ID: 1002313993

View in Genome Browser
Species Human (GRCh38)
Location 5:178331607-178331629
Sequence CAGCCACCGACAGGAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002313979_1002313993 27 Left 1002313979 5:178331557-178331579 CCCTCGGGGCAGGGTGCGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1002313993 5:178331607-178331629 CAGCCACCGACAGGAGGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 235
1002313980_1002313993 26 Left 1002313980 5:178331558-178331580 CCTCGGGGCAGGGTGCGGAGCAG 0: 1
1: 0
2: 7
3: 31
4: 291
Right 1002313993 5:178331607-178331629 CAGCCACCGACAGGAGGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002313993 Original CRISPR CAGCCACCGACAGGAGGGTG GGG Intronic