ID: 1002319854

View in Genome Browser
Species Human (GRCh38)
Location 5:178368609-178368631
Sequence CACACCATAGTGACTTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002319846_1002319854 0 Left 1002319846 5:178368586-178368608 CCATCCATATACCTCTCCCTCCC 0: 1
1: 0
2: 6
3: 101
4: 1290
Right 1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG No data
1002319845_1002319854 19 Left 1002319845 5:178368567-178368589 CCTAAAAGTAGTCTAAGCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG No data
1002319843_1002319854 26 Left 1002319843 5:178368560-178368582 CCACTGCCCTAAAAGTAGTCTAA 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG No data
1002319844_1002319854 20 Left 1002319844 5:178368566-178368588 CCCTAAAAGTAGTCTAAGCTCCA 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG No data
1002319847_1002319854 -4 Left 1002319847 5:178368590-178368612 CCATATACCTCTCCCTCCCCACA 0: 1
1: 0
2: 10
3: 70
4: 1068
Right 1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002319854 Original CRISPR CACACCATAGTGACTTGAGC AGG Intronic
No off target data available for this crispr