ID: 1002313987

View in Genome Browser
Species Human (GRCh38)
Location 5:178331584-178331606
Sequence GGGCGAGGCTCTGAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 443}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313977_1002313987 10 Left 1002313977 5:178331551-178331573 CCGCGGCCCTCGGGGCAGGGTGC No data
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313969_1002313987 21 Left 1002313969 5:178331540-178331562 CCCCAAGGAATCCGCGGCCCTCG 0: 1
1: 0
2: 1
3: 18
4: 552
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313972_1002313987 19 Left 1002313972 5:178331542-178331564 CCAAGGAATCCGCGGCCCTCGGG No data
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313980_1002313987 3 Left 1002313980 5:178331558-178331580 CCTCGGGGCAGGGTGCGGAGCAG 0: 1
1: 0
2: 7
3: 31
4: 291
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313970_1002313987 20 Left 1002313970 5:178331541-178331563 CCCAAGGAATCCGCGGCCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443
1002313979_1002313987 4 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313987 5:178331584-178331606 GGGCGAGGCTCTGAGGACAGAGG 0: 1
1: 0
2: 3
3: 45
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313987 Original CRISPR GGGCGAGGCTCTGAGGACAG AGG Intronic