ID: 1002316626

View in Genome Browser
Species Human (GRCh38)
Location 5:178348286-178348308
Sequence CAAAATAATGAGAAGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 786}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002316626_1002316630 13 Left 1002316626 5:178348286-178348308 CCTGCTTTCTTCTCATTATTTTG 0: 1
1: 0
2: 6
3: 64
4: 786
Right 1002316630 5:178348322-178348344 CTCCTCTACCTCATTGCTAATGG 0: 1
1: 0
2: 0
3: 17
4: 143
1002316626_1002316633 29 Left 1002316626 5:178348286-178348308 CCTGCTTTCTTCTCATTATTTTG 0: 1
1: 0
2: 6
3: 64
4: 786
Right 1002316633 5:178348338-178348360 CTAATGGCTTTTTCTTACTGAGG 0: 1
1: 0
2: 0
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002316626 Original CRISPR CAAAATAATGAGAAGAAAGC AGG (reversed) Intronic
900468917 1:2841479-2841501 GAAAAGGATGAGAAGAAAGCAGG - Intergenic
900723080 1:4192168-4192190 AACAATAATCAAAAGAAAGCTGG - Intergenic
901087246 1:6618629-6618651 AAAAAGAAAGAAAAGAAAGCAGG - Intronic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
902102564 1:14004014-14004036 CAAATCAATAATAAGAAAGCAGG + Intergenic
903414084 1:23169342-23169364 CAAAAGAAAAAGAAAAAAGCGGG + Intronic
903611403 1:24617293-24617315 AAAAATAATAATAAGAAAGGAGG - Intergenic
904215722 1:28917166-28917188 AAAAATAAGGAGAATAAAGGTGG - Intronic
904814457 1:33184750-33184772 CAAAATAGTATGGAGAAAGCTGG - Intergenic
905185859 1:36196484-36196506 CAAGAGAATGAAAAGACAGCCGG - Intergenic
905484808 1:38288013-38288035 AAAGATAATGAGAAGAAATGGGG - Intergenic
905804189 1:40863963-40863985 TAAAAAAATAAGAAGAAAGAGGG - Intergenic
906670660 1:47651968-47651990 CAAGATTATGAGAAGAAAGATGG - Intergenic
906824694 1:48966562-48966584 CAAAATAAAGAGAATAAAATGGG - Intronic
907531979 1:55108365-55108387 CACTATAGTGAGAAGCAAGCAGG + Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
908004771 1:59716628-59716650 CAAAATACTGAGACAACAGCAGG + Intronic
908814924 1:68021978-68022000 CAAAATAATAACAAGAAGCCAGG + Intergenic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909780292 1:79537398-79537420 CTAAATAAAAAGAACAAAGCTGG - Intergenic
910781102 1:90934363-90934385 GAAAACAACTAGAAGAAAGCAGG + Intronic
910939422 1:92517157-92517179 CAAAATAATTAGGAGAAAAAAGG + Intronic
910974294 1:92889944-92889966 CAAAAAAATGGAAAGACAGCTGG - Intronic
911111739 1:94195822-94195844 CAAAATAACCAAAAGAAAACTGG + Intronic
911348235 1:96722049-96722071 CGAGAAAATGAGAAGAAAGCGGG + Intronic
911710378 1:101064673-101064695 CAAAATATTAAGAAGGTAGCTGG - Intergenic
912273906 1:108236890-108236912 CAAAATATTGAAAAAAAAGGGGG - Intronic
912287361 1:108382972-108382994 CAAAATATTGAAAAAAAAGGGGG + Intronic
912294313 1:108457433-108457455 CAAAATATTGAAAAAAAAGGGGG + Intronic
912675387 1:111675551-111675573 CAAAGCAATGGGAATAAAGCTGG - Intronic
912762431 1:112381077-112381099 CAAAGTAATCAGACCAAAGCAGG + Intergenic
912923817 1:113895391-113895413 CAAAATAATCAGCAGTAAGCTGG + Exonic
913442145 1:118909377-118909399 CCACATAATGAAAAGACAGCTGG + Intronic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914787708 1:150849762-150849784 CAAAAAAATAAGAAGAAAATAGG + Intronic
914840973 1:151248377-151248399 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
915314840 1:155022585-155022607 CAAAATAATAATAATAAGGCAGG + Intronic
915696633 1:157749223-157749245 TAAAGTAATGAGAAAAAGGCAGG - Intronic
916045603 1:160997952-160997974 AAAAAGAAAGAAAAGAAAGCTGG - Exonic
916276671 1:163001449-163001471 GAATAAAATGAAAAGAAAGCAGG - Intergenic
916896978 1:169174202-169174224 CAAAATACTGAAAATAAAGAAGG + Intronic
916941362 1:169682052-169682074 CAAAATATTTAGAAGAAAATCGG - Intronic
916990557 1:170239470-170239492 CAAACTCACGAGAACAAAGCAGG + Intergenic
917041854 1:170813646-170813668 TTAAATAATGAAATGAAAGCAGG + Intergenic
917223172 1:172753532-172753554 TAAAATAATGAGAGAAAAGAAGG - Intergenic
917371269 1:174297033-174297055 CAAAACAATGATAAGACACCAGG + Intronic
918416307 1:184311546-184311568 CAACATACTGAGACAAAAGCTGG - Intergenic
918503656 1:185227427-185227449 CAAAATAATGGTATGAAGGCTGG - Intronic
918556848 1:185811835-185811857 AAAAATAATGTCAAGAAAGAAGG - Intronic
918855516 1:189750863-189750885 CAATAAAATTAAAAGAAAGCTGG - Intergenic
918866240 1:189904104-189904126 GAAAATAATGAGAACAAGGCCGG - Intergenic
918903359 1:190455603-190455625 CAGAATAATGAAAAAAAATCTGG - Intronic
918982531 1:191581845-191581867 CAAAACAAAAAGAACAAAGCTGG - Intergenic
920186335 1:204161633-204161655 CAAAACATTGAGAATGAAGCAGG + Intronic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
921360951 1:214330808-214330830 CAAAAGAATGAAAGGAAATCAGG - Intronic
921918557 1:220641599-220641621 CAAAATAAAGGGAAGAAGGAAGG + Intronic
922370359 1:224904414-224904436 GAAAATAAAGAAAAGAAAGAAGG - Intronic
922454090 1:225760590-225760612 CAAAAGAAAGAGAAGAAATGTGG - Intergenic
922543929 1:226440807-226440829 CAAAAGATTAAGAAGAGAGCTGG - Intergenic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924190106 1:241542096-241542118 CAAAAAAATAAAAAGAAAGAAGG - Intronic
924255225 1:242176135-242176157 CTAAATAAAAAGAATAAAGCTGG + Intronic
924480114 1:244422653-244422675 CAAAATATTGAGTAGGGAGCAGG - Intronic
924636634 1:245793889-245793911 CACATTAATCAGAGGAAAGCTGG - Intronic
924879435 1:248143946-248143968 CACAATAATCAGAACAAAGAAGG - Intergenic
1063311606 10:4957721-4957743 AAAAATAGTGAGAAGAAATTAGG + Intronic
1063316191 10:5008749-5008771 AAAAATAGTGAGAAGAAATTAGG - Intronic
1063621735 10:7655573-7655595 CAAAATAAATAGAAGAATGAGGG + Intronic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1063954533 10:11254209-11254231 AAAAAAACTCAGAAGAAAGCCGG + Intronic
1064525010 10:16246065-16246087 GACAGTAATGAGAAGAAAACTGG + Intergenic
1064814461 10:19242748-19242770 CAAACAAATGAAAAGCAAGCAGG - Intronic
1065073010 10:22047456-22047478 CCAAATAACCAGAAGAAAACGGG + Intergenic
1065176090 10:23076807-23076829 CAAAATAATAAGCACAAAACTGG + Intergenic
1065525738 10:26618857-26618879 CAAAAAAATTAGAAGAGAGTAGG + Intergenic
1065592358 10:27277772-27277794 AATAATAATCAAAAGAAAGCAGG - Intergenic
1065657992 10:27972596-27972618 AACAATAATCAAAAGAAAGCAGG + Intronic
1065774302 10:29105014-29105036 CAAAATCATGAGAAAAGACCAGG - Intergenic
1066258068 10:33700960-33700982 AACAATAATCAAAAGAAAGCTGG - Intergenic
1066326398 10:34364070-34364092 CAAAAAACTGAGAATAGAGCTGG + Intronic
1067459008 10:46443796-46443818 AAAAAAAAAGAAAAGAAAGCAGG - Intergenic
1067476472 10:46570696-46570718 TCAAATGATGAGAAAAAAGCTGG - Intergenic
1067618266 10:47771085-47771107 TCAAATGATGAGAAAAAAGCTGG + Intergenic
1068183423 10:53552538-53552560 AACAATAATCAAAAGAAAGCTGG + Intergenic
1068248603 10:54406799-54406821 CAAAGTATTTAGAAGAAAACAGG + Intronic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1068905022 10:62313034-62313056 CATAAGAATTAGAAGAACGCTGG - Intergenic
1069093673 10:64231887-64231909 TAAAATTATTAGAAGAAAACAGG + Intergenic
1069304656 10:66953984-66954006 CAAAATAATTAGAACAAAGCTGG + Intronic
1069663879 10:70142334-70142356 CAAATGAATGAGAAGACAACAGG - Intronic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1071033151 10:81208448-81208470 CAAAATACTGAAAAGAAAAATGG + Intergenic
1071080878 10:81808936-81808958 AACATTAATGAAAAGAAAGCTGG + Intergenic
1071428160 10:85580435-85580457 CAGAATACTGAGAACTAAGCAGG - Intergenic
1071704884 10:87987228-87987250 CAAAATAATGAAGAGAAAAATGG + Intergenic
1071870040 10:89783844-89783866 TAAAATAATGAAAATAAGGCAGG + Intergenic
1071952758 10:90723746-90723768 CAAAAAAATGTGCAGGAAGCTGG - Intergenic
1071952869 10:90724681-90724703 CAAAAGAATCAGATGAAAGTAGG - Intergenic
1071996138 10:91151286-91151308 GGAAAGAAGGAGAAGAAAGCAGG - Intergenic
1072210392 10:93240938-93240960 CACAACAATGAGCAGAAATCAGG + Intergenic
1073167351 10:101468105-101468127 CAAAGTAATTTTAAGAAAGCCGG - Intronic
1073359019 10:102882337-102882359 CAAAAAAATCAGAAGAAGCCAGG - Intronic
1073997851 10:109336820-109336842 CTAAACAAGAAGAAGAAAGCTGG - Intergenic
1074050683 10:109878724-109878746 CAAAAAAATCAGAAAAAATCAGG + Intronic
1074074958 10:110114681-110114703 CAAAGTAAGGAGAAGAGAGAAGG + Intronic
1074232628 10:111553049-111553071 CAAAAGAATGAGAAGAGCGAAGG + Intergenic
1074795061 10:116934609-116934631 CAAAGCAAAGAGAACAAAGCTGG - Intronic
1076001934 10:126919480-126919502 AAGAATAATGTGAAGAAATCTGG - Intronic
1076203845 10:128579266-128579288 CAAAATAATGAGAATTAATGTGG + Intergenic
1076409832 10:130239449-130239471 TAAAACAATGAAAAAAAAGCTGG - Intergenic
1076805418 10:132855343-132855365 AACACTAATGAAAAGAAAGCTGG - Intronic
1077808715 11:5615892-5615914 AACAATAATCAAAAGAAAGCTGG - Intronic
1077822068 11:5755506-5755528 GAAAAGAAGGAGAAGAAAGCTGG - Exonic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078284271 11:9935506-9935528 CTAAACAAAAAGAAGAAAGCTGG + Intronic
1078516603 11:12027976-12027998 AAAAATAATGGAAAGCAAGCGGG + Intergenic
1078712014 11:13802176-13802198 GAAAATACTCAAAAGAAAGCTGG + Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1079006628 11:16795791-16795813 CAAAATAATAATAATAAAGGTGG + Intronic
1079441021 11:20515031-20515053 CAAAACAATGGAAAGAAAACAGG - Intergenic
1079491666 11:20995683-20995705 CACAATAAGGCAAAGAAAGCTGG - Intronic
1079884584 11:25971254-25971276 CAAAATTATGGGGAGAAAGCAGG + Intergenic
1080215990 11:29841299-29841321 CTAAATAAAAAGAACAAAGCTGG - Intergenic
1080225207 11:29952333-29952355 CAAAATAAAAACAAAAAAGCAGG + Intergenic
1081522505 11:43896705-43896727 CTAAATAATGGGAAGAAGTCAGG - Intronic
1082021140 11:47534424-47534446 CAAAATTATAAAAATAAAGCTGG + Intronic
1082080942 11:48012177-48012199 AAAAGAAATGAGAAGAAAACTGG - Intronic
1082184053 11:49158402-49158424 GAAAATAAAAAGAAGTAAGCTGG + Intronic
1082778315 11:57265458-57265480 TAAAATAGTGTGAAGCAAGCAGG - Intergenic
1082873403 11:57964483-57964505 CCAAATACAGAGAAAAAAGCAGG - Intergenic
1083498442 11:63080315-63080337 CAAAATTAAGAAAAGAAAGCAGG - Intronic
1083981122 11:66171271-66171293 TATAATAATCAAAAGAAAGCTGG - Intronic
1084276796 11:68056048-68056070 CAAAATAATAATAATGAAGCAGG + Intronic
1084873652 11:72114903-72114925 CAAAAAGATAAGTAGAAAGCTGG + Intronic
1084951808 11:72670590-72670612 AAAAATAATGATAAAGAAGCAGG - Intronic
1085608324 11:77923017-77923039 TACAACTATGAGAAGAAAGCCGG + Intronic
1085929783 11:81067517-81067539 CAAAAACATGACAAGAAAACAGG - Intergenic
1086157336 11:83682164-83682186 CAAAATTATTGGAACAAAGCAGG + Intronic
1086326484 11:85706610-85706632 TAAAATAATGAAAAGAATTCAGG + Intronic
1086485786 11:87299815-87299837 GTAAATGAAGAGAAGAAAGCAGG + Intronic
1086581123 11:88400167-88400189 CAAAATCATCAGAAAATAGCAGG + Intergenic
1086608873 11:88729577-88729599 CTAAATAAAAAGAACAAAGCTGG + Intronic
1086963132 11:93000463-93000485 GAAAATAAAGAGAAAAAAGAAGG - Intergenic
1087911078 11:103754007-103754029 CAAAACAATGAGAAGGAAAATGG + Intergenic
1088055357 11:105569631-105569653 CAAAATATTGAAAAGTTAGCCGG + Intergenic
1088230088 11:107664992-107665014 CAATACAATGATAAGAATGCAGG - Intronic
1088291671 11:108245346-108245368 CAAAAGAATTTAAAGAAAGCAGG + Intronic
1088516714 11:110644355-110644377 CTAAGTAATAAGAACAAAGCTGG + Intronic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1089418578 11:118314249-118314271 CAAAATGATGAGAAGAGTGTAGG + Intronic
1089673951 11:120076787-120076809 GAAAATAAAGAGAAAAAAGAAGG + Intergenic
1090168909 11:124581116-124581138 AAAAAAAATGGTAAGAAAGCAGG + Intergenic
1090416555 11:126544436-126544458 CAAAACAAAGAGAAGAGAACTGG - Intronic
1090936276 11:131345382-131345404 CAATATAATGGAAAGAAAGAGGG + Intergenic
1091471738 12:734275-734297 TAAAATACTTAGAAGAAAACAGG - Intergenic
1092628372 12:10352770-10352792 CAAAAAAAAAAGAACAAAGCTGG - Intergenic
1092703097 12:11255331-11255353 CAAAAAAGTCAGAAGAAACCAGG + Intergenic
1092962758 12:13611673-13611695 GAAAATAAGGAGAAAAAAACTGG + Intronic
1093897052 12:24585324-24585346 AAAAGTAATCAAAAGAAAGCTGG + Intergenic
1093911922 12:24758139-24758161 CAAAATAATGAGGAGATGGTTGG - Intergenic
1094248845 12:28335791-28335813 AAAAATAATGAGAAAAAAAGGGG - Intronic
1094629896 12:32163242-32163264 TAAATTAATGAAAAGAAGGCAGG - Intronic
1095591229 12:43906462-43906484 CAAAAAAAAAAAAAGAAAGCGGG + Intronic
1095599333 12:43997341-43997363 CAAAAAAATAAGAAGAAAAATGG - Intronic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096580027 12:52579103-52579125 TCAGATTATGAGAAGAAAGCAGG + Intergenic
1096701227 12:53384263-53384285 GAAAAAAAAGAAAAGAAAGCCGG - Intronic
1097092317 12:56516585-56516607 CAAAAGAAGAAGAAGAAATCTGG + Intergenic
1097347309 12:58507456-58507478 AAAAAAAATGAGAGGAAAGTAGG - Intergenic
1097725042 12:63065842-63065864 CACAAGAATGAGAAGAAATGAGG + Intergenic
1097974326 12:65668202-65668224 CAACATAATGTGCAGTAAGCTGG - Intergenic
1098010742 12:66048619-66048641 CAATACAATGAGACGAATGCTGG + Intergenic
1098198663 12:68030834-68030856 CAAAAAAATAAGAAAAAAGGCGG + Intergenic
1098219215 12:68250997-68251019 CAGAACAATGAGAAAAGAGCTGG - Intronic
1098894165 12:76038544-76038566 CAAAAACATGAGAATAAAGAAGG + Exonic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099040530 12:77648004-77648026 CACAACAAAGAGAAGAAAACAGG + Intergenic
1099532993 12:83809794-83809816 TAAGATAATGGCAAGAAAGCTGG + Intergenic
1099735318 12:86561412-86561434 CAGCATAATTAGAATAAAGCAGG + Intronic
1099807517 12:87538510-87538532 AGAAATAATGAGAAGAAATATGG + Intergenic
1099902404 12:88727978-88728000 CAGAATAATGAGGAGATAGTAGG + Intergenic
1100227036 12:92568499-92568521 CAAAAGAATGAGAATCAAGCTGG + Intergenic
1100765401 12:97859399-97859421 CTAAACAATAAGAACAAAGCTGG + Intergenic
1101094786 12:101326883-101326905 CAAAATAAGGCTAAGAGAGCTGG - Intronic
1101106012 12:101440807-101440829 GAAAAGAATGCTAAGAAAGCTGG - Intergenic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1102319322 12:111917801-111917823 AAAACAAATAAGAAGAAAGCAGG - Intergenic
1102693797 12:114782290-114782312 AAAAAAAAAGAAAAGAAAGCAGG + Intergenic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1103106987 12:118236984-118237006 CAAAATAATCACAAGCAAGTTGG + Intronic
1103359146 12:120343195-120343217 AAAAATAAGAAGAAGAAAGTAGG - Intronic
1103537707 12:121644581-121644603 CAAAAAAAAAAAAAGAAAGCTGG - Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104507732 12:129348725-129348747 TAAAATAAAGAAAAGAAAACTGG + Intronic
1104681098 12:130752539-130752561 AACAATAATAAGAAGAAAACAGG - Intergenic
1104799961 12:131547725-131547747 CAAAAGAGTGAGAAGCCAGCTGG - Intergenic
1105582519 13:21712780-21712802 AACAATAATTAAAAGAAAGCAGG + Intergenic
1105865616 13:24456616-24456638 CAAAATAATGAAATGTAGGCCGG + Intronic
1105911003 13:24867320-24867342 CAAAAAAGTGAAAAGAAAGCTGG - Intronic
1106031268 13:26007048-26007070 TGAAATAATGAGAAGAAAAGAGG - Intronic
1106359449 13:29016771-29016793 TAAGATAAAGAGAACAAAGCAGG + Intronic
1106637868 13:31550104-31550126 AACAATAATCAAAAGAAAGCTGG - Intergenic
1107068198 13:36240137-36240159 AAAAATAGTGAGAAGCAAGGTGG - Intronic
1107331374 13:39304566-39304588 CAAAACAATGTGAAGAAAAGTGG - Intergenic
1107553486 13:41497815-41497837 TGGAATAATGAGAATAAAGCTGG + Intergenic
1107734286 13:43380727-43380749 AACATTAATGAAAAGAAAGCTGG + Intronic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1108234655 13:48390779-48390801 GATATTAATGGGAAGAAAGCTGG - Intronic
1108448075 13:50528982-50529004 CCAAATCATGTGGAGAAAGCTGG + Intronic
1108491732 13:50988890-50988912 CAAAACAGAGAGAAGAAAACGGG - Intergenic
1108606271 13:52041929-52041951 CAAAAGAAAGTGAAGCAAGCAGG + Intronic
1108678215 13:52756632-52756654 CAAAATGATGTGAAAAAAACTGG + Intergenic
1108842855 13:54642170-54642192 CAAAATAATGAGAAAGTAGCCGG + Intergenic
1109137000 13:58664843-58664865 TAAAATAATAAGAGGAAAGCTGG - Intergenic
1109955825 13:69564471-69564493 CAAAAAAAAGGGAAGAAAGTTGG + Intergenic
1110271002 13:73590739-73590761 CAAAATAAACCAAAGAAAGCAGG - Intergenic
1110855939 13:80296806-80296828 CAAAATAACAAGAAGGAAGGGGG + Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111407778 13:87832315-87832337 CAAAATTTTAAGAAGACAGCAGG - Intergenic
1111654499 13:91135050-91135072 TTAAATAATGAGAGGGAAGCAGG + Intergenic
1111686860 13:91512889-91512911 AATAATAATGAGAACCAAGCTGG - Intronic
1111772055 13:92609358-92609380 CAAAAAACTGAAAAGAAAGGAGG - Intronic
1112126351 13:96472574-96472596 CAAAATAATAAGTACAATGCTGG - Intronic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112375189 13:98833111-98833133 CAATTTAATGAGCAGAAAGTGGG + Intronic
1112410483 13:99158822-99158844 CAAAACTACTAGAAGAAAGCAGG - Intergenic
1112510990 13:100009253-100009275 CAAAATAATGCAGAGAAAGAGGG + Intergenic
1113057514 13:106285220-106285242 AGAAAGAATCAGAAGAAAGCTGG - Intergenic
1113142235 13:107166799-107166821 CAAAAGAATGACAGGAAAGAAGG - Exonic
1113385981 13:109848494-109848516 CAAAATCAAAAGAAGAAATCTGG - Intergenic
1114261429 14:21039336-21039358 CGATAGAATGAGAAGGAAGCAGG + Intronic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1114999050 14:28399347-28399369 CTAAATGAAGAGAAAAAAGCTGG - Intergenic
1115063044 14:29217582-29217604 GAAAATACTTTGAAGAAAGCAGG - Intergenic
1115901388 14:38152736-38152758 CCAAATAATGAGAATAAAAAAGG - Intergenic
1116374342 14:44179090-44179112 AAAAATAAAGAAAAGAAAGCAGG + Intergenic
1117147112 14:52846551-52846573 CAAAAAAAAGAAAAGAAAGAAGG - Intergenic
1117514687 14:56489053-56489075 CAAAATACAGAGAAGAAACTGGG + Intronic
1118466942 14:66039578-66039600 CAAAAGAATAAGAAAAAAGAAGG + Intergenic
1118919203 14:70134382-70134404 CAAAGGAATGGGAAGAATGCAGG - Intronic
1119500571 14:75123556-75123578 CAAAATGATGTGAAGAAATCAGG + Intronic
1119960155 14:78846890-78846912 CAAAATGGTGAGAAGAAACTAGG - Intronic
1120266778 14:82260809-82260831 AAAAATAATGAGAAGGAAAGAGG + Intergenic
1120396713 14:83976179-83976201 CAAATTAAGCAGAATAAAGCCGG + Intergenic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1122518908 14:102328962-102328984 AAAAAAAAAAAGAAGAAAGCAGG - Intronic
1122764909 14:104061642-104061664 CACACAAATCAGAAGAAAGCTGG - Intergenic
1123894375 15:24813801-24813823 CAAAGACATGAGAAGAGAGCAGG + Intergenic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1125264594 15:37864555-37864577 CAAAATAAGGGAATGAAAGCTGG + Intergenic
1125908967 15:43419221-43419243 CAAAAAAAAGTGAAGAAATCTGG + Intronic
1128406526 15:67346083-67346105 AACAATAATGAAAAGAAAGCTGG + Intronic
1129560758 15:76564719-76564741 CAAAATAAAAAGAAGAAAGCTGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130543493 15:84838915-84838937 CAAAATAATGGGAAGAGGCCGGG - Intronic
1130732238 15:86508373-86508395 AAAAATAATGACAAAAAAGAAGG + Intronic
1130800394 15:87256751-87256773 AATAATAATGAAAAGAAATCAGG - Intergenic
1130913399 15:88286231-88286253 CAAAATAATGAAGAGAAAGATGG - Intergenic
1131101924 15:89698272-89698294 AACACTAATCAGAAGAAAGCTGG - Intronic
1131828529 15:96339612-96339634 CAAATTAAGGAAGAGAAAGCAGG + Exonic
1132169617 15:99636236-99636258 CATATTAATAAGAAAAAAGCAGG - Intronic
1132468942 16:91079-91101 CAAAACAATAAAAAAAAAGCTGG + Intronic
1133066703 16:3213057-3213079 GAAAAGAAAGAGAAGAAAGAGGG + Intergenic
1133807300 16:9135335-9135357 CAAAATAATAAGAACAACACGGG - Intergenic
1134252426 16:12583667-12583689 CAAAATAATAAGTAAACAGCTGG + Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134904197 16:17965483-17965505 AAAAATAATTAAATGAAAGCAGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135156159 16:20054726-20054748 CAAAATAAAAAGAAAAAAGAAGG - Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135592702 16:23715759-23715781 CAAAATATAGAGCAGAAAGGAGG - Intergenic
1136749445 16:32620007-32620029 CAAATGAATGGGAAGAGAGCAGG - Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1137470685 16:48754519-48754541 TAAAATAATTAAAGGAAAGCTGG + Intergenic
1137764165 16:50964898-50964920 CAAAACAGAGAGAAGAAAGCAGG - Intergenic
1137835270 16:51586167-51586189 CAAGATAATAAGGAGAAAGGAGG - Intergenic
1138204741 16:55116227-55116249 CAACACAGTGAGAAGGAAGCAGG + Intergenic
1139199559 16:64959980-64960002 AAAAATAAAAATAAGAAAGCAGG - Intronic
1139453456 16:67051516-67051538 AAAAATAATGAGTATAAAACTGG - Intronic
1139816710 16:69680210-69680232 CACAAACATGAGAAGAAAGATGG + Intronic
1140171513 16:72609753-72609775 CAAAATTGTCAGATGAAAGCTGG + Intergenic
1140289532 16:73639737-73639759 CAAAGTAATGAGAATAAAAAAGG + Intergenic
1140436014 16:74947772-74947794 CAAAATAATCACAAGAGGGCCGG + Intronic
1141457916 16:84156494-84156516 CAACAAAAGGAGAAGCAAGCAGG - Intronic
1203051576 16_KI270728v1_random:879217-879239 CAAATGAATGGGAAGAGAGCAGG - Intergenic
1142585348 17:968986-969008 CAAAAAAATGAAGAGAAACCAGG + Intronic
1142998958 17:3778615-3778637 CACATAAATGAGAAGAAAGAAGG - Intronic
1143048753 17:4104532-4104554 CAAAAAGATGAGAAGATACCAGG + Intronic
1143200614 17:5110875-5110897 CAATTTAATGGGGAGAAAGCTGG + Intronic
1143556260 17:7662918-7662940 CAAAATAATGACAATAAGGCCGG - Intronic
1143643863 17:8216866-8216888 CAAAATAATAATAATAAGGCCGG - Intergenic
1145727196 17:27141143-27141165 CAAAGTATTTAGAAGAAAACAGG + Intergenic
1146991524 17:37277736-37277758 CCAAATAAGGAAAAGAAAGATGG - Intronic
1147282471 17:39373502-39373524 CAAAATTATTAAAAGAAACCAGG - Intronic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150023324 17:61643862-61643884 CAAAAAAATGAAAAATAAGCCGG + Intergenic
1150054078 17:61995165-61995187 CAAAATAGTGAGAGAGAAGCTGG - Exonic
1150139921 17:62718964-62718986 CAAAATATTGACAAGAATGAAGG - Intronic
1150517918 17:65833900-65833922 CAAAGTAAAGAGAACAAAGCTGG + Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151753818 17:76059246-76059268 AAAAATAATAATAAGTAAGCCGG + Intronic
1152591562 17:81215916-81215938 CAAAACAATGTAAGGAAAGCGGG + Intronic
1153056818 18:953875-953897 AAAAATAATAATAACAAAGCAGG - Intergenic
1153284461 18:3445426-3445448 TTAAAAAATGAGAAGAAGGCCGG + Intronic
1153295876 18:3545782-3545804 AATACTAATGAAAAGAAAGCTGG + Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1153890426 18:9509296-9509318 AAAAATATTGAGAGGAAGGCTGG + Intronic
1155019310 18:21880520-21880542 CAAAATAACTACAAGAAAGCTGG + Intergenic
1155101505 18:22614859-22614881 GAAAAGAAAGAGAAGAAATCTGG + Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155306958 18:24487956-24487978 CAAAATATTGAGAAGTGAGTGGG - Intergenic
1155716890 18:28954826-28954848 CTAAGTAAAGAGAACAAAGCTGG + Intergenic
1156222183 18:35063834-35063856 CAAAAAAATGAAAAGTAAGCTGG + Intronic
1156446101 18:37237988-37238010 AAAAAAAATCAGAAGAAAGAAGG + Intergenic
1156826282 18:41434047-41434069 CAAAAGAATGAAAAGAGAACAGG + Intergenic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1157064056 18:44326426-44326448 CACAACAATGATAAGAAATCAGG - Intergenic
1157507360 18:48238054-48238076 AAAAATAATGAAAACACAGCTGG + Intronic
1158143962 18:54289527-54289549 CTAAATAAAAAGAACAAAGCTGG + Intronic
1158329039 18:56341160-56341182 GTAAATGATGAGAAGAAAGTAGG + Intergenic
1158380704 18:56927117-56927139 CACAAGAATAAGAAGAAAGTAGG - Intronic
1158708007 18:59811378-59811400 GAAATTAAGGAGAAGAAAGAGGG - Intergenic
1158709359 18:59823773-59823795 CAATAGAAAGAGAAGACAGCAGG - Intergenic
1158780116 18:60638590-60638612 CAGAATAGTGATAAGAAATCAGG + Intergenic
1159236672 18:65683427-65683449 TAAAATCTTGAGAAGAAAGTAGG + Intergenic
1159825301 18:73201677-73201699 AAAAAAAAAAAGAAGAAAGCTGG - Intronic
1160146127 18:76366496-76366518 CAAAACAAAGAGAAGCACGCTGG + Intronic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1161121669 19:2530412-2530434 CAAAAAAAAGAAAAAAAAGCTGG + Intronic
1161589989 19:5125182-5125204 CACATTAATGAAAAGAAAGCTGG - Intronic
1162054938 19:8056839-8056861 CAAAATAATAATAAAAGAGCTGG - Intronic
1162083938 19:8237196-8237218 CAAGATAATGAACAGAAAGCTGG - Intronic
1162949168 19:14060641-14060663 CAAAATACTGAGAACACAGCTGG + Intergenic
1162949984 19:14065520-14065542 AAAAATAATAAAAAGAAGGCTGG + Intergenic
1162973418 19:14194867-14194889 AAAAAAAAAGAGAAGAAAGAAGG - Intronic
1163581396 19:18141369-18141391 CAAAAAAAAAAAAAGAAAGCTGG - Intronic
1163817276 19:19474504-19474526 CAAAACACTCAGAAGGAAGCCGG - Intronic
1164141873 19:22477089-22477111 CAAAGTATTTAGAAGAAAGGGGG - Intronic
1164205353 19:23053919-23053941 TAAAATAATGAGTAAAATGCTGG - Intergenic
1164207733 19:23071865-23071887 GAAAATAATGAAAAGAAAAAGGG + Intergenic
1164697344 19:30255720-30255742 AAAAGTAATGAGAAGAAAATTGG - Intronic
1165338479 19:35192162-35192184 AAAATTAATCAAAAGAAAGCTGG - Intergenic
1165603871 19:37082010-37082032 AATATTAATGAAAAGAAAGCTGG - Intronic
1166212149 19:41313696-41313718 CAAAAAAATGGAAAGAAAACAGG - Intronic
1166273561 19:41734561-41734583 AAGTGTAATGAGAAGAAAGCAGG + Intronic
1166442926 19:42831740-42831762 AAATGTAATGAGAAGAAAGTAGG - Intronic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166495374 19:43299157-43299179 CAAAATATTGGAAAGAAAGCTGG + Intergenic
1166630690 19:44404242-44404264 AAATCTAATGAAAAGAAAGCAGG - Intergenic
1167292853 19:48634106-48634128 CAAAATAACGAGAAAAATGAAGG + Intronic
1167894654 19:52571105-52571127 AAAAAAAAAGATAAGAAAGCAGG + Intronic
1167904572 19:52648140-52648162 AAAAAAAAAGATAAGAAAGCAGG - Intronic
1167958795 19:53089840-53089862 CAAAATGAGGAGCAGAAACCTGG - Intronic
1168080532 19:54006829-54006851 CAAAATAAAAAAAAGAAGGCCGG - Intronic
925261774 2:2535578-2535600 CAAAATTACAAGAAGAAAGTAGG - Intergenic
925948420 2:8888432-8888454 GAAAGTACTGAGCAGAAAGCAGG - Intronic
926483016 2:13423226-13423248 CAAACAAATGAAAACAAAGCTGG - Intergenic
926502635 2:13674779-13674801 AAAAATAATAAGAAAAAGGCAGG + Intergenic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
927160204 2:20250241-20250263 CACAATAATAAAAAGAAAGCTGG + Exonic
927480097 2:23446744-23446766 GAAAATAATGTCAGGAAAGCTGG - Intronic
927752814 2:25685136-25685158 TAAAATGATTAGCAGAAAGCGGG + Intergenic
927789082 2:25995921-25995943 AAAAATAAAAAGAAAAAAGCCGG - Intergenic
928080308 2:28306533-28306555 AAAAATACACAGAAGAAAGCTGG - Intronic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
928631433 2:33196937-33196959 CATTATAATGAGAAAAGAGCGGG + Intronic
929264550 2:39903512-39903534 TAAGATAATGAGAAGATAGATGG + Intergenic
929324149 2:40586039-40586061 TAAAATCATTAGAAGAAAACAGG - Intronic
929713364 2:44287152-44287174 CAATATACTGAGGGGAAAGCAGG + Intronic
929732190 2:44507520-44507542 GAAAAAAATGAGATGAAATCAGG - Intronic
930445405 2:51464682-51464704 TTACAAAATGAGAAGAAAGCTGG + Intergenic
931211196 2:60197093-60197115 CTAAACAAAAAGAAGAAAGCTGG - Intergenic
931275760 2:60742482-60742504 CCAAGTGATTAGAAGAAAGCTGG + Intergenic
932214831 2:69959889-69959911 CAAAATAATGAGAGCAATTCTGG + Intergenic
932842216 2:75094288-75094310 TAAAATAAAGAGAAGTAAGTAGG + Intronic
932994062 2:76827209-76827231 TAAAATAATGAACAGAAAGTTGG + Intronic
933076380 2:77932764-77932786 CAAAGCAAAAAGAAGAAAGCTGG + Intergenic
933166400 2:79081568-79081590 CAAAATAAAAAAAAAAAAGCAGG - Intergenic
933318199 2:80740211-80740233 CTAAATAAAAAGAACAAAGCTGG + Intergenic
934058718 2:88274432-88274454 AAAAAAAAAGAAAAGAAAGCCGG - Intergenic
934924319 2:98371320-98371342 CAAATGAATGAGAAGAAATGAGG - Intronic
935869949 2:107436919-107436941 CAGAATAATTAGAAGACAGTGGG - Intergenic
936506225 2:113109613-113109635 CAAACTAACTAGAAGAGAGCTGG + Intronic
936738786 2:115478446-115478468 TAAAACATTTAGAAGAAAGCAGG + Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937842944 2:126544192-126544214 AAAAGTAACCAGAAGAAAGCTGG + Intergenic
937844854 2:126568377-126568399 CAAAATATTGAAAAAAAAGTGGG - Intergenic
937911504 2:127077879-127077901 CACAAGAATGAGAAGGAAACGGG + Intronic
938246853 2:129783778-129783800 AAAAATAAAGATAAGAAAGTGGG + Intergenic
938542980 2:132301453-132301475 AAATCTAATGAAAAGAAAGCAGG + Intergenic
938551931 2:132390624-132390646 CAAAAAAAAGAAAAGAAAGACGG + Intergenic
938866561 2:135427750-135427772 CAAAGTAAAAAGAACAAAGCTGG + Intronic
938937465 2:136139719-136139741 CAAAATATTGACATTAAAGCAGG + Intergenic
939041769 2:137198064-137198086 CTAAATAATGAAAAGCAAGCAGG - Intronic
939069806 2:137525720-137525742 GCAATGAATGAGAAGAAAGCTGG + Intronic
939272489 2:139958747-139958769 CAAAAGAAGAAGAAGAAAGAAGG + Intergenic
939284651 2:140113514-140113536 GAAAAAAATTAGAAGAAAGAAGG - Intergenic
939556847 2:143685417-143685439 CCAAATAATGAAAACATAGCTGG + Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940787980 2:158002416-158002438 CAAAATAAAGAGCAGAGAGTTGG - Intronic
940882152 2:158957736-158957758 TAAAAGAATGGGAAGAAAACAGG - Intergenic
940939477 2:159541914-159541936 CAAAAGAATGAAAGGAAACCAGG + Intronic
941063701 2:160876994-160877016 CACAATACTGAGAAGAAAGGGGG + Intergenic
941229314 2:162889921-162889943 AAAAATATTGTGAAGAAAGAAGG - Intergenic
941625037 2:167822114-167822136 CATAATAAAGAGGAAAAAGCAGG - Intergenic
942346487 2:175007736-175007758 CAAACTAGTGAGTGGAAAGCTGG - Intergenic
942449992 2:176103020-176103042 CAAGAAAATGAGTAGCAAGCAGG - Intergenic
942510742 2:176697120-176697142 TATAATGATGAAAAGAAAGCAGG + Intergenic
942651434 2:178172838-178172860 CAATATAAAAAGAAGCAAGCTGG - Intergenic
942964175 2:181869915-181869937 CAAAATAATTAGAAGAATTTTGG + Intergenic
943005502 2:182384630-182384652 AAAAATAATAAAAAGAAATCAGG + Intronic
943078319 2:183225742-183225764 CAAGATAATGAGAAACAAGATGG - Intergenic
943140289 2:183973924-183973946 CTAAATAAAAAGAACAAAGCTGG - Intergenic
943241904 2:185396027-185396049 CTTAATAGTGAGAAGACAGCAGG - Intergenic
943631449 2:190257382-190257404 TAAAATAAGCAGAAGAAAGGAGG + Intronic
943687272 2:190831673-190831695 AAAAAGAAGAAGAAGAAAGCCGG + Intergenic
943920195 2:193697671-193697693 CAGACTAATGAAAAGAAAGCAGG - Intergenic
944179754 2:196877736-196877758 CAAAATAATCAGAAAAATGTAGG - Intronic
944793282 2:203155414-203155436 CAAAAAAAGGAAAAGAAAGAAGG - Intronic
944806971 2:203292455-203292477 CAAAAGAAAGAGAAGAAAAGGGG - Intronic
944925568 2:204460586-204460608 CAAGATAATGTGAGGAAAGGTGG + Intergenic
945581492 2:211601145-211601167 AAAAATGATGACAAGAAAGATGG + Intronic
945654212 2:212604281-212604303 CAAATTAATGGAAACAAAGCTGG - Intergenic
945987555 2:216367452-216367474 AAAAAAAATGAGAAGAAACTGGG + Intronic
947075307 2:226337221-226337243 CAAAATGATGAGAAAGAAGAGGG - Intergenic
947157893 2:227181659-227181681 CAATATAATGTCAAAAAAGCCGG - Intronic
947287879 2:228537858-228537880 AAAAAAAATGAGAAAAAAGAAGG - Intergenic
947318248 2:228887587-228887609 GAAAATACTTATAAGAAAGCTGG - Intronic
947358933 2:229326602-229326624 GACACTAATGAGAAGAAAGCTGG + Intergenic
948343527 2:237275832-237275854 CTAAATAAAAAGAACAAAGCTGG + Intergenic
948678792 2:239616776-239616798 AAATCTAATGAAAAGAAAGCTGG - Intergenic
1169629642 20:7615870-7615892 CAGAATACTGAGAACAAAGTTGG + Intergenic
1169946254 20:10992161-10992183 CATAATAATAATAAGAAAGTGGG - Intergenic
1170517069 20:17141305-17141327 CAAAGTGATGAGAAGAACACTGG - Intergenic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1170729747 20:18963188-18963210 AAAAAAAAAGAAAAGAAAGCTGG - Intergenic
1170734640 20:19004287-19004309 TAAAATAATCAAAACAAAGCAGG - Intergenic
1170897443 20:20428685-20428707 CACAATAATGGGAAGAAATGAGG - Intronic
1171871860 20:30534282-30534304 AAATCTAATGAAAAGAAAGCAGG + Intergenic
1172111219 20:32546240-32546262 CAAAAAAAGGAAAAAAAAGCTGG - Intronic
1172447817 20:35002325-35002347 GAAAAGAATGAGAAGGAAACTGG - Exonic
1173155171 20:40602439-40602461 AAAGATAATGAAAAAAAAGCTGG - Intergenic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174618598 20:51856212-51856234 CAAAAAAAAAAAAAGAAAGCAGG - Intergenic
1174769044 20:53281252-53281274 CTAAATAATGAGAAGCAGCCAGG + Intronic
1174843893 20:53924635-53924657 CAAAAAAATGAAAAGATTGCTGG + Intergenic
1175155936 20:56971631-56971653 TAAAATGATGAGAAGATTGCTGG + Intergenic
1175606105 20:60313625-60313647 AATAATAATGAGAAGGAACCAGG + Intergenic
1176207610 20:63898117-63898139 CCAAATACTTAGAAGAAACCTGG - Intronic
1176228728 20:64019384-64019406 CAAAATAATAAGAGAAAAACAGG - Intronic
1176303405 21:5110628-5110650 CACATTAATCACAAGAAAGCTGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177044018 21:16146764-16146786 AAAAATAATGCCAAGAAAGGAGG - Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1177943471 21:27439838-27439860 AAAATTAAGGAGCAGAAAGCTGG - Intergenic
1178431796 21:32524150-32524172 CCAAACAAAGAGAGGAAAGCTGG + Intergenic
1178682611 21:34685535-34685557 TAAAACAAAGAGAACAAAGCTGG - Intronic
1178721895 21:35017721-35017743 CAGAACTATGAGAAGAAAGATGG - Intronic
1178737085 21:35162009-35162031 CAAAGTGCTGTGAAGAAAGCAGG - Intronic
1178819812 21:35964857-35964879 AATAATAATAAAAAGAAAGCTGG - Intronic
1179191148 21:39122511-39122533 CAAAATAATGATATTAAAGAAGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179257862 21:39732441-39732463 CAAAATCCTATGAAGAAAGCAGG - Intergenic
1179305717 21:40152445-40152467 GAAAGAAATGAGAAGAAATCAGG - Intronic
1179853628 21:44151322-44151344 CACATTAATCACAAGAAAGCTGG - Intergenic
1181361335 22:22339557-22339579 CAGAATAATGTGAAGAAATCTGG + Intergenic
1182012818 22:27014782-27014804 CCAAATAAAGAGAAGACAGCAGG - Intergenic
1182151354 22:28029304-28029326 CACAATAATGAGAGGAAACCAGG + Intronic
1183004739 22:34891703-34891725 CAAACTGAGAAGAAGAAAGCAGG - Intergenic
1184235369 22:43180357-43180379 TAAAATCATGAGAAACAAGCAGG + Intronic
1185159655 22:49215567-49215589 GAAAAAAATGAGAAGGAAGAAGG - Intergenic
949177152 3:1078464-1078486 CAAAATATTGAGAATCAGGCTGG + Intergenic
949540825 3:5030945-5030967 AAAAAAAAAGAGAAGAAAGAAGG + Intergenic
950096196 3:10332163-10332185 CAACAAAAAGGGAAGAAAGCTGG - Intronic
950339866 3:12233734-12233756 CAAAATGATGAGAGGAAAAAAGG + Intergenic
950641057 3:14348430-14348452 CAAAAAAAAGAAAAGAAAACAGG + Intergenic
951389810 3:22089221-22089243 TAATATAATGTGAAGAAAGTAGG - Intronic
951591768 3:24273502-24273524 CAACAAAATGAGAAGAAAAAGGG + Intronic
951891656 3:27573274-27573296 CAAAAGAGAGAGAAGAAAGGAGG - Intergenic
952284972 3:31959587-31959609 CTAGATAATGAGAAGCCAGCGGG + Intronic
952445479 3:33377257-33377279 CAAAATTCTGAGGAGAAAGTGGG - Exonic
953092174 3:39739406-39739428 CTAAATAAAAAGAACAAAGCTGG - Intergenic
954565489 3:51596415-51596437 AAAAATAACAAGAAGAAACCTGG + Intronic
954843749 3:53535703-53535725 CATAAAACTGAGATGAAAGCTGG + Intronic
954977845 3:54713540-54713562 CCAGATAATGAGAAGAAAAGAGG - Intronic
955208823 3:56921779-56921801 TAAAATGATGAGAAGAATGTGGG + Intronic
955432333 3:58860328-58860350 GAAAGCAATGACAAGAAAGCTGG + Intronic
955501547 3:59589424-59589446 CAATAAAATGAGGAGAAAGATGG + Intergenic
955779233 3:62465635-62465657 CATAATAATGAAGAGAAAGCCGG - Intronic
955865092 3:63373617-63373639 GAAAGTGATGGGAAGAAAGCAGG + Intronic
955867437 3:63399907-63399929 CAAAATAATGAGCAAAAAATGGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956217940 3:66869626-66869648 CAAAACAACTAGAACAAAGCAGG + Intergenic
956448285 3:69347115-69347137 CAAAATAAAGAGATGAATGAAGG + Intronic
957433851 3:80149358-80149380 CAAACTAATCAAAAGATAGCAGG - Intergenic
958169894 3:89925868-89925890 GGAAATAAAGAGAAGAAAGCGGG + Intergenic
958552145 3:95629798-95629820 CAAAATAATTATAAGAAAAAAGG + Intergenic
958746936 3:98147653-98147675 CAAAATAGCCAGAAGAAAGTTGG + Intergenic
958773448 3:98453776-98453798 TAAAAGAAAGAGAAGAAAGAGGG - Intergenic
959181869 3:102991173-102991195 GAAAATAAGAAGAAGAAAGAAGG - Intergenic
959428840 3:106226498-106226520 CTAAATAAGAAGAACAAAGCTGG + Intergenic
959822666 3:110755057-110755079 TAAAGTAATGAAAATAAAGCAGG + Intergenic
959896146 3:111608924-111608946 CAAAATACTAAGATGAAAGGTGG + Intronic
959900834 3:111660568-111660590 CAAAACAAAAAGAACAAAGCTGG + Intronic
960295246 3:115935076-115935098 CCAAATAATGAGAAAAAAAAAGG + Intronic
960929001 3:122825039-122825061 AAAAAGACTGATAAGAAAGCAGG - Intronic
961419778 3:126793058-126793080 AATACTAATGAAAAGAAAGCTGG - Intronic
961584622 3:127911738-127911760 GAAAAAAAAGAGAAGAAAGCTGG + Intergenic
962143512 3:132816113-132816135 CAAAATAATTAGTAGAAAATGGG - Intergenic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
963626274 3:147678114-147678136 TAAGACACTGAGAAGAAAGCAGG + Intergenic
964124761 3:153224431-153224453 CGAAATATTGAGAAGAAGGGAGG + Intergenic
964162130 3:153658257-153658279 CAAAATAAGATGAAGAAAGAGGG + Intergenic
964678877 3:159315979-159316001 TAAAAGAATGTGAAGAAAGTAGG - Intronic
964842134 3:161005866-161005888 TAAAATTATTAGAAGAAATCAGG + Intronic
965531086 3:169770021-169770043 TAAAATAAGGAGAAAAATGCTGG + Intergenic
966017734 3:175163490-175163512 CAAATTAATGTGAAGATAGAGGG + Intronic
966538633 3:181063953-181063975 CAAGGAAATGGGAAGAAAGCAGG - Intergenic
966578090 3:181526111-181526133 CACACTCATCAGAAGAAAGCTGG + Intergenic
967338100 3:188366859-188366881 CAAAACAGTGAGAAGACATCAGG - Intronic
967413487 3:189191589-189191611 GAAAATAATGAGATGCAAGAAGG - Intronic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
968315514 3:197720967-197720989 AAAAAAAATCAGAAGATAGCCGG - Intronic
968426241 4:525269-525291 CGAAATAAGTAGAAGAAACCAGG + Intronic
968678151 4:1896758-1896780 GAAAAAAAAGAGAAGAAAGAAGG - Intronic
970023832 4:11599302-11599324 AAAAAAAATGAGAGGAGAGCTGG + Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970187060 4:13467945-13467967 AACATTAATGAAAAGAAAGCTGG + Intronic
970342671 4:15122775-15122797 GAAAATAATTAGAAAAAAACAGG + Intergenic
970624243 4:17860158-17860180 CTAAATAAAAAGAACAAAGCTGG + Intronic
971657631 4:29369902-29369924 CAAAATCTTGAGAAGATAGGAGG - Intergenic
971704052 4:30016188-30016210 AAAATTAATAATAAGAAAGCTGG - Intergenic
972006646 4:34117769-34117791 GAAAAAAATCAGAATAAAGCAGG + Intergenic
972142634 4:35979414-35979436 CATAATAATGGAAAGAAAACAGG - Intronic
972469806 4:39393101-39393123 AAAATTAATGAGATGAAAGATGG + Intergenic
972506298 4:39723349-39723371 AAAAAAAAAGAGAAGACAGCAGG - Intronic
972600684 4:40569703-40569725 AAAAAAAATGAGAATAGAGCCGG - Intronic
973320635 4:48806898-48806920 AAAAAGAAAGAAAAGAAAGCTGG - Intronic
973627433 4:52787060-52787082 CAAAAGAATAACAAGAAACCAGG + Intergenic
974006791 4:56565917-56565939 AACAATAATAAAAAGAAAGCTGG - Intronic
974239066 4:59220934-59220956 TAATATAATGAAAAGAAAGAAGG - Intergenic
974900948 4:67997518-67997540 CTCACTAATGAGAAGAAAGGGGG - Intergenic
974967593 4:68781401-68781423 CATAATAAAATGAAGAAAGCCGG - Intergenic
975026444 4:69554805-69554827 CCAAATAAAAAGAAAAAAGCTGG + Intergenic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
975461665 4:74660578-74660600 CAAAATAATGTGATAAAAGATGG + Intergenic
975469303 4:74747002-74747024 CAGAATAGTGAGCAGAAAGAGGG + Intronic
976015935 4:80554431-80554453 CAAAATAAAGAGAACAAAGCTGG - Intronic
976096527 4:81514039-81514061 CAAAATATTGAGTAAAAAGAGGG + Intronic
976657504 4:87504629-87504651 CAAAATAACTAGAAAAAAGCTGG - Intronic
976673459 4:87679065-87679087 AAAAAAAAAGAGAAGAAAGATGG - Intergenic
976777193 4:88719627-88719649 GAAAAGAAGGAGAAGAAAGAAGG - Intergenic
976933081 4:90592662-90592684 CAAAATAATGAGAAGCATATGGG - Intronic
976988878 4:91338786-91338808 CAAAATAAAGACTAGAAAACTGG + Intronic
977051301 4:92131202-92131224 ACAAATAATAAGAAGAAAGGAGG + Intergenic
977072903 4:92415009-92415031 CAAAATAATAATAATAAGGCAGG - Intronic
977186670 4:93946900-93946922 GAAAATAATAAGAAGAATTCTGG + Intergenic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
977682033 4:99807441-99807463 AAAAAAAATGTGAAGAGAGCAGG - Intergenic
977940630 4:102854618-102854640 AAAACTAATAAAAAGAAAGCTGG - Intronic
978557233 4:109993796-109993818 GAAAAGAAAGAGAAGAGAGCTGG - Intronic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978608554 4:110510082-110510104 TTAAATAATCAGAATAAAGCAGG + Intronic
979166072 4:117533256-117533278 AAACATAATGGGAAGAAATCAGG + Intergenic
979193888 4:117897030-117897052 CAGCATAATGAGAAGAAACAGGG - Intergenic
979436273 4:120695989-120696011 AAAAATACTGTAAAGAAAGCTGG + Intronic
979780023 4:124639163-124639185 CAAAATACTGGAAAGAAATCAGG - Intergenic
979900196 4:126206220-126206242 CAAAGAAAAGAGAATAAAGCTGG - Intergenic
980060702 4:128125983-128126005 CAATATAATGTGAATAAAGGAGG - Intronic
980282905 4:130743292-130743314 CTAAATAAACAGAACAAAGCTGG - Intergenic
980650808 4:135712287-135712309 CATTATAATGAGAAAAATGCCGG - Intergenic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
981363903 4:143879005-143879027 AAAAATAATGAGAAGAAAGGAGG + Intronic
981374631 4:143999780-143999802 AAAAATAATGAGAAGAAAGGAGG + Intronic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981522681 4:145679892-145679914 CATAATTATGGCAAGAAAGCAGG - Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
982343073 4:154324900-154324922 TAAAATAATGAGATGAAAATTGG - Intronic
982578561 4:157148323-157148345 AAAATTAATGAGATAAAAGCTGG - Intronic
983358689 4:166699801-166699823 AAAAATAATGAGTAGAGAGATGG + Intergenic
983740908 4:171132439-171132461 CAAAATAATGAGAATAAGACAGG - Intergenic
984236233 4:177161978-177162000 CAAAAAAATGAGAAAAATTCAGG + Intergenic
984607149 4:181798448-181798470 CAATATAAAGTCAAGAAAGCTGG - Intergenic
984804889 4:183742879-183742901 AAAAATAATGAGAATAAAAATGG - Intergenic
984886983 4:184457849-184457871 CAAAAAAAAAAGAAAAAAGCTGG + Intronic
985130504 4:186734100-186734122 CAAAATAATCATAAGACAGTAGG - Intergenic
985205680 4:187533168-187533190 CAACAAACTGAGAAGAAACCTGG - Intergenic
985522486 5:383550-383572 AAAAAAAAAGAAAAGAAAGCTGG - Intronic
985687004 5:1287094-1287116 CAAAAAAATGAAAATAAATCAGG + Intronic
985692425 5:1320859-1320881 CAACAAAAAGAGCAGAAAGCCGG + Intronic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
986235603 5:5907269-5907291 AACAGTAATGAAAAGAAAGCTGG - Intergenic
986507148 5:8463918-8463940 GAAACAAATGAGAAAAAAGCAGG + Intergenic
986926323 5:12757178-12757200 GAAAATAAGGAGAAAAAAGAGGG + Intergenic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987990564 5:25206116-25206138 CAAAATAATAAACAGAAATCTGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988869457 5:35372916-35372938 AAAAAGAAAGAGAAGCAAGCAGG - Intergenic
989155157 5:38337981-38338003 CAAAATAATGTAAAGTAAGAAGG + Intronic
989817539 5:45754392-45754414 AAAAATAATCAAAAGAAAGCAGG - Intergenic
990350173 5:54908330-54908352 GAAAAAAATAAGAAGAGAGCTGG + Intergenic
990352691 5:54934695-54934717 GGGAAGAATGAGAAGAAAGCAGG + Intergenic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
990757079 5:59085429-59085451 CAAAATAATAATAAGCAAGGGGG - Intronic
992446323 5:76837498-76837520 AAAAATAATGAGAAACAGGCAGG - Intergenic
992550988 5:77859826-77859848 CTAAAAAATTTGAAGAAAGCAGG + Intronic
993053428 5:82952356-82952378 CAAAAATAAGAGAAGAAAGAAGG + Intergenic
993220751 5:85093724-85093746 CTAAACAAAGAGAACAAAGCTGG + Intergenic
993497610 5:88625352-88625374 AAAAGTAATGAAAAGAGAGCAGG + Intergenic
993510289 5:88762566-88762588 AAAAATAATAATAATAAAGCAGG - Intronic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
993959475 5:94279548-94279570 AAAAAGAATGGGAAGAAAGGCGG - Intronic
993992619 5:94678489-94678511 TAAAATAATGAGAAAATACCTGG - Intronic
994308379 5:98236117-98236139 CTAAGTAATAAGAACAAAGCTGG - Intergenic
994324510 5:98434470-98434492 CAAAATAATGAGAGGATAAGAGG + Intergenic
994548103 5:101195300-101195322 CAAAATACTTGGCAGAAAGCAGG - Intergenic
994603851 5:101942558-101942580 GAAAATCATGAGAAGATTGCTGG - Intergenic
994824072 5:104690690-104690712 CAAAATAATCAGGTGAAAGCTGG - Intergenic
995244654 5:109922214-109922236 TAAAATAATCAAAACAAAGCAGG + Intergenic
995274894 5:110266881-110266903 CAAAACTATTAGAAGAAAGCTGG - Intergenic
995292772 5:110477435-110477457 CACAATAATACAAAGAAAGCTGG - Intronic
995684122 5:114752375-114752397 AACAATAATCAAAAGAAAGCTGG - Intergenic
995978282 5:118069733-118069755 CAGAATAATGAGAAGCCAGTAGG - Intergenic
996034327 5:118740949-118740971 TAAAATAAAGGGAAGAAACCAGG + Intergenic
996949318 5:129107104-129107126 CAAATAAATGAGAAGAATACTGG + Intronic
997461834 5:134058181-134058203 CAAAATAGTGAGAAGCAACTGGG - Intergenic
997728590 5:136144994-136145016 TAAAAGAATGAGAACAAAGGAGG + Intronic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
997970182 5:138395152-138395174 GAAAATACTGAGAAGGCAGCTGG + Intronic
998405420 5:141871683-141871705 CAAGATGGTGAGCAGAAAGCAGG + Intronic
998702866 5:144724318-144724340 GAAAAAGAGGAGAAGAAAGCTGG - Intergenic
999982239 5:156968697-156968719 CAAAATAAATAGAAGAATACTGG + Intergenic
1000073141 5:157759881-157759903 CAAAATACTGAGAGTAAAGGAGG - Exonic
1000500974 5:162049274-162049296 TAAAATTATGAGAAAAAAGTAGG + Intergenic
1001337043 5:170807526-170807548 CAAAATCAAGAAAATAAAGCAGG + Intronic
1002129041 5:177068243-177068265 CAAAATTATGAGAAAAATGGAGG - Intronic
1002203094 5:177542649-177542671 GAAAAACATGAGAAGAAAGTGGG - Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002857143 6:1048046-1048068 CAAACTCCTGAGCAGAAAGCGGG - Intergenic
1002970477 6:2012455-2012477 AACACTAATGAAAAGAAAGCTGG + Intronic
1003381803 6:5631118-5631140 CAAAATAAGAGAAAGAAAGCTGG + Intronic
1003456414 6:6286791-6286813 CAAGATACTGAGAAGAAAGAGGG + Intronic
1003574313 6:7278720-7278742 GAAGATAATGAGAACAGAGCAGG + Intronic
1004526604 6:16414799-16414821 CAACATATTGAGTAGAAAGAAGG - Intronic
1005342083 6:24852500-24852522 CAAAATAATGACATGACAACTGG + Intronic
1005732711 6:28713978-28714000 AGAAATAATGAGAAGTAAGCCGG - Intergenic
1005903371 6:30238931-30238953 CAAAATAATAACAATAAAGAGGG - Intergenic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1005967009 6:30733747-30733769 AAAAAAAAAGAAAAGAAAGCTGG + Intronic
1006081402 6:31569494-31569516 TAAAAGAATGAGAAGAAGGTTGG + Intergenic
1006840100 6:37022988-37023010 GAAAATGATGATAAGAATGCAGG - Intronic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1007136002 6:39522411-39522433 CAAGATATTGAGAAGAAATTAGG - Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008657758 6:53633287-53633309 CAAAAAAAAGAAAAAAAAGCTGG - Intergenic
1008768663 6:54951724-54951746 CAAGTAAATGAGAAGAAAACTGG + Intergenic
1009462292 6:63928471-63928493 CAAAATAATTTGAAGTAAGGAGG + Intronic
1009782855 6:68292953-68292975 CAACATACTGAGAAGTCAGCTGG + Intergenic
1009842628 6:69095491-69095513 GAAAATAATGAAAATGAAGCTGG + Intronic
1010130722 6:72490522-72490544 CAAAATAATTAAAAGAAATATGG + Intergenic
1010573108 6:77502019-77502041 GAAAATGAAGAGAGGAAAGCAGG - Intergenic
1011831111 6:91372680-91372702 CTAATTAAAAAGAAGAAAGCTGG - Intergenic
1011855418 6:91683601-91683623 CAATAAAATGATAAGAAAACAGG - Intergenic
1012114327 6:95276276-95276298 CCAAATAAATAGAATAAAGCAGG - Intergenic
1012193627 6:96312394-96312416 CAAAATAATGTGCAGAAAAATGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1014015500 6:116525557-116525579 CAAAATTATAAAAAGATAGCTGG - Intronic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014243467 6:119042233-119042255 CAGGATAATGGGAAGAAAGGGGG + Intronic
1014683998 6:124472027-124472049 CAAAATGATGAAAAGAAATTGGG - Intronic
1014874900 6:126645428-126645450 CAAAATCAAAAGAAGAAAGGTGG - Intergenic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015268149 6:131309503-131309525 AAAAATAATGAGGAGAAACAAGG + Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1016041986 6:139441158-139441180 CACAATAGTGGGAGGAAAGCAGG + Intergenic
1016578070 6:145593288-145593310 CAAAATAATGAGACTAAAACTGG + Intronic
1016774125 6:147885591-147885613 CAAAAAATTTAGAAGCAAGCAGG + Intergenic
1017475232 6:154784066-154784088 CAAAAAAATAAAAAGAAAGATGG + Intronic
1017925180 6:158905171-158905193 CAAAATGATGGGAAAATAGCAGG + Intronic
1018130420 6:160725781-160725803 AATAAGAATCAGAAGAAAGCTGG + Intronic
1018574644 6:165246855-165246877 TAAAAAAATAAAAAGAAAGCTGG - Intergenic
1019003274 6:168773837-168773859 TAAAGCAATGATAAGAAAGCTGG - Intergenic
1019098285 6:169605659-169605681 CTAAATAAAAAGAACAAAGCTGG + Intronic
1019693449 7:2431307-2431329 AATATTAATGAAAAGAAAGCAGG - Intronic
1020264035 7:6548535-6548557 CAAAATAATGTAAAAAAAGTTGG + Intronic
1020561291 7:9730761-9730783 GGAAAGAATGAGAAGAAAGCTGG + Intergenic
1020921057 7:14264849-14264871 CAAAATCATGAGAAAAATGGGGG + Intronic
1021061202 7:16115056-16115078 AAAAATAATTAGAATCAAGCAGG + Intronic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1022024998 7:26440104-26440126 CAAATTATTATGAAGAAAGCAGG + Intergenic
1022075861 7:26969613-26969635 CTAAATAAAAAGAACAAAGCTGG - Intronic
1022159261 7:27692452-27692474 CAAAAAAATGAAAAATAAGCTGG + Intergenic
1022550550 7:31235256-31235278 AAAAATAAAAAGAAGAAAGAAGG - Intergenic
1023159754 7:37285673-37285695 CAAAAGAAGGGGAAAAAAGCAGG + Intronic
1024023766 7:45393965-45393987 GAAAATAAATAGAATAAAGCGGG - Intergenic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1024237456 7:47409090-47409112 GAAAATAATGAGGAGGAAGGAGG + Intronic
1024375719 7:48636125-48636147 TACAATAATGAGAAGAAAGCAGG - Intronic
1024736243 7:52307882-52307904 AAAATTAATGAGGAGAAAGTGGG - Intergenic
1024827109 7:53403643-53403665 GAAAATCATTAGAAGTAAGCAGG - Intergenic
1024849510 7:53694409-53694431 AACACTAATGAAAAGAAAGCTGG + Intergenic
1024859974 7:53827400-53827422 CAAAGGAAAAAGAAGAAAGCTGG + Intergenic
1025844577 7:65184822-65184844 TACAACCATGAGAAGAAAGCCGG - Intergenic
1025894905 7:65691160-65691182 TACAACCATGAGAAGAAAGCCGG - Intergenic
1026328951 7:69335565-69335587 AAAAAGAATGAGGAGAATGCAGG - Intergenic
1026865899 7:73823870-73823892 CAAAAAAATAAGAAGTTAGCTGG + Intronic
1027419914 7:78008795-78008817 CAGAATAATAGGAAGAAAGGGGG + Intergenic
1028143560 7:87297510-87297532 CTAAATAAAAAGAAAAAAGCAGG + Intergenic
1028658157 7:93234792-93234814 CAAAATAATGGGAGGAAGGAAGG + Intronic
1028848494 7:95510129-95510151 AAAAAAAATGAGAAGGCAGCTGG + Intronic
1028901874 7:96110344-96110366 CAAAATTATGAATAAAAAGCTGG - Intergenic
1029184334 7:98727777-98727799 CCAAAAAAGGAAAAGAAAGCAGG - Intergenic
1029918483 7:104237075-104237097 CAAAATAATGAGAAGTGATAAGG + Intergenic
1030249236 7:107423898-107423920 AAAAATAATGAAAAGAATGCAGG + Intronic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030766392 7:113415162-113415184 CAATAAAATGAGAAAAAATCTGG + Intergenic
1030885338 7:114929762-114929784 TGCACTAATGAGAAGAAAGCCGG + Intronic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031765868 7:125776898-125776920 GAAAATAATGGGAAGAAAAGTGG - Intergenic
1032730343 7:134635889-134635911 CAAACTAAAGAGAAAAAAGTTGG - Intergenic
1032954528 7:136955174-136955196 CAAAATCATGAGAAAGAAGGAGG - Intronic
1032981437 7:137288338-137288360 TAAAATAATGAGAGGAACTCAGG + Intronic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1034012552 7:147545709-147545731 CAAACCTATGTGAAGAAAGCTGG - Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034207525 7:149330674-149330696 CTAAATATTGAGAAGAAATAAGG - Intergenic
1034608865 7:152345944-152345966 AAAAATAATCAAAAGAAAGCAGG + Intronic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1036199786 8:6759745-6759767 AAAAATATTGTGAAGAATGCAGG - Intergenic
1036708436 8:11061768-11061790 CCAAAGAATGAGAAGAAGGAAGG + Intronic
1036772278 8:11587470-11587492 AAAAGGAATGAGAAAAAAGCAGG - Intergenic
1037070883 8:14647321-14647343 CAAAATATTGAGAAGAAAATAGG + Intronic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1037382352 8:18299990-18300012 CAAAAAAATGAAAAGAAAATCGG - Intergenic
1038997727 8:32944748-32944770 CAAAATAATGATATTAAAGAAGG - Intergenic
1039257591 8:35735888-35735910 CAAAAGAGTAAAAAGAAAGCAGG + Intronic
1039524275 8:38199821-38199843 AAAAATTCTGAGAAGAAATCGGG - Intronic
1040396412 8:47004695-47004717 AACAATAATCAAAAGAAAGCAGG - Intergenic
1040870592 8:52096882-52096904 CTAAGGAGTGAGAAGAAAGCAGG - Intergenic
1041405794 8:57497903-57497925 CAGAATAATTAGGAGAAATCGGG + Intergenic
1041709483 8:60880289-60880311 AAAAAGAAAAAGAAGAAAGCAGG - Intergenic
1042463588 8:69100155-69100177 TAATATAATGAGAAGAATACAGG - Intergenic
1043007011 8:74832264-74832286 CAAAATAAAGAGCAGAATTCTGG + Intronic
1043145189 8:76644764-76644786 AAAAAAAAAAAGAAGAAAGCTGG + Intergenic
1043358910 8:79446589-79446611 CAAAATTATAAAAAGAAAGAAGG + Intergenic
1043384773 8:79737534-79737556 CAAAAAAAAGAAAAGAAATCTGG + Intergenic
1043756008 8:84005228-84005250 CAATATAATTAGGATAAAGCTGG - Intergenic
1044146566 8:88722906-88722928 ATAGATAATGAAAAGAAAGCAGG - Intergenic
1044623577 8:94214540-94214562 TAAAATTCTAAGAAGAAAGCAGG + Intronic
1044770816 8:95631151-95631173 AAAAATAACTACAAGAAAGCTGG - Intergenic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1045724390 8:105155202-105155224 CAAAATACTGAGAAAAATACTGG - Intronic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1046865932 8:119150320-119150342 CAAAATAATGGGAAAAAATTTGG - Intergenic
1047241769 8:123096503-123096525 TAAAATAAGGTGATGAAAGCTGG - Intronic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047361702 8:124175138-124175160 CAAACTGATGAGAAGAAAGGAGG + Intergenic
1047607890 8:126492806-126492828 CTAACTAAGAAGAAGAAAGCAGG - Intergenic
1050001483 9:1082068-1082090 AAATATAATAATAAGAAAGCAGG + Intergenic
1050061052 9:1710205-1710227 GAAAAAAAAGAGAAGAAAGAAGG - Intergenic
1050488260 9:6158680-6158702 CAAATTAATGAGAAAAAAAAAGG - Intergenic
1051970053 9:22877404-22877426 AAAAATAATAATAAGAAAGTCGG + Intergenic
1052255614 9:26452743-26452765 GAAGATAATGAAAAGAAATCTGG + Intergenic
1053322227 9:37109323-37109345 TAAAACTATTAGAAGAAAGCAGG + Intergenic
1053902774 9:42811427-42811449 GAAAGGTATGAGAAGAAAGCAGG - Intergenic
1054606075 9:67179689-67179711 AACAATAATCAGAAGAAATCCGG - Intergenic
1055535818 9:77243121-77243143 CAAAATAAAAGGAAGAAAGGAGG - Intronic
1055869957 9:80864624-80864646 AAAACTAATGAGAAAAAAGCTGG - Intergenic
1056002564 9:82232420-82232442 CACTATAATGAGAAGCAAGGGGG + Intergenic
1056315793 9:85388695-85388717 AAATATGATGAGAAGAAAGAAGG - Intergenic
1056481896 9:87014005-87014027 CAAAGTGATGATAAGAAAGGGGG + Intergenic
1057104924 9:92405674-92405696 CAAGATATTGAGAAGTAAGCTGG + Intronic
1057486570 9:95489508-95489530 CAAAAAAATGAAAAGTTAGCTGG - Intronic
1057594141 9:96400427-96400449 AAAAAGAATGACAAGAAACCAGG + Intronic
1058337131 9:103844065-103844087 AAAAATTATGAGAAAAATGCTGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1060022966 9:120148103-120148125 CGAAATGATGAAAAGAAAGAGGG + Intergenic
1060180405 9:121529789-121529811 CAGGAGAGTGAGAAGAAAGCTGG + Intergenic
1060761852 9:126259313-126259335 CAAATTAATAAGAAGAAAAATGG - Intergenic
1060888424 9:127172718-127172740 CAAAGGAATGAGAAGAAAAAAGG - Intronic
1061642287 9:131968641-131968663 TAAAATAATGGGAAGAAAGATGG - Intronic
1061767950 9:132894180-132894202 AAAAATAAAGGGAAGAAAGGAGG - Exonic
1062434525 9:136540974-136540996 CAAAACAAAGAGAAAAAAGGTGG + Intronic
1062588417 9:137261768-137261790 CAAAGAAATGAAAAGACAGCTGG + Intronic
1062704304 9:137927231-137927253 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
1185672353 X:1823275-1823297 CAAAATAATAAGGAAAAAGGGGG - Intergenic
1185912347 X:3993968-3993990 GAAAAGAATGAGGAGAAAGAGGG - Intergenic
1186253437 X:7694071-7694093 CAAAATATAGAAAAGAAAGAGGG + Intergenic
1186952354 X:14641194-14641216 GAAAATAATGAGCAAAAAGTTGG - Intronic
1187713004 X:22073134-22073156 CAATATCCTGAGAAGCAAGCAGG + Intronic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189183463 X:39028328-39028350 GAATACAATGAGAAGAAAACAGG - Intergenic
1189542004 X:42001676-42001698 CAAAAAAATTAAAAGAAAGCTGG - Intergenic
1189567177 X:42254974-42254996 CAAAGAAGTGAGAAAAAAGCTGG - Intergenic
1189660421 X:43291106-43291128 CAAAAAAACAAGAAGAAAACGGG - Intergenic
1190307237 X:49091441-49091463 AAAAATAAAGAAAAGAAAGAAGG + Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1190834975 X:54092245-54092267 GAAAAAAATGAAAAGAAGGCTGG + Intronic
1192742684 X:73908624-73908646 TAAAATAAAAAGAATAAAGCTGG - Intergenic
1193003292 X:76587039-76587061 CTAAACAAAGAGAACAAAGCTGG - Intergenic
1193128661 X:77896470-77896492 CAAAATAATGAATAAAAAGAAGG - Intergenic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1193650532 X:84125556-84125578 AAAAATAAAGAGAAAAAGGCTGG + Intronic
1194046033 X:89004516-89004538 CAAAAAAGTGAAAAGAAAACTGG + Intergenic
1194115648 X:89893444-89893466 CTAAATAATGAAAAAAAATCAGG + Intergenic
1194208873 X:91044525-91044547 CAAAACAAAAAGAACAAAGCTGG + Intergenic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1194589576 X:95782426-95782448 CATACTAATCAGAAGAAAGTTGG + Intergenic
1194833249 X:98651352-98651374 AAAAATATTAAGAAGAAAGAAGG - Intergenic
1194867839 X:99090552-99090574 CTAAACAAAGAGAACAAAGCTGG + Intergenic
1195306948 X:103593168-103593190 TACACTAATGAAAAGAAAGCTGG - Intergenic
1195781125 X:108465698-108465720 CCAAATATCTAGAAGAAAGCAGG - Intronic
1195852226 X:109295599-109295621 CGAGATACTGAGAAAAAAGCTGG - Intergenic
1196014794 X:110927278-110927300 GAAAATAATGAAACCAAAGCTGG + Intergenic
1196153597 X:112402912-112402934 CTAAATAAAGGAAAGAAAGCAGG + Intergenic
1196485394 X:116201172-116201194 CAAAATAATAAGAAGATGGCAGG - Intergenic
1196578050 X:117344053-117344075 TATAATAATGAGGAAAAAGCTGG + Intergenic
1196677197 X:118432191-118432213 CAAAACAAAGAGTACAAAGCAGG - Intronic
1196820604 X:119697425-119697447 GAAAAGAAAGAGAAGAAAGTTGG + Intergenic
1197030926 X:121814531-121814553 AACATTAATCAGAAGAAAGCAGG - Intergenic
1197662089 X:129185218-129185240 CAAAATAAGCAGAAGACAGTGGG + Intergenic
1197999836 X:132421832-132421854 TAAAATGATAACAAGAAAGCAGG + Intronic
1198078045 X:133213038-133213060 CAAAATAAAAAAAAAAAAGCTGG + Intergenic
1198205573 X:134461202-134461224 AAAAATAATCATAATAAAGCAGG - Intronic
1198446257 X:136718186-136718208 CATACTAATCAAAAGAAAGCTGG + Intronic
1198499970 X:137234262-137234284 GAAAATAAAGAGAACAAAGAGGG - Intergenic
1198686303 X:139231200-139231222 AAAAATAATAATAAAAAAGCAGG + Intergenic
1199327762 X:146520964-146520986 CAATATAATCAAAAGAAAGCAGG + Intergenic
1199513929 X:148654710-148654732 CATTAGAATGAGAACAAAGCAGG + Intronic
1199674701 X:150178028-150178050 AAAAATAAAGAGAAAAAAGGGGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200428526 Y:3048775-3048797 CTAAGTAAAGAGAACAAAGCTGG - Intergenic
1200468442 Y:3550579-3550601 CTAAATAATGAAAAAAAATCAGG + Intergenic
1200690106 Y:6299031-6299053 CAATATAATGAAAAGAAAAGTGG + Intergenic
1200803212 Y:7405519-7405541 CAAAGTAATGGGAAAAAAGATGG + Intergenic
1200960115 Y:8988747-8988769 CAAAATAAGGAAATAAAAGCAGG + Intergenic
1201045167 Y:9875685-9875707 CAATATAATGAAAAGAAAAGTGG - Intergenic
1201316903 Y:12656295-12656317 CAAAAACATGAAAAGAAGGCAGG - Intergenic
1201432756 Y:13921912-13921934 TAAAATAATGTGAAGGAAGTTGG - Intergenic
1201470276 Y:14325701-14325723 CAAAATATAGAAAAGAAAGAGGG + Intergenic