ID: 1002313992

View in Genome Browser
Species Human (GRCh38)
Location 5:178331606-178331628
Sequence GCAGCCACCGACAGGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313980_1002313992 25 Left 1002313980 5:178331558-178331580 CCTCGGGGCAGGGTGCGGAGCAG 0: 1
1: 0
2: 7
3: 31
4: 291
Right 1002313992 5:178331606-178331628 GCAGCCACCGACAGGAGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1002313979_1002313992 26 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313992 5:178331606-178331628 GCAGCCACCGACAGGAGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313992 Original CRISPR GCAGCCACCGACAGGAGGGT GGG Intronic