTGCCCACCCTGCCCCCAGGG - Intronic
1183548501 22:38468018-38468040 GGCTCCCCACCCTGCGCCGGCGG + Intergenic
1184822848 22:46923584-46923606 TGCCCCGCACCCTGGCTCAAAGG - Intronic
1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG + Intergenic
953797069 3:45994127-45994149 TGCTCCAAACCCAGCCCCAAGGG + Intronic
958482268 3:94657758-94657780 TCCTCCGAGCCCTGCCCAGAGGG - Intergenic
961400537 3:126638873-126638895 TGCTGCACTCCCTGCCCCCATGG - Intronic
967018056 3:185498965-185498987 GGCTCCGCACCCCGGCCCGCGGG + Exonic
972201273 4:36716909-36716931 TCTTCCGCAGCCTGCACCGATGG - Intergenic
978384900 4:108168881-108168903 TCCTCCGCGCCCTGCCCCGCAGG + Intronic
981006788 4:139883342-139883364 TGCCCCTCACCCTGCCCAAAAGG + Intronic
981075208 4:140584406-140584428 TCCTCCCTACCCTGCCCCCAGGG + Intergenic
985092718 4:186381164-186381186 AGCCCCGCACGCTGCCCTGAGGG - Intergenic
988641985 5:33050140-33050162 TGCTGAGCACCCTGCCTCTATGG + Intergenic
996056431 5:118988230-118988252 GGCGCCGCACCCTCCTCCGAAGG + Intronic
998041361 5:138952806-138952828 TGCATGGCACCCTGCCCTGATGG - Intronic
1002313979 5:178331557-178331579 TGCTCCGCACCCTGCCCCGAGGG - Intronic
1002323137 5:178387537-178387559 TGCTCTGCACACTGCTCCAAGGG + Intronic
1005990625 6:30899583-30899605 TTCTCCCCACCCTTCCCCAAGGG - Intronic
1010855092 6:80828226-80828248 TGCTCCTCTCCCTCCTCCGATGG + Intergenic
1013210472 6:107982562-107982584 TGCTCCTAAGCCTGCCCCAATGG - Intergenic
1019654829 7:2185867-2185889 TGCTGCCCACCCTGGCCCAAGGG - Intronic
1022711643 7:32856351-32856373 TCCTCCTCACCCTGCACCGCAGG + Intergenic
1022913015 7:34918608-34918630 TCCTCCTCACCCTGCACCGCAGG - Intergenic
1029364072 7:100106261-100106283 TGCACCTCCCCCTGCCTCGAGGG + Exonic
1032679328 7:134166020-134166042 TGCTCCTCAACCTGCCCAGGGGG - Intronic
1033346218 7:140527271-140527293 TTCTCCGCACCCTGCAGGGAGGG + Intronic
1035771200 8:2148244-2148266 TTCTCCGCATTCTGCCCTGAGGG - Intronic
1038540478 8:28386248-28386270 TGCTCCGCTCCCTTCCCGGGCGG - Intronic
1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG + Intronic
1052733707 9:32318759-32318781 TGCTCCACCCCCTGCCCTGAAGG + Intergenic
1053532902 9:38899406-38899428 TGCCCCGCCCGCTGCCCCTAAGG + Intergenic
1054205129 9:62123835-62123857 TGCCCCGCCCGCTGCCCCTAAGG + Intergenic
1054633231 9:67464535-67464557 TGCCCCGCCCGCTGCCCCTAAGG - Intergenic
1054867824 9:70020614-70020636 TGATTCGCACCCTCCTCCGAGGG + Intergenic
1057151315 9:92798500-92798522 TGCCCCGCCCGCTGCCCCTAAGG - Intergenic
1057180392 9:93026717-93026739 TGCTGTGCACCCAGCCCCGCAGG + Intronic
1060050895 9:120377400-120377422 TGCTCCCCACTCTGCCCCCAAGG - Intergenic
1061128383 9:128690259-128690281 TTCTCCGCACGCTGGCGCGACGG - Intronic
1062194491 9:135265357-135265379 TGCTCCGAACCATCCCACGAAGG - Intergenic
1062338892 9:136084797-136084819 TGCTCCGCACCCTCTCCCCACGG - Intronic
1062651223 9:137578782-137578804 GGCTCCGCGCCCTTCCCCGAGGG - Exonic
1195747991 X:108137693-108137715 TGCCCCCCACCCTGCCTAGAAGG - Intronic
1200092462 X:153642351-153642373 TTCTCCGCCCCCTGCCCAGGAGG - Intergenic