ID: 1002314597

View in Genome Browser
Species Human (GRCh38)
Location 5:178334933-178334955
Sequence CCTCCCCCACACCCCAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002314593_1002314597 3 Left 1002314593 5:178334907-178334929 CCAGGCAGCTGACCACATAGCCT 0: 1
1: 0
2: 0
3: 17
4: 201
Right 1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG 0: 1
1: 0
2: 10
3: 82
4: 691
1002314592_1002314597 11 Left 1002314592 5:178334899-178334921 CCTCAGATCCAGGCAGCTGACCA 0: 1
1: 0
2: 1
3: 116
4: 480
Right 1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG 0: 1
1: 0
2: 10
3: 82
4: 691
1002314594_1002314597 -9 Left 1002314594 5:178334919-178334941 CCACATAGCCTGTGCCTCCCCCA 0: 1
1: 0
2: 10
3: 77
4: 493
Right 1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG 0: 1
1: 0
2: 10
3: 82
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002314597 Original CRISPR CCTCCCCCACACCCCAGACT TGG Intronic
900117881 1:1036236-1036258 CATCCCCCACTCCCAAGACCTGG - Intronic
900156264 1:1204486-1204508 CTCCCCCCACACCCCACACCAGG - Exonic
900171071 1:1269138-1269160 CCTCAGCCACACCCGAGACTGGG + Intronic
900171093 1:1269217-1269239 CCTCAGCCACACCCGAGACTGGG + Intronic
900171114 1:1269296-1269318 CCTCAGCCACACCCGAGACTGGG + Intronic
900171136 1:1269375-1269397 CCTCAGCCACACCTGAGACTGGG + Intronic
900350031 1:2229984-2230006 CCTTCCCCACACACCAGGCCTGG - Intronic
900360728 1:2287701-2287723 CCACCCCCACGCCCCACACAGGG - Intronic
900614011 1:3556218-3556240 CCTGCCCCACTCCCCATCCTGGG - Intronic
900780644 1:4615275-4615297 CCGCCTCCACACCCCACACCTGG + Intergenic
901012899 1:6211154-6211176 CCTCCCCCACACCCCAGTGTTGG - Intronic
901058440 1:6460518-6460540 CCTCCCCCGCACCCCGGAACCGG + Exonic
901216704 1:7559218-7559240 CCTCCCACGCACCCCAGACATGG + Intronic
901453806 1:9352065-9352087 CCACCCCCTCACCCCAGCCCAGG - Intronic
901681517 1:10915683-10915705 CCTCCACCACATCCCGGAGTGGG + Intergenic
901760588 1:11468834-11468856 CCTCCCCCGTACCCCAGCCCTGG + Intergenic
901849709 1:12007625-12007647 CATCCCCACCACCCCAGATTAGG - Intronic
902025613 1:13381306-13381328 CCTTCCCCACACCCTATCCTGGG - Intergenic
902509426 1:16958056-16958078 CAGCCCACACACACCAGACTGGG - Intronic
902617736 1:17632989-17633011 CCTCACCCTCACCCCACACCAGG - Intronic
902642214 1:17774306-17774328 CCGCCCCCACCCCCCAGCGTGGG - Intronic
902705736 1:18202951-18202973 CCTCACCCAAAGCCAAGACTGGG - Intronic
902771310 1:18646966-18646988 CCTCCCCCCCACCCCACCCCCGG - Intronic
902945051 1:19829791-19829813 GCACCACCACACCCCAGCCTGGG - Intergenic
903019992 1:20387037-20387059 CCTCCCCCTCAGCCCTGCCTCGG - Intergenic
903492922 1:23743365-23743387 CCCCCCACACACCCCAGCCGAGG + Exonic
903539687 1:24089958-24089980 CATCCCCCACACCCTGCACTGGG + Intronic
904000328 1:27335240-27335262 CCACCCCCTCACCCCAAACTTGG - Intronic
904030409 1:27529873-27529895 TCTCCCCCACACCAGAGACCTGG - Intergenic
904047447 1:27617047-27617069 CCTCTCCCAGCTCCCAGACTAGG - Intronic
904189583 1:28733293-28733315 CCACCACCACACTCCAGCCTGGG - Intergenic
904237945 1:29125908-29125930 CTTCCCCCAGCCCCCAGACCAGG + Intergenic
904289836 1:29478033-29478055 ACTCCACCACACTCCAGCCTGGG + Intergenic
904597480 1:31655952-31655974 CCTCTCCGACTCCCCAGGCTGGG + Intronic
904748979 1:32729091-32729113 CCCACCCCACCCCCCAGCCTGGG - Intergenic
904812373 1:33171822-33171844 GCACCACTACACCCCAGACTGGG - Intronic
904830100 1:33300789-33300811 CCTCCCCCGCCCCCCAGACTTGG + Intergenic
904913712 1:33954367-33954389 CCACCCCCATACCCCTCACTTGG - Intronic
904930424 1:34082517-34082539 GCCCCCCCACCCCCCAGACGTGG - Intronic
905202735 1:36324639-36324661 ACTCCCCCAGTCCCGAGACTGGG + Intronic
905432377 1:37933675-37933697 GCACCACCACACCCCAGCCTGGG + Intronic
905443059 1:38006545-38006567 GCCTCCCCACACCCCAGGCTGGG + Intergenic
905478255 1:38244072-38244094 CCTCACCCCCAGCCCAGGCTGGG + Intergenic
906308867 1:44738783-44738805 CCCCCCCCACCTCCCAGACAGGG - Intergenic
906357559 1:45120291-45120313 CCGCCACCACACTCCAGCCTGGG + Intronic
906824166 1:48961070-48961092 ACACACACACACCCCAGACTGGG - Intronic
906963596 1:50434919-50434941 TCTCCCCTAACCCCCAGACTGGG - Intergenic
907072933 1:51553469-51553491 TCACCACCACACCCCAGCCTGGG + Intergenic
907359702 1:53904542-53904564 CCTACCCCCCACCCCAGGATGGG - Intronic
907571560 1:55488581-55488603 CCTTCCCCCCACCCCACAATAGG - Intergenic
907858047 1:58323083-58323105 CCTGCCCCCCACCCCACAATAGG - Intronic
908095957 1:60738869-60738891 CCTCCCCCCCACCCCACAACAGG - Intergenic
908096395 1:60743309-60743331 CCTCCCCCCCACCCCACAACAGG - Intergenic
910083537 1:83371603-83371625 CATCCTCCAGACCCCAGAGTGGG - Intergenic
910345456 1:86231429-86231451 CCTGCCCCACACCCCAGATTTGG + Intergenic
910440508 1:87246937-87246959 CCACCCCCACACCCAACACGTGG - Intergenic
910817119 1:91302775-91302797 CCTCCCCCCCACCCCACAACAGG - Intronic
911005338 1:93215497-93215519 ACACCACCACACTCCAGACTGGG - Intronic
911116935 1:94255634-94255656 CCTGGGCCACACCCCAGAGTAGG - Intronic
911332744 1:96543916-96543938 CCACCACCGCACTCCAGACTGGG + Intergenic
912530287 1:110315874-110315896 CCCACCCCACACCCCAGTCTAGG - Intergenic
912620006 1:111145825-111145847 CCTCCCCTCCACCCCAGACAGGG + Intronic
913602407 1:120434117-120434139 CCTCCCCCACCCGCCAGCCCAGG - Intergenic
914084642 1:144442520-144442542 CCTCCCCCACCCGCCAGCCCAGG + Intronic
914190651 1:145407686-145407708 CCTCCCCCACCCGCCAGCCCAGG + Intergenic
914488097 1:148129411-148129433 CCTCCCCCACCCGCCAGCCCAGG + Intronic
914519978 1:148406644-148406666 CCACCACCACACTCCAGCCTGGG - Intergenic
914588458 1:149084530-149084552 CCTCCCCCACCCACCAGCCCAGG + Intronic
914815479 1:151059393-151059415 CCTCCCCCACACCCCGCATCCGG + Exonic
914914829 1:151813227-151813249 CCTGCCCCTCACCCAAGGCTCGG + Exonic
915152857 1:153848974-153848996 CCCCCCCCCTCCCCCAGACTGGG + Intronic
915517026 1:156419682-156419704 ACTGCCCCAGAACCCAGACTGGG + Intronic
915629089 1:157138172-157138194 CCTCCCCCGCCCCCCGCACTGGG + Intronic
916078862 1:161219532-161219554 CCTCCCCTACAACCCAACCTTGG - Intronic
916442035 1:164836649-164836671 CATCCCCCACCCCCAAGCCTGGG + Intronic
916692222 1:167201387-167201409 CCTCCACTGCACTCCAGACTGGG + Intergenic
916802354 1:168226540-168226562 CCACCCCAACACCCCAGTCCGGG - Intronic
918145307 1:181750969-181750991 CCTACCCCACCCCCCTGACAGGG - Intronic
918249122 1:182685832-182685854 CATCCCCCACAGCACATACTAGG - Intergenic
918315103 1:183316693-183316715 CCTCCCCCACAGCCCTTACCAGG + Intronic
918818911 1:189226056-189226078 CCCCCCCCACCTCCCAGACGGGG - Intergenic
919897531 1:202018503-202018525 CCACCCCCACTCCCCAGCCCAGG - Intergenic
920266757 1:204729785-204729807 CATCCCCCAGACCCCAGAAGGGG - Intergenic
920676571 1:208042366-208042388 CCTCCACCACACCCCACCCCAGG - Exonic
921649124 1:217656024-217656046 CCTCCCCCACCCCCCACGCCCGG + Intronic
922080972 1:222296246-222296268 ACACCACCACACCCCAGCCTAGG + Intergenic
922586697 1:226738753-226738775 CCGCCCCGAGACCCCAGCCTGGG + Intronic
922721932 1:227903811-227903833 CATCCCCCAGACCCCAGGGTAGG - Intergenic
922917824 1:229272583-229272605 CCTCCCTGACACCCCTGTCTGGG - Intronic
924063131 1:240197102-240197124 TCTGCCCCACCCCCCAGCCTCGG + Intronic
924082089 1:240409183-240409205 CCACCACCACACTCCAGCCTGGG - Intronic
924318665 1:242825104-242825126 CCTCCCCCACATCCATGAATGGG + Intergenic
924824218 1:247522322-247522344 CGTCCCCCACCTCCCAGACGGGG - Intronic
1063625474 10:7685475-7685497 CCTCCACCACACTCCAGCCTGGG + Intergenic
1063796335 10:9517556-9517578 CATCCCCCACCCCCATGACTGGG + Intergenic
1064214009 10:13384255-13384277 CTTCCCCCAGCCACCAGACTTGG - Intergenic
1065204866 10:23347638-23347660 CCTGCCCCAAACCCCCTACTGGG - Intergenic
1065582923 10:27189615-27189637 CCTCCCCCCCACCCCACAACAGG - Intergenic
1065606581 10:27424234-27424256 CCTCCCCCCCACCCCACAACAGG - Intergenic
1065644379 10:27819161-27819183 CCTCCCACACACTGCAGACTTGG - Intronic
1065660717 10:28001870-28001892 CCTCCCCCACACCCTATCCATGG + Intergenic
1065748436 10:28863119-28863141 TCACCCCCACACTCCAGCCTGGG - Intronic
1066649853 10:37643725-37643747 CCTCCCCCACTCCCCAGTAGTGG - Intergenic
1067087489 10:43250616-43250638 CCTTCGGCACACCCCACACTTGG - Intronic
1067699187 10:48556372-48556394 CCTTCCCCAACCCCCAGGCTAGG + Intronic
1067705343 10:48602844-48602866 CTTCCCACACACCCCAGTCCAGG - Intronic
1067713383 10:48668201-48668223 CCTTCCCCATACCTCAGAATTGG + Intergenic
1067776538 10:49168397-49168419 CCTCCCTGACTCCCCAGACCTGG + Intronic
1067935192 10:50605199-50605221 CCTCCCCTACCACCCAGATTTGG + Intronic
1068673291 10:59744514-59744536 GCTCCCCCACCTCCCAGACGGGG - Intergenic
1069683461 10:70301251-70301273 CCGCCCCCAGCCCCCAGGCTTGG + Exonic
1069831961 10:71287100-71287122 CCTGCCTCAGCCCCCAGACTTGG - Intronic
1069899132 10:71696929-71696951 CCTCCTCCCCACCCCAGCCAGGG + Intronic
1069965617 10:72112833-72112855 CCTCCACTGCACCCCAGCCTGGG + Intronic
1070138330 10:73715566-73715588 CCCCCCCCACATCCCAGACGGGG + Intergenic
1070444184 10:76478890-76478912 CCTCCCCCACACCCCACAACAGG - Intronic
1070481302 10:76885410-76885432 CCTCCCCCACACCAAAGACAGGG - Exonic
1070756126 10:78994242-78994264 CTACCCCCACTCCCCAGGCTGGG - Intergenic
1070826231 10:79391931-79391953 CCTCAGCCACACCCTAGACTTGG + Intronic
1071704249 10:87980288-87980310 ACACCACCACACCCCAGCCTGGG - Intergenic
1072305486 10:94102702-94102724 CATCCTCCACACCCCAGCCCTGG + Intronic
1072480815 10:95809272-95809294 CACCCCCCACATCCCAGACAGGG + Intronic
1072480861 10:95809383-95809405 CGCCCCCCACCCCCCAGACGGGG + Intronic
1072480879 10:95809420-95809442 CGTCCCCCACCTCCCAGACGGGG + Intronic
1072737128 10:97886685-97886707 CCACCACCACACTCCAGCCTGGG - Intronic
1073104039 10:101022127-101022149 CCATCCCCACATCCCAGCCTAGG + Intronic
1073326099 10:102644566-102644588 CCTCCCCGACTCCCCAGCCCCGG - Exonic
1074349746 10:112724646-112724668 CCTCCCTCAGACCCCAGAGCTGG + Intronic
1074769207 10:116722590-116722612 CATCCCCTGCACCCCACACTCGG + Intronic
1074841452 10:117356705-117356727 CCTCTCCCCAACCCCAGATTAGG - Intronic
1075734532 10:124655712-124655734 CCTCCCACACACGCCAGCCTTGG + Intronic
1076186192 10:128451336-128451358 CCTCCCCCACACCCCACAGGGGG - Intergenic
1076309436 10:129493695-129493717 CCTCCCCCAGATCCCACACTGGG - Intronic
1076428225 10:130382297-130382319 CCTCCCCCACACCCTTGTGTGGG - Intergenic
1076715355 10:132361221-132361243 CCTCCCTGACAGCCCAGGCTGGG - Intronic
1076777871 10:132708079-132708101 CCCCCACCCCACCCCAGGCTGGG + Intronic
1077048386 11:555947-555969 TCACCCCCACACCCCAGCCCCGG + Intronic
1077348701 11:2078665-2078687 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077696818 11:4400968-4400990 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077712204 11:4548810-4548832 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077757207 11:5045297-5045319 CCCCCTCCACACCTCAGAATGGG + Intergenic
1077858750 11:6156748-6156770 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1079304312 11:19308883-19308905 TCACCCCCACACTCCAGACCTGG - Intergenic
1079920260 11:26425029-26425051 CCTCCCCCCCACCCCACAAGAGG + Intronic
1081049061 11:38315143-38315165 CCTCTCCCACACCCCAGCAGTGG + Intergenic
1081502578 11:43680929-43680951 CATTCCCCACTCCCCAGACCCGG - Exonic
1081696017 11:45109614-45109636 CATCTCCCACACCTCAGTCTTGG - Intronic
1083522494 11:63328239-63328261 CCTTCCCCACACCCCACAACAGG + Intronic
1083648338 11:64185995-64186017 CCTCCCCCGCACCTCAGGATTGG - Intronic
1083694598 11:64434238-64434260 CCTGCCCCCCACCCCACCCTGGG + Intergenic
1083748025 11:64745810-64745832 CCGCCCCCGCACCTCAGTCTTGG + Intergenic
1084755802 11:71237906-71237928 GCTCTACCACACCCCAGCCTGGG - Intronic
1084888570 11:72225275-72225297 CCGCCTCCACCCCCCAGAGTGGG + Intronic
1084892300 11:72242616-72242638 TCTTCCCCAAACCCCAGCCTAGG + Intronic
1084969227 11:72761011-72761033 CTTCCCCCTCATCCCAGAATAGG + Intronic
1085026957 11:73241991-73242013 CCCACCCCACACCCCACACTTGG + Intergenic
1085109166 11:73872604-73872626 CCACCACCACACTCCAGCCTGGG + Intergenic
1085398313 11:76218971-76218993 CCACCCCCATACCTCAGCCTCGG - Intergenic
1085463056 11:76706801-76706823 CGTCCTCCACACCCCAGCCATGG - Intergenic
1085512091 11:77093531-77093553 CCTGCCTCCCACCACAGACTTGG - Intronic
1085515799 11:77111194-77111216 CCTCCTCCTCTCCCCAGACTGGG + Intronic
1085666427 11:78418453-78418475 CCTCCCCCACACACCTGAATTGG - Intergenic
1085785068 11:79441158-79441180 CCGCTCCCTCACCCCAGTCTCGG + Intergenic
1087519439 11:99212353-99212375 CTTCCCCCACAACCCATGCTGGG - Intronic
1088239195 11:107756518-107756540 CCTCCCCAACTCCCCAGAAATGG - Intergenic
1088757354 11:112896946-112896968 CCTCCCCCCCACCCCACAACAGG + Intergenic
1088882102 11:113980440-113980462 TGACCCCCACACCCCAGGCTGGG - Intronic
1088970808 11:114773280-114773302 CCCCCCCCCCACCCCATTCTGGG + Intergenic
1089148517 11:116347321-116347343 GCTCCCCCACCTCCCAGACGGGG - Intergenic
1089223403 11:116894802-116894824 CCATCTCGACACCCCAGACTGGG + Intronic
1089307439 11:117535487-117535509 CCTCACCCACAGCCCCGAGTGGG - Intronic
1089322692 11:117637149-117637171 CCTTCCCGACACCCAAGACTGGG + Intronic
1090195429 11:124812238-124812260 CCTCCCCGACACCCCCCACCCGG - Intergenic
1090332814 11:125944665-125944687 ATTCCCCCACTCCCCAGACTGGG - Intergenic
1090852031 11:130579109-130579131 CCACCCCCACACCCCAGCACAGG - Intergenic
1091638101 12:2213431-2213453 CCTCCTCCTCACCCCAGCCCTGG - Intronic
1091833720 12:3569325-3569347 CCTAGCCCTCACCCCAGACAAGG + Intronic
1092124563 12:6066134-6066156 TCTCCCCCACGCCCCAGCCTAGG + Intronic
1092484814 12:8893398-8893420 GCGCCCCTGCACCCCAGACTGGG - Intergenic
1093426289 12:19032603-19032625 CATCCTCCAGACCCCAGAATGGG - Intergenic
1093652171 12:21657982-21658004 CCTCCCCCACCCTCCAGATGAGG + Intronic
1093687841 12:22076966-22076988 CCTCACCCAGACCCTTGACTGGG - Intronic
1093777131 12:23089099-23089121 CCTCCCCCCCACCCCACAACAGG + Intergenic
1094200877 12:27793497-27793519 GCTCCCCTGCACCCCAGGCTGGG + Intronic
1094526770 12:31236289-31236311 AATCCCCCACAGCCCGGACTCGG + Intergenic
1096069582 12:48767569-48767591 CCTCCCCAACACCAGAGACTTGG + Exonic
1096238718 12:49947848-49947870 CCTTCCCCTCCTCCCAGACTAGG + Intergenic
1096472892 12:51890073-51890095 CCTTCCCCACACACCCCACTGGG + Intronic
1097534868 12:60855928-60855950 CCTCCCCCCCACCCCACAACAGG + Intergenic
1097751176 12:63354573-63354595 CCTCCCCCCCACCCCACAACAGG - Intergenic
1100501732 12:95180938-95180960 TCTCCCCCAACCCCCAGACTTGG + Intronic
1100803661 12:98259083-98259105 CCTGCCCCGTACCCCAGATTGGG + Intergenic
1100831323 12:98518922-98518944 GCGCCACCGCACCCCAGACTGGG - Intronic
1101150724 12:101880088-101880110 CCACCACCACACCACAGACTGGG - Intronic
1101237993 12:102809060-102809082 GCGCCCCCACACTCCAGCCTGGG + Intergenic
1101658683 12:106747110-106747132 CCTCTTCCTAACCCCAGACTAGG - Intronic
1102251225 12:111388836-111388858 CCACCACCACACTCCAGCCTAGG + Intergenic
1102656267 12:114484882-114484904 CGCCCCCCACATCCCAGACAGGG + Intergenic
1103123170 12:118397855-118397877 CCCTCCCCACTCCCCAGTCTTGG + Intronic
1103804265 12:123560190-123560212 TCACCACCACACCCCAGCCTGGG - Intergenic
1103893305 12:124255974-124255996 CCCAGGCCACACCCCAGACTTGG + Intronic
1103978137 12:124717165-124717187 GCTCCCTCACCCCCAAGACTGGG - Intergenic
1104506870 12:129340455-129340477 CCTTCCCCCCACCCCACAATAGG + Intronic
1104839417 12:131814822-131814844 ACTCCACCACACTCCAGCCTGGG - Intergenic
1106034851 13:26034525-26034547 ACTCCACCACACTCCAGCCTGGG - Intergenic
1106171097 13:27289202-27289224 CCTGCCCCAACTCCCAGACTGGG + Intergenic
1107136090 13:36945512-36945534 ACCCCCCCACCCCCCAGATTAGG + Intergenic
1107562665 13:41571961-41571983 CATTCCTCACATCCCAGACTGGG - Intronic
1108410321 13:50139593-50139615 ACTCCACTGCACCCCAGACTGGG - Intronic
1108502891 13:51084433-51084455 CCTCCCCAAGACCCAGGACTAGG - Intergenic
1108692550 13:52872239-52872261 CCTCCCTGACACTCTAGACTGGG + Intergenic
1109003813 13:56842697-56842719 CCTTCCCCCCACCCCACAATAGG + Intergenic
1109057117 13:57564852-57564874 CCTACCCCACAGCCAACACTGGG - Intergenic
1109120594 13:58451504-58451526 CCTCCACTGCACTCCAGACTTGG - Intergenic
1109531196 13:63650260-63650282 CCCTCCCCACCCCCCAAACTGGG - Intergenic
1110130981 13:72010343-72010365 CCTCCCACAAACCCCAAAATAGG - Intergenic
1110499893 13:76214894-76214916 CCTCCCCCCCACCCCACAACAGG + Intergenic
1110789741 13:79574669-79574691 CCTCCCCCCCACCCCACAACAGG - Intergenic
1111950794 13:94707592-94707614 TCTCCCTCTCACCCCAGGCTCGG - Intergenic
1112060482 13:95734968-95734990 CCTCCCCCCCACCCCACAACAGG + Intronic
1112286591 13:98110332-98110354 GCACCCCAGCACCCCAGACTGGG - Intergenic
1112699445 13:101988699-101988721 CCTCCCCCCCACCCCACAACAGG - Intronic
1113589775 13:111490156-111490178 CCTCCCCTGCACTCCAGCCTGGG + Intergenic
1113812233 13:113149827-113149849 CCTCCCCAAGACCCCCCACTTGG + Intergenic
1114594240 14:23898283-23898305 CCCCCCCCACCCCCCAGACGTGG + Intergenic
1114657996 14:24327599-24327621 CTTCCCCCACTCCCCAGTGTTGG + Intronic
1114836179 14:26205117-26205139 CCTCCCAAACGCCCCAGAGTCGG - Intergenic
1114888936 14:26891682-26891704 CCACCACTACACTCCAGACTGGG - Intergenic
1115820849 14:37211186-37211208 ACCCCCCCACCCCCCAGACAAGG + Intronic
1116322575 14:43489390-43489412 CCTCCCCCTCCCCCCACACCAGG - Intergenic
1117397760 14:55327967-55327989 CCACCACCACACTCCAGCCTGGG - Intronic
1118218207 14:63829656-63829678 CCACCACTACACCCCAGCCTGGG - Intergenic
1118350101 14:64967541-64967563 CCACCACCACACTCCAGACTGGG + Intronic
1118615136 14:67569857-67569879 CTTCCCCCACACCCCTTCCTGGG + Intronic
1118778097 14:68986466-68986488 CCTCCCCCACAACACAGCATTGG + Intergenic
1118952843 14:70450066-70450088 CCTCCCCCACCCCACTCACTGGG - Intergenic
1118971938 14:70644186-70644208 CCTGCCCTCCACCCCAGACGTGG + Intronic
1119666461 14:76488631-76488653 CCTTCCCCACCCCCACGACTGGG - Intronic
1119724534 14:76914077-76914099 CCACCCCCACACCCCTGTCCAGG + Intergenic
1119725220 14:76918235-76918257 CCTCACCCTCACCCCAGCCAAGG + Intergenic
1120090697 14:80329731-80329753 CCAGCCCCCCACCCCACACTAGG - Intronic
1121018891 14:90566929-90566951 CCACCTCCTGACCCCAGACTGGG + Intronic
1121133481 14:91472020-91472042 CCGCCACCACACTCCAGCCTGGG + Intronic
1121219814 14:92276985-92277007 CCTGTCCCACACCCCAGCCCAGG - Intergenic
1121264745 14:92593534-92593556 CCTTCCCCCCACCCCACAATAGG - Intronic
1122104383 14:99441190-99441212 CATCCGCCACACCCCACACTGGG - Intronic
1122428064 14:101623177-101623199 CCTCCCCCACTCCCCGCACCTGG - Intergenic
1122616856 14:103024108-103024130 TCTCCCACACACTCCAAACTGGG + Intronic
1122710110 14:103650285-103650307 CCTCCACCACACCCCAGGGTAGG + Intronic
1122737075 14:103848850-103848872 CCTCCGCCACACCCTCGCCTGGG + Intergenic
1123021875 14:105402141-105402163 CCGCCACCACACTCCAGCCTGGG + Intronic
1123676239 15:22712965-22712987 CCTCCCCCCCACCCCACAACAGG + Intergenic
1124141112 15:27077940-27077962 CCTCCCCCAAACCCCCGGCGGGG - Intronic
1124607136 15:31178169-31178191 CCTCCCCCACTCCCCGCCCTGGG + Intergenic
1125536199 15:40442015-40442037 CCCCCGCCACACCTCGGACTCGG - Intronic
1125592754 15:40865016-40865038 GCTCCCTCACTCCCCAGCCTAGG + Intergenic
1125628188 15:41126338-41126360 TCTCTCCTACACTCCAGACTTGG - Intergenic
1125728515 15:41880328-41880350 CCTGACCCTCACCCCAGCCTTGG - Intronic
1125973106 15:43928289-43928311 CCTCACCCCCACCCCAGCCTTGG - Intronic
1127287691 15:57545515-57545537 CCTCCTCCACAGCCTAGGCTGGG + Intronic
1127921491 15:63497889-63497911 CCACCCCCACTCACCAGCCTGGG + Intergenic
1128086915 15:64893119-64893141 AGGCCCCCACACCCCAGGCTGGG + Intronic
1128489700 15:68134577-68134599 CGCCCCCCACCCCCCAGACGGGG + Intronic
1128756769 15:70188498-70188520 CTTCCCTCTCACCCCAGCCTGGG - Intergenic
1129717408 15:77860304-77860326 CCCTCCCCCCACCTCAGACTGGG + Intergenic
1130176065 15:81572368-81572390 CCACACACACACCCCACACTAGG - Intergenic
1130264699 15:82389815-82389837 CCTCCCCCCCACCCCACAACAGG + Intergenic
1131117777 15:89805254-89805276 CCTGCCCCACACCCCAGCCCAGG + Intronic
1131284254 15:91044152-91044174 CCTCACCCCCACCCCCCACTTGG - Intergenic
1131578629 15:93617840-93617862 CCGCCCACATGCCCCAGACTAGG - Intergenic
1132552992 16:560860-560882 TCTGCCCCAGACCCCAGACCCGG - Intronic
1132643295 16:987752-987774 CCTGCCCCTCACCCCACAGTGGG + Intergenic
1132670523 16:1100568-1100590 CCTCCCGCACCCCCCAGGATGGG - Intergenic
1132814624 16:1819840-1819862 CCTCCCCCACGCTCCTGACAGGG + Intronic
1132828155 16:1915052-1915074 CCTGCCCCACACCTCAGGCCTGG + Intronic
1132878202 16:2149477-2149499 CCTCCCCCCAACCTCAGACTTGG + Intronic
1133042476 16:3067877-3067899 GCTCCCACACACCCCGAACTGGG - Intronic
1133527827 16:6623592-6623614 CCTGCCCCACACCCCACAACAGG + Intronic
1133598425 16:7315453-7315475 CCTACCCCCCCCCCCATACTGGG + Intronic
1133754376 16:8751542-8751564 CATACACCACACCCCAGAGTTGG + Intronic
1133838136 16:9384536-9384558 CCTCTCCCAAACCCCACACCCGG - Intergenic
1134008758 16:10835649-10835671 CCTCACCCCCACCCCAACCTAGG + Intergenic
1134441270 16:14301164-14301186 CCACCCCCACACCCCTGCCCAGG - Intergenic
1134584296 16:15396925-15396947 TGTCCCCCACACCCCAGGCCCGG - Intronic
1134803040 16:17103229-17103251 CCTCCCCTGCCCCCAAGACTGGG - Exonic
1134829740 16:17313382-17313404 CCTCCCACACAAGCCAGCCTTGG + Intronic
1135190585 16:20351019-20351041 CCTCACCAACATCCCAGTCTTGG + Intronic
1136191992 16:28622391-28622413 TGTCCCCCACACCCCAGGCCCGG + Intronic
1137064447 16:35825502-35825524 TCTCCCCCACACCCCACAACAGG + Intergenic
1137256194 16:46777659-46777681 GCACCACCACACTCCAGACTGGG - Intronic
1137747916 16:50836785-50836807 CCACCCCTACACCACAGCCTGGG + Intergenic
1137979277 16:53055774-53055796 CATCCCCCACCCCCCACAGTAGG + Intronic
1138037750 16:53625416-53625438 CCCACCCCACCCCCCAGACGGGG - Intronic
1138223680 16:55274624-55274646 CCTCACCCACTCCACAGCCTCGG - Intergenic
1138432407 16:56977493-56977515 CCTCTCCCACCTCCCTGACTAGG + Intronic
1138534419 16:57652461-57652483 GGTTCCCCACACCCCAGGCTGGG + Intronic
1139637508 16:68266975-68266997 GCGCCACCACACCCCAGCCTGGG - Intronic
1139711973 16:68782778-68782800 CCTGCCCCTCACCCCACACAGGG + Intronic
1140479457 16:75254507-75254529 CCACCCCCATCCTCCAGACTGGG - Intronic
1140916205 16:79495418-79495440 ACACCACCACACTCCAGACTAGG + Intergenic
1141093130 16:81144053-81144075 CCTCCCTCACCCTCCTGACTGGG + Intergenic
1141635912 16:85313617-85313639 CCTTCCCCACCCCCCAGCCTAGG - Intergenic
1141691516 16:85599434-85599456 CCTCACCCACATTCCAGATTGGG - Intergenic
1141784066 16:86186831-86186853 CCTCCCCTAAACCCCAGTGTTGG - Intergenic
1141929114 16:87189346-87189368 CTTCCCGCTCTCCCCAGACTGGG - Intronic
1142027401 16:87822023-87822045 CCTCCCCCAAACCCTGAACTGGG + Intergenic
1142154542 16:88527151-88527173 CCTCCCCCACCCCCCCGCCACGG - Intronic
1142261478 16:89044453-89044475 TCTCCCCCAAGCCCCAGACGCGG + Intergenic
1142375132 16:89702569-89702591 CCTACCCCACACCCCCGCTTTGG + Intergenic
1142483057 17:230149-230171 CCTCCTCCACTCCCCAGACCTGG - Intronic
1142613556 17:1122524-1122546 CCTCCTCCAGCCTCCAGACTCGG + Intronic
1142638423 17:1271437-1271459 GCGCCCCCACATCCCAGCCTGGG + Exonic
1142638441 17:1271491-1271513 GCGCCCCCACATCCCAGCCTAGG + Intergenic
1143023641 17:3929089-3929111 CCTTCCTCCCACCCCAGCCTGGG + Intronic
1143204701 17:5133627-5133649 CCACCCCCCCACCCCAGGGTGGG - Intronic
1143277495 17:5722562-5722584 CCACCCCCACACCACTGCCTTGG + Intergenic
1143281035 17:5754167-5754189 CCTCCCCCACCCCCCAGTCCAGG - Intergenic
1143385924 17:6530467-6530489 CCTCCCCCACTCCCCAAGGTGGG - Intronic
1143588582 17:7865785-7865807 CCTCCACTCCACCCTAGACTGGG - Intronic
1144597893 17:16586623-16586645 CCGCCACCACACTCCAGCCTGGG + Intergenic
1144665413 17:17098848-17098870 CCTGCCCCACCCCCCAGCATTGG + Intronic
1144680322 17:17188914-17188936 CTTCCCCTACACCCCAAATTAGG - Exonic
1145994048 17:29095560-29095582 CCACCCGGACACCCCATACTGGG + Intronic
1146456714 17:33014640-33014662 CCTCCCACCCACCACAGCCTGGG - Intronic
1146466105 17:33088027-33088049 CCTTTCCCACACCCCAGAGCAGG + Intronic
1146624943 17:34428030-34428052 CCTCCCTCCCTCCTCAGACTTGG + Intergenic
1147161961 17:38573574-38573596 GCTCCCCCAAGCCCCTGACTTGG + Intronic
1147168426 17:38605194-38605216 CCTCCCCCAGCTCCCAGAATGGG - Intronic
1147253542 17:39167616-39167638 CCACCCCCCAGCCCCAGACTTGG - Intergenic
1147279261 17:39344745-39344767 GCGCCCCTACACCCCAGCCTGGG + Intronic
1147459418 17:40558821-40558843 CCTCCACTAAACCCCTGACTTGG + Intronic
1147513693 17:41096036-41096058 CCTCCCACACACCCCACCCCTGG - Intronic
1147742659 17:42677626-42677648 GCTCCACCGCACCCCAGCCTGGG - Intergenic
1147757809 17:42780252-42780274 CCTCCTGCACACCCCAGATAAGG - Intergenic
1147758442 17:42782741-42782763 CGTCCCCCATCCCACAGACTCGG + Exonic
1147993391 17:44348781-44348803 CCTTCCCCTCACCCCAGAGGTGG + Intronic
1148087770 17:45004761-45004783 CTTCCCCCCCACCCAAGACATGG - Intergenic
1148245349 17:46026554-46026576 CCTCAGCCACCCCTCAGACTGGG + Exonic
1148615118 17:48996049-48996071 CCTCCCCCACCGCCCAGACGGGG + Intergenic
1148746288 17:49920138-49920160 CCTCCCTCTCACCCCTGCCTAGG + Intergenic
1148751233 17:49947007-49947029 CCTCCCTCTCCCCTCAGACTGGG + Intergenic
1148760097 17:49995121-49995143 CCTCCCCCTCCCCCCAGACGCGG - Exonic
1149588679 17:57811228-57811250 CCTCCCACCCACCCCTGACAGGG + Intergenic
1149933523 17:60780335-60780357 GCTCCACCGCACCCCAGTCTGGG - Intronic
1150004828 17:61463131-61463153 CCCCCACCCCACCCCAGAGTGGG + Intronic
1150664641 17:67121561-67121583 CCTTGCCCACACTCCAGAATGGG - Intronic
1151474998 17:74340311-74340333 CCCCTCCCATACCCTAGACTAGG + Intronic
1151556727 17:74850463-74850485 CCTGCCCCACACCCAAGCATGGG + Intronic
1151699782 17:75737081-75737103 CCTCCCCCACTTCCCTGACCTGG - Intronic
1152291143 17:79440874-79440896 TCTTCCCCACACCCCATACGAGG + Intronic
1152597152 17:81243364-81243386 CCACCCCCACCCCCCAGCCCAGG - Intergenic
1155658667 18:28222125-28222147 CCTGCCCCACACCCCACAACAGG + Intergenic
1155922350 18:31616071-31616093 CCTCCTTCACATCCCAGCCTGGG + Intergenic
1157274049 18:46297754-46297776 CCCCCTCCCCACCCCAGGCTGGG + Intergenic
1157632986 18:49118830-49118852 CCTTCACCACAACCCAAACTTGG - Exonic
1157650876 18:49329277-49329299 CCTCCCCCCCACCCCACAACAGG - Intronic
1157860215 18:51134326-51134348 CCTTCCCCACCCCCCAAACTTGG - Intergenic
1159104556 18:63990665-63990687 CCTCCCCCCCACCCCACAACAGG + Intronic
1159546440 18:69844556-69844578 CTGCCCCCACCCCCCAGAATAGG - Exonic
1160025519 18:75212081-75212103 CCTCCCCCACACCCCCAACCTGG + Intronic
1160293511 18:77617011-77617033 CCTCCTGCACACCCCAGGCAGGG - Intergenic
1161993198 19:7697070-7697092 GCTCCTGCACACACCAGACTTGG - Exonic
1161993443 19:7698404-7698426 TCTCTCCCCCTCCCCAGACTGGG - Exonic
1162066529 19:8129148-8129170 CCACCCCCACCCCACAGACGTGG - Exonic
1162301552 19:9847819-9847841 CCTCACCCACACCCAAGAAGAGG - Intronic
1162918017 19:13884674-13884696 CCTCCCCCACCCCACAGAACAGG + Intronic
1162940503 19:14006196-14006218 CCACCCCCACCCCCCAGGCCCGG - Exonic
1163088360 19:14999994-15000016 CCTCCCCCCCACCCCACAACAGG + Intronic
1163258452 19:16172074-16172096 CCAAGCCCACAACCCAGACTGGG + Intronic
1163365453 19:16873520-16873542 CCTCCCCCCCCCCCCAGGCTGGG + Intronic
1163775700 19:19216189-19216211 CCACCACCACACTCCAGCCTGGG - Intronic
1163848603 19:19651147-19651169 CCTTCCCCACACCACAGAGGAGG - Intronic
1164067508 19:21732126-21732148 CCGCCACTACACCCCAGTCTTGG + Intronic
1164846701 19:31438647-31438669 TCTCCCCCATATCCCAGGCTGGG + Intergenic
1164996416 19:32722720-32722742 GCTCCACCACACTCCAGCCTGGG - Intronic
1165739296 19:38196019-38196041 ACTCCCCCACACCCCTGAGCTGG + Intronic
1165898103 19:39155435-39155457 CCTCCCTGCCACCCCAGGCTGGG - Intronic
1165949836 19:39468092-39468114 CCTTCCCCACCCCGGAGACTCGG + Intronic
1166297564 19:41896486-41896508 CCGCCCCTGCACCCCAGCCTGGG - Intronic
1166531471 19:43546000-43546022 CCTCCCCTACACCCAAGGCCAGG + Intronic
1166762257 19:45232297-45232319 ACCCCCAAACACCCCAGACTTGG + Intronic
1166977727 19:46614500-46614522 CCTGAGCCCCACCCCAGACTAGG + Intergenic
1167104099 19:47420262-47420284 CCTCACCCTCAGCCAAGACTTGG + Intergenic
1167169212 19:47820024-47820046 CCTCCCCCAAACCCCCTGCTAGG - Intronic
1167236710 19:48320110-48320132 CCTGCCCCACTGCCCAGGCTTGG + Intronic
1167271382 19:48508469-48508491 CCTTCCCCAGGCCACAGACTAGG - Intronic
1167271928 19:48510841-48510863 CCATCCCCTCACCCCAGGCTTGG + Intronic
1167457746 19:49606551-49606573 CCTCCCCCGCCCCCCAACCTTGG + Intronic
1167517667 19:49932690-49932712 CCTCCCCCAGCCCCCTGTCTTGG + Exonic
1167809503 19:51816022-51816044 GCACCACTACACCCCAGACTGGG + Intronic
1168498286 19:56872517-56872539 ACTCCACCACACTCCAGCCTGGG - Intergenic
927464265 2:23325319-23325341 CCACCACCACACTCCAGCCTGGG + Intergenic
927948351 2:27150664-27150686 CCTTTCCCAGGCCCCAGACTTGG - Intronic
927971281 2:27307466-27307488 CCTTTCCCCCACCCCAGAGTTGG - Exonic
929536213 2:42785977-42785999 CCTCCCCCACTCTCCAAGCTGGG + Intronic
929588378 2:43130219-43130241 CCTCCCTCACATGCCAGGCTTGG + Intergenic
930290430 2:49486313-49486335 CCTCCCCCCCACCCCACAACAGG - Intergenic
930732981 2:54745736-54745758 ACTCCACCACACTCCAGCCTGGG + Intronic
931929942 2:67120841-67120863 CATCCCCCCCACCCCACAATAGG + Intergenic
932434600 2:71695583-71695605 CTTCCCCCACCCCCCAGAGATGG + Intergenic
932862204 2:75305856-75305878 ACTCCCCCCCACCCAAGAATTGG + Intergenic
933066816 2:77808152-77808174 CCTCCCCCACACCACCCAGTGGG - Intergenic
933668338 2:84983367-84983389 ACACCCCCACACTCCAGCCTGGG - Intronic
934128777 2:88926258-88926280 CGCCCCCCACCTCCCAGACTGGG - Intergenic
934585577 2:95490772-95490794 CCACCACCACACTCCAGCCTGGG - Intergenic
934593891 2:95585986-95586008 CCACCACCACACTCCAGCCTGGG + Intergenic
934788887 2:97039696-97039718 CCACCACCACACTCCAGCCTGGG - Intergenic
935151414 2:100440032-100440054 CCGCCTCCACACCTCAGACTTGG + Intergenic
935883166 2:107587160-107587182 CCTCCCCCCCACCCCACAACAGG - Intergenic
936007674 2:108905518-108905540 CCACCCCCACACCCCACCGTAGG - Intronic
936573501 2:113635216-113635238 CCTCCCACAACACCCAGACTTGG - Intronic
937317945 2:120943861-120943883 GGGCCCCCACACCCCAGCCTCGG - Intronic
938057820 2:128230409-128230431 TCCCCCCCACACCCCTGCCTTGG + Intergenic
938066646 2:128285226-128285248 CCTCCACCAGACCCCTGGCTGGG - Intronic
938102164 2:128504638-128504660 CTTGCTCCTCACCCCAGACTAGG + Intergenic
939797119 2:146659168-146659190 TCTCCCCTACCCTCCAGACTTGG - Intergenic
939826710 2:147024150-147024172 CCTCCTCCAGACCTCAGAATGGG - Intergenic
939939745 2:148335336-148335358 CCACCGCCACACTCCAGCCTAGG + Intronic
940250884 2:151675004-151675026 CCTCCCCCACATGCAAAACTAGG + Intronic
940918431 2:159283274-159283296 CATCCCCCACACCCCAGTCCAGG - Intronic
941029517 2:160494254-160494276 CCTCCCACCCACCCCCGACCCGG + Intergenic
941794438 2:169584370-169584392 CCTCCCCCACAACTCAGTCCTGG - Exonic
942879703 2:180844453-180844475 CCTCCCCCAGCCCCCACATTTGG - Intergenic
943557047 2:189418867-189418889 ACTCCCCCAATTCCCAGACTTGG - Intergenic
944508622 2:200442088-200442110 CCTCCCCCCAACCCCAGTCATGG + Intronic
944692831 2:202173090-202173112 ACTCCTACACAGCCCAGACTGGG + Intronic
945968749 2:216216330-216216352 CCTCCTCCAAACCCAAGGCTAGG + Intergenic
946068990 2:217014983-217015005 CCTCCCACACTCTCCAGACATGG + Intergenic
946306892 2:218861126-218861148 CCTCCCTCGCCCCCCAGATTTGG + Intronic
947323489 2:228948824-228948846 CCTCCCCCCCACCCCACAACAGG - Intronic
947670518 2:231932812-231932834 CCTCCCCCACACTCCATTCTTGG + Intergenic
948684294 2:239660323-239660345 CCCCGCCCGCCCCCCAGACTAGG + Intergenic
1168846318 20:947051-947073 CCTCCTCCACAGCCCAGGGTTGG + Intergenic
1170247356 20:14237691-14237713 CCTCCCCCCCACCCCAAAACAGG + Intronic
1170404348 20:16020401-16020423 CCTCCCCTCCACCCAAGACAGGG + Intronic
1170525201 20:17229027-17229049 ACTCCCCCCCACCCCAAACTTGG + Intronic
1170570144 20:17628060-17628082 CCTCCCCCACCTCCCTGGCTGGG + Intronic
1170932286 20:20779944-20779966 CATCCCCTGCACCCCAAACTGGG + Intergenic
1171392861 20:24812255-24812277 CCTGCCCCATACCCCAGGCTGGG + Intergenic
1171903824 20:30883022-30883044 CCCCCCCCACACCCCACAACAGG + Intergenic
1171993295 20:31713209-31713231 CCTCCCTCACAGCCTAGCCTAGG + Intronic
1172058588 20:32172712-32172734 CCGCCACTGCACCCCAGACTGGG - Intergenic
1172097196 20:32466321-32466343 CCTCCCCAGCATCCCAGACAAGG + Intronic
1172143896 20:32743235-32743257 CGTCCCCCCCACCCCAGGCCCGG + Intronic
1172247229 20:33454043-33454065 CCACCACCACACTCCAGCCTGGG + Intergenic
1172414719 20:34755776-34755798 GCTCCACCACACTCCAGCCTGGG - Intronic
1172457856 20:35092244-35092266 CCTCCCCCACGCCCAATACACGG + Intronic
1173146592 20:40529854-40529876 CCTCAACCACCCCCCTGACTAGG + Intergenic
1173656841 20:44705275-44705297 CCTCCTCCACCTCCCAGGCTGGG + Intergenic
1173667498 20:44773491-44773513 CCCCCCCCACACCCCACACTAGG + Intronic
1173795690 20:45857801-45857823 CCGCCCCCACAACCCACACTAGG - Exonic
1174222006 20:48963523-48963545 CCTCCCCACCACCCCCAACTTGG - Intronic
1174421003 20:50399176-50399198 CCTCCCCCACAGCCCTGCTTGGG + Intergenic
1174487767 20:50871895-50871917 CCTCCCCCACAGCTCAGGCTGGG - Intronic
1174629714 20:51945744-51945766 GCACCACCACACCCCAGCCTTGG - Intergenic
1175007681 20:55702782-55702804 TCTCCACCACACTCCAGCCTGGG - Intergenic
1175413234 20:58785121-58785143 CCTCCCCCAAAACCCAGGCGAGG - Intergenic
1175748892 20:61481208-61481230 CCTCCCCCACGCCCCAGCTGTGG - Intronic
1175804177 20:61818266-61818288 CCTCCCCCACACCCCAGCAAGGG - Intronic
1176083794 20:63286749-63286771 CCTCCCTCCCACCCTAGCCTGGG - Intronic
1176310233 21:5145448-5145470 CCTCCCCCACAGCCCAGACGCGG + Intronic
1176411500 21:6451685-6451707 CTTCCCCCAAACTCCAGATTGGG - Intergenic
1177836600 21:26192082-26192104 GCTCCACCACACTCCAGTCTAGG - Intergenic
1178707288 21:34886690-34886712 CATCCCCCACATCCCAAGCTAGG + Intronic
1179541042 21:42083447-42083469 CCCCCACCACACCCCACACCAGG + Intronic
1179686994 21:43060007-43060029 CTTCCCCCAAACTCCAGATTGGG - Intronic
1179846823 21:44116587-44116609 CTCCCCCCACAGCCCAGACGCGG - Intronic
1180060958 21:45384804-45384826 CCTCCCCGAGACCCCAGTCAGGG - Intergenic
1180147224 21:45928330-45928352 CCTGCCCCCCAGCCCAGACCTGG + Intronic
1180537767 22:16410065-16410087 ACTCCCCCGCACTCCAGCCTGGG - Intergenic
1180594918 22:16966796-16966818 CCTCCCCCATGCAGCAGACTGGG - Intronic
1181981357 22:26769100-26769122 CCGCCCACACATCCCAGCCTGGG - Intergenic
1182058868 22:27382437-27382459 CCTTCCCCCAACCCCAGGCTGGG + Intergenic
1183334737 22:37240146-37240168 CCAACCCCCAACCCCAGACTTGG - Intronic
1183408146 22:37640331-37640353 CCTCCCCCTCCCCCCAGCCCAGG + Intronic
1184246894 22:43240429-43240451 CCTCCCTGATACCCCAGACACGG + Intronic
1184301250 22:43562526-43562548 CCTCCCTCCCACCCCTGACCGGG - Intronic
1184301258 22:43562552-43562574 CCTCCCTCCCACCTCTGACTGGG - Intronic
1184301282 22:43562605-43562627 CCTCCCTCCCACCCCTGACCTGG - Intronic
1184301315 22:43562684-43562706 CCTCCCTCCCACCCCTGACCTGG - Intronic
1184301348 22:43562763-43562785 CCTCCCTCCCACCCCTGACCTGG - Intronic
1184369035 22:44070959-44070981 CCTGCCCTAGACCCCAGACCAGG + Intronic
1184388798 22:44191268-44191290 CCCCCACCCCACCCCAGCCTCGG + Intronic
1184475035 22:44715693-44715715 GCACCCCCACACTCCAGCCTGGG - Intronic
1185426681 22:50775664-50775686 CCTCCCACAACACCCAGACTTGG + Intronic
949128895 3:477784-477806 CCTCACACCCACCCCAGAGTTGG - Intergenic
949405040 3:3705396-3705418 CCTCCCCCGCTCCCCTGTCTTGG - Intronic
950007330 3:9699748-9699770 CCTGCCCCACCCCCCTGACATGG - Intronic
950826297 3:15825449-15825471 CCTCCCCCACCGCCCCGAATTGG - Intronic
951264150 3:20547878-20547900 GCCCCCCCACCCCCCAGACGGGG + Intergenic
951489141 3:23249227-23249249 GCACCACCACACCCCAGCCTGGG + Intronic
951526484 3:23657681-23657703 TCTCCACCACACCCCAGTATGGG + Intergenic
952232667 3:31447998-31448020 CCTCCCCCACACCCCTACCTAGG - Intergenic
952290323 3:32008715-32008737 ACTCCACCACACTCCAGCCTGGG + Intronic
952478763 3:33737963-33737985 CCTCACCCTAATCCCAGACTTGG + Intergenic
953376001 3:42429038-42429060 CCTCCCCCACCTCCCCCACTAGG - Intergenic
953463324 3:43098816-43098838 CCTGCCCCACACTCAAGCCTTGG - Intronic
954083126 3:48224106-48224128 CCTTGCCCCCACCCCAGAGTGGG + Intronic
954115199 3:48463223-48463245 CCTCCTGCACACCCCACAGTAGG + Intronic
954138030 3:48591235-48591257 CCTGCCCCACACCCCATCCACGG - Intronic
954405037 3:50340892-50340914 CCTCCCCCAGGATCCAGACTGGG + Intronic
954435234 3:50492443-50492465 GCTCCCCCAAACCCCAGGTTTGG + Intronic
954697920 3:52437293-52437315 CATCACCCACCCCTCAGACTGGG + Intronic
955203973 3:56878417-56878439 CCTCACCCAATCCCCTGACTGGG - Intronic
955235111 3:57132141-57132163 ACACCACCACACTCCAGACTGGG + Intronic
955605248 3:60694907-60694929 CCACCCCCACACCCCACAACAGG - Intronic
956035056 3:65081517-65081539 CCTGCCCCACCTCCCAGCCTGGG + Intergenic
956189639 3:66596432-66596454 CCCCACCCACACCCCAGACTAGG - Intergenic
956600649 3:71018483-71018505 GCACCCCCACACCCCAACCTAGG + Intronic
956778462 3:72586085-72586107 CCACCCCCACTCCCCAGGCTGGG - Intergenic
956861910 3:73332995-73333017 CCTCCCCCCCACCCCACAACAGG + Intergenic
958186377 3:90125260-90125282 CCTCCCCCCCACCCCATAACAGG - Intergenic
959108810 3:102097151-102097173 CCTCCCCCTCACCCCAGCCCAGG - Intergenic
959969124 3:112389033-112389055 TCTCCCCCACCCCCCAAAATGGG - Intergenic
960661913 3:120069513-120069535 TGTCCCCCACACCCCCAACTGGG - Intronic
960940332 3:122929046-122929068 CCTCCCCCAGGCCACAGAGTGGG - Exonic
961136877 3:124519542-124519564 CCTCCCCCATAACCCAGCCAGGG - Exonic
961653014 3:128426660-128426682 CCTCCCCCACACCGTGCACTGGG - Intergenic
961815089 3:129545592-129545614 CCACCCCCACTCCCCAGCCCTGG + Intronic
962364947 3:134772676-134772698 CCTCTGCCACACCCCAGAGTAGG + Intronic
962900246 3:139755558-139755580 CCTCCTCCCCATACCAGACTAGG - Intergenic
963043252 3:141084315-141084337 CCTCCCCCACACCCCTCTCCTGG + Intronic
963249726 3:143092051-143092073 GCACCACCACACCCCAGCCTGGG + Intergenic
964144845 3:153447294-153447316 CCTCCCCCCCACCCCACAACAGG - Intergenic
964445363 3:156752399-156752421 CCACCACCACACTCCAGCCTGGG - Intergenic
964770620 3:160221194-160221216 CCACCTCCACACCCCAGACTCGG - Intergenic
965083444 3:164064879-164064901 CATCCTCCAAACCCCAGAATGGG + Intergenic
966139089 3:176734343-176734365 CCTCCCCCACATTCCCGTCTGGG - Intergenic
967269843 3:187724575-187724597 CCTCCTGGACACCCCATACTGGG - Intronic
967893309 3:194378649-194378671 CCTCCCCCAGAGCCCAGTCATGG + Intergenic
968156579 3:196385777-196385799 CCCCCCCCACTTCCCAGACGGGG - Intronic
968466834 4:756253-756275 GCACCCCCACACTCCAGCCTGGG - Intronic
969902673 4:10364237-10364259 CCCCCCCCCCCCCCCATACTAGG + Intergenic
972362313 4:38338536-38338558 GCACCCACACACCCCAGCCTGGG - Intergenic
972468914 4:39384940-39384962 CCTCCCCCACCCCCCAGCAGCGG - Intergenic
972557495 4:40195502-40195524 CCACCACCACACTCCAGCCTGGG - Intronic
973093668 4:46169906-46169928 CCTCCCCCTCACCCCACAGCAGG - Intergenic
974254660 4:59433216-59433238 CCTTCCCCACACCCCACAACAGG - Intergenic
974296879 4:60011738-60011760 CCCCCCCCCCACCCCACAATAGG - Intergenic
974597936 4:64037524-64037546 GCCCCCCCACCCCCCAGACGGGG - Intergenic
976233771 4:82873311-82873333 GCGCCCCTACACTCCAGACTGGG + Intronic
976269061 4:83212418-83212440 CCACACCCACACCTCAGCCTAGG - Intergenic
977211081 4:94218852-94218874 CCACCACCACACTCCAGCCTGGG - Intronic
977616260 4:99089987-99090009 GCTCCCCTAAACTCCAGACTTGG + Intergenic
979263583 4:118675497-118675519 CCTTCCCCACACTCCAAACCTGG + Intergenic
979410575 4:120373526-120373548 CCGCCACCGCACTCCAGACTGGG - Intergenic
981732510 4:147914398-147914420 CCACCACCACACTCCAGCCTGGG - Intronic
982830534 4:160054183-160054205 GCTCCACCGCACTCCAGACTGGG + Intergenic
983613719 4:169679039-169679061 CGCCCCCCACCTCCCAGACTGGG + Intronic
984995849 4:185429174-185429196 TCTCCCCCACCCCGCAGAGTAGG + Intronic
985469834 5:33374-33396 CCTTCCCCACCCCCCACACCAGG + Intergenic
985513444 5:324894-324916 CCTCCCCCACACCGCCCACAGGG + Intronic
985657316 5:1139055-1139077 CCCCCCCCCCACCCCAAGCTTGG - Intergenic
985747554 5:1655703-1655725 CCCTCCCCACACCTCAGAATGGG + Intergenic
986064435 5:4221991-4222013 CCACCACCGCACCCCAGCCTGGG + Intergenic
986629142 5:9752696-9752718 CCTTCCCCCCACCCCACAATAGG + Intergenic
986800099 5:11250558-11250580 CCACCACCACACCCCAACCTAGG - Intronic
986869199 5:12027762-12027784 CATCCTCCAGACCCCAGAATGGG - Intergenic
988692640 5:33588248-33588270 CCTCCCACACACCCCAAAAGTGG - Intronic
989143450 5:38224757-38224779 CCTCCCCCCCACCCCACAACAGG - Intergenic
989387643 5:40869184-40869206 CCACCACCACACTCCAGCCTAGG - Intergenic
989408176 5:41085721-41085743 GCACCCCCGCACCCCAGCCTGGG - Intergenic
989628843 5:43460606-43460628 CCTCCCCTACACCCCAGAAGTGG + Intronic
989940795 5:50147329-50147351 GCTCCCCCATGCTCCAGACTGGG - Intergenic
989978368 5:50612182-50612204 CCTCCCCCCCACCCCAGAATAGG - Intergenic
991060070 5:62365048-62365070 GCGCCACCACACCCCAGCCTGGG + Intronic
991135785 5:63180314-63180336 GCTCCACCGCACCCCAGCCTGGG + Intergenic
992415846 5:76551237-76551259 CATCCCTCACATCCCAGACGGGG + Intronic
993309732 5:86314096-86314118 CCTCCTCCAGACCCCAGAATGGG + Intergenic
993386784 5:87270350-87270372 CCTTCCCCCCACCCCAGAGATGG + Intronic
993702591 5:91135862-91135884 CCTCCCCACCACCCCATACTGGG - Intronic
993782560 5:92086637-92086659 CCGCCACCGCACTCCAGACTGGG - Intergenic
994369836 5:98955441-98955463 CCTCCCCCCCACCCCACAACAGG + Intergenic
994526232 5:100908427-100908449 CCTCCCCCCCACCCCACAACAGG + Intergenic
995373276 5:111444687-111444709 CCTCCCCAACCCCCCTTACTTGG + Intronic
995431902 5:112088742-112088764 CCTCCCCCCCACCCCACAACAGG + Intergenic
995720275 5:115123238-115123260 CCTCCCCCACACCCCACAACAGG - Intergenic
997468092 5:134101514-134101536 CCACCACCACACTCCAGCCTGGG + Intergenic
997543451 5:134684258-134684280 GCGCCACCACACCCCAGCCTGGG + Intronic
997588114 5:135056231-135056253 CCTCACCCTCACCCCCGTCTTGG + Intronic
997936867 5:138119977-138119999 ACACCACCACACTCCAGACTGGG - Intronic
998266661 5:140672193-140672215 CCACCCCCACACCGCAAAATAGG - Exonic
1000717798 5:164668315-164668337 CCACCCCCCCACCCCAGCCTTGG + Intergenic
1001575851 5:172763338-172763360 CCTCCGCCCCACCCCACACGAGG + Intergenic
1001596341 5:172901236-172901258 CCTCCCCCTCACCCCCCACCAGG - Intronic
1001699446 5:173696100-173696122 CCTCCCCCCCACCACACACCTGG - Intergenic
1001761522 5:174211878-174211900 CCTCACTCTCACCCCAGTCTGGG + Intronic
1001799332 5:174529694-174529716 CCTCCTCCACTCCCCAAACTTGG + Intergenic
1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG + Intronic
1002588623 5:180270804-180270826 CCTCCACTGCACCCCAGCCTGGG + Intronic
1002924979 6:1600460-1600482 CCTCCACTACACTCCAGCCTGGG + Intergenic
1003317891 6:5027993-5028015 CCTCCCCCATCCCCCAGAGACGG + Intergenic
1003785745 6:9485123-9485145 ACACACACACACCCCAGACTAGG - Intergenic
1004927790 6:20432263-20432285 CCTCCCCAAGGCCCCAGAGTAGG - Intronic
1005177637 6:23064809-23064831 CCTCCCCCCCACCCCACAACAGG - Intergenic
1005725274 6:28641503-28641525 CCTCCCCCACCCCTCTGACCTGG - Intergenic
1006379119 6:33687578-33687600 CCCCACCCCCACCCCAGTCTCGG - Intronic
1006390928 6:33758030-33758052 CCTCCACCACTCTCCAGAATTGG - Intergenic
1006410481 6:33870703-33870725 CCTCACCCACACCCCATACTGGG - Intergenic
1006670410 6:35726805-35726827 CATCCCCCACAGGCCAGGCTTGG - Intronic
1006810821 6:36819499-36819521 CTGCCCCCAGTCCCCAGACTTGG - Intronic
1006831389 6:36970348-36970370 TCTCCCCCACCCCACAGCCTTGG + Intronic
1007073311 6:39051517-39051539 CCTGCCCCAGCCCCCAGCCTGGG - Intronic
1007176545 6:39901533-39901555 CCTCCCACACACCCCAGTTTGGG - Intronic
1007575979 6:42925462-42925484 GCTCACCCAGACCCCAGCCTCGG + Exonic
1007706644 6:43795282-43795304 CCTTCCCCAGTCCCCAGAATGGG - Intergenic
1007965716 6:46001999-46002021 CCACCCCCACCCCCCACACCAGG + Intronic
1008767261 6:54933899-54933921 TTTCCCCCAGCCCCCAGACTGGG - Intronic
1008909881 6:56721065-56721087 CCCCCCCCACCTCCCAGACGGGG + Intronic
1008956859 6:57224934-57224956 CCTCCTCCCCATCCCACACTAGG + Intergenic
1009485787 6:64220024-64220046 CCTCCCCCTCACCCCACAATAGG - Intronic
1009940033 6:70280763-70280785 CCCACCACACACCCCAGGCTGGG + Intronic
1010608960 6:77928978-77929000 CCCCTCCCACACCCCACAATAGG - Intergenic
1010877301 6:81123396-81123418 CCTCCCCCCCACCCCACAACAGG + Intergenic
1011005367 6:82638315-82638337 CTTCCCCCACTCCCCATCCTCGG - Intergenic
1011087043 6:83552456-83552478 CCTCCCCCCCACCCCACAACAGG - Intergenic
1011545773 6:88480046-88480068 CCCACCCTACACCCCAGTCTGGG - Intergenic
1011640028 6:89410050-89410072 GCTTCCCCAGAGCCCAGACTTGG - Intronic
1012473045 6:99591451-99591473 CAGCCCCCAGTCCCCAGACTAGG + Intergenic
1013242029 6:108255143-108255165 CCTCCCCCACTCTCCATTCTGGG + Intronic
1014973450 6:127848067-127848089 CCTCCCCCCCACCCCACAACAGG + Intronic
1015181184 6:130364877-130364899 TCTCCCCCACCCCCCAAACACGG + Intronic
1015300394 6:131646546-131646568 CCTGCCTCCCACTCCAGACTAGG - Intronic
1017072540 6:150588467-150588489 CCACCACTACACCCCAGCCTGGG + Intergenic
1017196111 6:151702240-151702262 CCTCACCCACACAGTAGACTTGG - Intronic
1018536752 6:164828481-164828503 ACTCCACCACACTCCAGCCTGGG - Intergenic
1018715291 6:166527711-166527733 CCTCTCTCACCCCCCAGCCTAGG + Intronic
1018833901 6:167469228-167469250 CCTCCCCCACTCCACGGAATGGG + Intergenic
1019340476 7:506674-506696 TCTCCCCCAGACCCAAGCCTCGG - Intronic
1019503194 7:1375829-1375851 ACTCCACCACACTCCAGCCTGGG - Intergenic
1019631651 7:2052837-2052859 CCTCCCCCATGCTCCAGGCTGGG - Intronic
1019726298 7:2604704-2604726 GCTCCCACTCACCCCAGTCTGGG - Intronic
1019830432 7:3322850-3322872 ACACCACCACACCCCAGCCTGGG - Intronic
1020080637 7:5284034-5284056 CCCCCCCCCCACCCCCGACTTGG + Intronic
1022095574 7:27139299-27139321 CCTCCCCCGCACCCGGGACCAGG - Intronic
1022185290 7:27961421-27961443 ACTCACCCACACACCAGCCTTGG - Intronic
1022996041 7:35756531-35756553 GCTGCCCCACACTCCAGCCTGGG + Intergenic
1023659782 7:42459899-42459921 GCTCCACCACACTCCAGCCTGGG - Intergenic
1023732633 7:43206637-43206659 CCTCCCCCACCTCCCATACTGGG + Intronic
1023978909 7:45054555-45054577 CCTACCCCACCCCCTAGACAAGG + Intronic
1024984058 7:55180739-55180761 CCTTCCCCACAGGCCAGGCTTGG - Intronic
1026984473 7:74546262-74546284 GCGCCACCACACCCCAGCCTGGG - Intronic
1027300369 7:76827744-76827766 CATCCTCCAGACCCCAGAGTGGG - Intergenic
1027534414 7:79379109-79379131 CCTCCCCCCCACCCCACAATAGG + Intronic
1027967938 7:85038039-85038061 CCTCCCCCCCACCCCACAACAGG - Intronic
1028406012 7:90474727-90474749 CCTCACCCACACCACAGAGGTGG + Intronic
1028471797 7:91213884-91213906 CCTCCCCCCCACCCCACAACAGG + Intergenic
1029045979 7:97629224-97629246 CCTCCCCCCCACCCCACAACAGG - Intergenic
1029146832 7:98452383-98452405 CCTACCCCACCCCACAGACTGGG - Intergenic
1029241824 7:99168551-99168573 CTGCCACCACACCCCAGCCTGGG - Intergenic
1030354838 7:108530455-108530477 CCTTCCCAACACCACAGGCTGGG - Intronic
1030365144 7:108637337-108637359 CCTCACTCCCACCCCACACTGGG - Intergenic
1030986164 7:116244619-116244641 CATCCTCCAGACCCCAGAATGGG - Intronic
1031171906 7:118302769-118302791 CCTCCCCCACACCCCACCACAGG + Intergenic
1031443568 7:121823422-121823444 GCTCCCTCAAACCCCAGACCTGG - Intergenic
1031610737 7:123824306-123824328 TCTTCCCCACACACCAGGCTTGG + Intergenic
1032057901 7:128698290-128698312 TCTTGCCCACACCCCACACTGGG + Intergenic
1032266616 7:130374231-130374253 CCTGCCCCACATCTCAAACTCGG + Intergenic
1032540120 7:132695876-132695898 CCCTCCCCACACCCCACAATAGG - Intronic
1033660350 7:143398240-143398262 CCCAACCCACACCCCAGGCTAGG + Intronic
1034411117 7:150942681-150942703 CCTCACCCACTCTCCAGCCTTGG + Intergenic
1034710349 7:153185654-153185676 CATCCTCCAGACCCCAGAATTGG - Intergenic
1035255486 7:157623245-157623267 CTTCCCTCACACACCAGATTTGG - Intronic
1035596702 8:863922-863944 CCTTCCCCACAGCCCAGAAACGG + Intergenic
1036475244 8:9087286-9087308 GCTCCACTACACTCCAGACTGGG - Intronic
1037529713 8:19760610-19760632 ACACCCCCACACTCCAGCCTGGG + Intergenic
1037834537 8:22208388-22208410 CCTGCCCCCCACCCCATACTAGG + Intronic
1037839256 8:22232311-22232333 CCTCCAACACACCCCCTACTTGG + Exonic
1038195157 8:25360417-25360439 CACCCCCCACCCCCCATACTGGG - Intronic
1039009462 8:33076580-33076602 ACTCTCCCGCTCCCCAGACTGGG + Intergenic
1039990076 8:42480065-42480087 CCTTAGCCACACCCCTGACTGGG - Intronic
1040439169 8:47423252-47423274 ACGCCACCACACTCCAGACTAGG + Intronic
1040908873 8:52497950-52497972 CCTCCCCCACCCCCCAGGTGGGG - Intergenic
1041279392 8:56195951-56195973 CCTCCCACACCCGCGAGACTAGG - Intronic
1041491817 8:58441102-58441124 CCTACCCCACTCTCCTGACTGGG + Intronic
1041664406 8:60428795-60428817 TCTCTCCCACAACCCAGACTCGG + Intergenic
1041777458 8:61539196-61539218 ACTCCACTGCACCCCAGACTGGG + Intronic
1041901257 8:62985522-62985544 CCTCCACCACAACCCAGCCAGGG + Intronic
1043136789 8:76537466-76537488 CCTTCCCCCCACCCAATACTGGG - Intergenic
1044024723 8:87154745-87154767 CCTCCTCCACCACCCAGTCTAGG - Intronic
1044090391 8:87992947-87992969 GCTCCACCACACTCCAGCCTGGG + Intergenic
1044214509 8:89593164-89593186 CCTTAACCCCACCCCAGACTAGG + Intergenic
1044989949 8:97786993-97787015 ACACCCCCACCCCCCAGCCTGGG - Intronic
1045021858 8:98051697-98051719 GCCCCCCCACCTCCCAGACTGGG + Intergenic
1045100763 8:98841637-98841659 CCTCCACTGCACCCCAGTCTGGG + Intronic
1045108564 8:98917873-98917895 CCTCCCACACTCCCCAGAGATGG - Intronic
1045254363 8:100507394-100507416 CCACCACCACACTCCAGCCTGGG - Intergenic
1045662903 8:104456549-104456571 CCTCTCCTCAACCCCAGACTGGG + Intronic
1046025006 8:108711877-108711899 TCTCACCCATACCCTAGACTTGG - Intronic
1046198038 8:110888867-110888889 CTTCCCCCATACCCCACCCTAGG + Intergenic
1046495602 8:115010107-115010129 CATCCTCCAAACCCCAGAATGGG - Intergenic
1046638061 8:116695109-116695131 GCTCCACCACACTCCAGCCTGGG - Intronic
1048449798 8:134523367-134523389 CCTGCCCCAAACTCCAGCCTGGG + Intronic
1048837784 8:138537624-138537646 CCTCCCCCCCACCCCACAACAGG - Intergenic
1049197669 8:141324543-141324565 CCTCCACCACACCCCACTCATGG - Intergenic
1049235004 8:141508037-141508059 CCTCGTCCTCACCCTAGACTCGG - Intergenic
1049327862 8:142033159-142033181 CCGCCCCCTCACCCCAAACATGG - Intergenic
1049554185 8:143274050-143274072 CCCCCCTCCCACCCAAGACTTGG - Intronic
1051235883 9:14998257-14998279 CCCTCCCCACACCCCACACCAGG - Intergenic
1051249542 9:15145625-15145647 CCTCACCCCCACCCCAGCCTGGG + Intergenic
1051855394 9:21559559-21559581 CGCCCCCCGCACCCCAGACCAGG + Intergenic
1052044877 9:23782527-23782549 CTGCCACCACACTCCAGACTGGG + Intronic
1052476722 9:28970519-28970541 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1052558475 9:30051733-30051755 CCGCCTCTACACCCCAGCCTGGG - Intergenic
1053139607 9:35674411-35674433 CCCCTCCCATACCCCAGCCTAGG + Intronic
1053377489 9:37619961-37619983 CCTCCCCCACATCCTGGAGTTGG + Intronic
1053455040 9:38227182-38227204 CCTCCCCCACACCCACAACCTGG - Intergenic
1053551868 9:39089211-39089233 TCTCCCCAACACCCCAGCCTAGG + Intronic
1053815999 9:41909349-41909371 TCTCCCCAACACCCCAGCCTAGG + Intronic
1054614598 9:67278092-67278114 TCTCCCCAACACCCCAGCCTAGG - Intergenic
1054870590 9:70044379-70044401 CCCCACCCCCACCCCAGGCTTGG - Intronic
1055875639 9:80938685-80938707 TCTCCCACACACCCCATATTTGG - Intergenic
1056229169 9:84526851-84526873 CGCCCCCCACATCCCAGACAGGG + Intergenic
1056514537 9:87337580-87337602 CCTCCCCCCCACACTAAACTGGG - Intergenic
1056575837 9:87855707-87855729 CCTGCCCCTCAGCCCACACTTGG - Intergenic
1056851980 9:90092834-90092856 CCTGCCCCGCAGCCCAGCCTAGG + Intergenic
1057219775 9:93250825-93250847 GCGCCACCACACTCCAGACTGGG - Intronic
1057313865 9:93956985-93957007 CCACCCCCACTCCCGAGTCTGGG - Intergenic
1057367672 9:94438438-94438460 CCTCCCCCACACATCAGACAGGG - Exonic
1057486263 9:95486874-95486896 GCTCCCCCACTCCACAGTCTAGG + Intronic
1057655657 9:96949623-96949645 CCTCCCCCACACATCAGACAGGG + Exonic
1057674781 9:97130391-97130413 CGCCCCCCACATCCCAGACGGGG + Intergenic
1057674843 9:97130559-97130581 CCCCCCCCACCTCCCAGACGGGG + Intergenic
1058432150 9:104928690-104928712 CCTTCCCCTCACCCCAGCCTAGG - Intergenic
1058857369 9:109076373-109076395 CCTCCCCCCCACCCCACAGTGGG - Intronic
1058873000 9:109218620-109218642 CCTCCCCCCGCCCCCAGTCTTGG + Intronic
1059084598 9:111286522-111286544 CCGCCACCACACTCCAGCCTGGG + Intergenic
1059438414 9:114289685-114289707 CTTCCCCCAGCCCCCAGACTGGG + Intronic
1059482264 9:114600686-114600708 CGTCCTCCAGACCCCAGAATGGG - Intergenic
1060080191 9:120636841-120636863 GCCCCCCCACCCCCCAGACGGGG - Intronic
1060415010 9:123424016-123424038 CCACCCCCTCTCCCCAGCCTAGG - Intronic
1060610460 9:124959683-124959705 CATCCCCCCCACCCCACAATAGG + Intronic
1061014876 9:127975843-127975865 GCTCCCCGACTCACCAGACTTGG + Intronic
1061113628 9:128593739-128593761 CCCCCACCTCACCCCAGCCTGGG + Intronic
1061187009 9:129060668-129060690 CCTTCACCCCACCCCAGGCTTGG - Intronic
1061420814 9:130472090-130472112 CCTCCCCCACCTCCCACAGTGGG - Intronic
1061484364 9:130912887-130912909 CCCCCCACACACCCCAGGCTTGG + Intronic
1061860784 9:133467846-133467868 CCTTCCCCGCTTCCCAGACTCGG - Intronic
1062322623 9:135997886-135997908 CCTCCTGCACACTCCAGCCTGGG + Intergenic
1062338574 9:136083346-136083368 CCTCCCCCCCAACCCAGCCTGGG - Intronic
1062521554 9:136959978-136960000 CCACCCCAGCACCCCAGACCAGG + Intergenic
1185479560 X:435792-435814 CCTCACCCACACCCGGGACCTGG - Intergenic
1185615345 X:1418662-1418684 CCTCCACCCCACCCCAGCCCTGG - Intronic
1185755619 X:2650845-2650867 CCCACTCCAGACCCCAGACTGGG + Intergenic
1185778908 X:2829126-2829148 CCTCCCCCAGCCCCCAGCCTCGG - Intronic
1186567122 X:10675383-10675405 CCTCCCCCATCCCCAAGACAGGG - Intronic
1188137193 X:26504846-26504868 CCGCCCCCACTCCCCAGAGTGGG + Intergenic
1188242859 X:27810462-27810484 TTTCCCCCACAGCCCACACTGGG - Intronic
1189297576 X:39929855-39929877 CTTCCCCCACCCCCCAGCCCCGG + Intergenic
1189327174 X:40119935-40119957 CCTCCCCCAACCCCCCAACTTGG - Intronic
1189480596 X:41389654-41389676 CCCCCCCCACCCCCCAACCTGGG + Intergenic
1190106575 X:47565145-47565167 CCCCCCACCCACCCCAGGCTGGG - Intronic
1190874601 X:54450643-54450665 CCTCACCCAAACTTCAGACTGGG - Intronic
1192011005 X:67272400-67272422 CCTCCCCCCCACCCCACAACAGG - Intergenic
1192173624 X:68872371-68872393 CCACAGCCACACCCCAGCCTGGG - Intergenic
1192351396 X:70359779-70359801 CCTCCCTCACAACCCAGGGTGGG - Intronic
1192712997 X:73611167-73611189 CCTCTCCCACACCCCACAACAGG + Intronic
1193539578 X:82754933-82754955 GCGCCACCACACCCCAGCCTGGG + Intergenic
1194247585 X:91534936-91534958 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1194714553 X:97275230-97275252 CCCCCCCCACCTCCCAGACGGGG + Intronic
1194998996 X:100623891-100623913 CCTTCCCCACACCCCACAACAGG + Intergenic
1196186292 X:112748140-112748162 CCGCCACCACACTCCAGCCTGGG + Intergenic
1196459073 X:115911494-115911516 CCTCACCCTCTCCCCATACTGGG - Intergenic
1196483911 X:116181913-116181935 TCTCCTCCACACCCCAGTCCAGG - Intergenic
1196939315 X:120760033-120760055 CCTCTCCCTCACAGCAGACTTGG - Intergenic
1197181075 X:123538062-123538084 CCCCTCCCCCACCCCAGATTTGG + Intergenic
1197282671 X:124555305-124555327 CCTCTCTCACCACCCAGACTAGG + Intronic
1197502507 X:127259678-127259700 CCTTTCCCACACCCCAGTCAGGG + Intergenic
1197953020 X:131918341-131918363 CCTCCCCCACTCCCCAGAAGTGG + Intergenic
1198122326 X:133606462-133606484 ACTCCACCACACTCCAGCCTGGG - Intronic
1198178124 X:134175053-134175075 CCTCCCCCAGACCACAGCCCAGG + Intergenic
1198393372 X:136198811-136198833 CCCCCTCCACACCCCAAACCTGG - Intronic
1198652095 X:138873996-138874018 CCTCCCCCCCACCCCACAACAGG - Intronic
1199139013 X:144288013-144288035 CCTCCCCCATCCCCCAGAAGAGG - Intergenic
1199617583 X:149670247-149670269 CCACTCCCACACCCCATCCTTGG + Intergenic
1199625060 X:149733002-149733024 CCACTCCCACACCCCATCCTTGG - Intergenic
1199638982 X:149841707-149841729 CATCCTCCAGACCCCAGAATAGG - Intergenic
1199843705 X:151675567-151675589 CCTCCTCCACACCCCAGTGTGGG + Intronic
1199865776 X:151848835-151848857 CGTCCCCCACCCCCCACACTAGG + Intergenic
1199921035 X:152404362-152404384 CCTCCCCCATACCCCAAACTAGG + Intronic
1200135278 X:153871714-153871736 CCTCCCCTCCACCTCCGACTTGG - Intronic
1200154478 X:153968154-153968176 GCTCCCCCACCCCCCACACCTGG + Intronic
1200566607 Y:4776469-4776491 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1202082487 Y:21098817-21098839 CCTCTCCCACACCCCACAACAGG + Intergenic