ID: 1002313989

View in Genome Browser
Species Human (GRCh38)
Location 5:178331601-178331623
Sequence CAGAGGCAGCCACCGACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313979_1002313989 21 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 234
1002313977_1002313989 27 Left 1002313977 5:178331551-178331573 CCGCGGCCCTCGGGGCAGGGTGC No data
Right 1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 234
1002313980_1002313989 20 Left 1002313980 5:178331558-178331580 CCTCGGGGCAGGGTGCGGAGCAG 0: 1
1: 0
2: 7
3: 31
4: 291
Right 1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313989 Original CRISPR CAGAGGCAGCCACCGACAGG AGG Intronic