ID: 1002322390

View in Genome Browser
Species Human (GRCh38)
Location 5:178383526-178383548
Sequence TGCTGGTTACCCCATTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002322383_1002322390 4 Left 1002322383 5:178383499-178383521 CCTGCAGGCCTGGCACCCAATTT 0: 1
1: 0
2: 1
3: 20
4: 271
Right 1002322390 5:178383526-178383548 TGCTGGTTACCCCATTCTCCAGG No data
1002322382_1002322390 7 Left 1002322382 5:178383496-178383518 CCACCTGCAGGCCTGGCACCCAA 0: 1
1: 1
2: 1
3: 39
4: 296
Right 1002322390 5:178383526-178383548 TGCTGGTTACCCCATTCTCCAGG No data
1002322386_1002322390 -4 Left 1002322386 5:178383507-178383529 CCTGGCACCCAATTTGGGATGCT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1002322390 5:178383526-178383548 TGCTGGTTACCCCATTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002322390 Original CRISPR TGCTGGTTACCCCATTCTCC AGG Intronic
No off target data available for this crispr