ID: 1002313979

View in Genome Browser
Species Human (GRCh38)
Location 5:178331557-178331579
Sequence TGCTCCGCACCCTGCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313979_1002313990 22 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313990 5:178331602-178331624 AGAGGCAGCCACCGACAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 215
1002313979_1002313988 18 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313988 5:178331598-178331620 GGACAGAGGCAGCCACCGACAGG No data
1002313979_1002313992 26 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313992 5:178331606-178331628 GCAGCCACCGACAGGAGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1002313979_1002313989 21 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 234
1002313979_1002313986 -3 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313986 5:178331577-178331599 GCAGGGAGGGCGAGGCTCTGAGG 0: 1
1: 0
2: 2
3: 53
4: 564
1002313979_1002313993 27 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313993 5:178331607-178331629 CAGCCACCGACAGGAGGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 235
1002313979_1002313991 25 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313991 5:178331605-178331627 GGCAGCCACCGACAGGAGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 220
1002313979_1002313987 4 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313979 Original CRISPR TGCTCCGCACCCTGCCCCGA GGG (reversed) Intronic